Non-human animal that lacks kng1 gene and kng2 gene

Abstract

Provided is a non-human animal that is useful for analysis of a kallikrein-kinin system. A non-human animal that lacks the Kng1 gene and the Kng2 gene.

Description

Non-human animals deficient in the Kng1 gene and the Kng2 gene

[0001] The present invention relates to gene-deficient non-human animals and the like.

[0002] In the kallikrein-kinin system (KK system), the enzyme kallikrein limitedly degrades the kinin precursor protein kininogen (KNG), and the released kinin binds to receptors, expressing physiological activities such as inflammation and vasodilation. However, the current situation is far from elucidating the whole picture of the KK system. To elucidate the whole picture of the KK system, knockout mice (KO mice) with the Kng gene disrupted are required. For example, in mice, there are two Kng genes that are close to each other on the chromosome (Kng1 and Kng2), and it has been difficult to generate KO of both genes by conventional methods.

[0003] Although Kng1-deficient mice have been reported in Non-Patent Document 1, it is not described that both Kng1 and Kng2 are deficient.

[0004] Blood. 2008 Feb 1;111(3):1274-81. doi: 10.1182 / blood-2007-06-092338. Epub 2007 Nov 13.

[0005] An object of the present invention is to provide a non-human animal useful for analyzing the kallikrein-kinin system.

[0006] In view of the above problems, the present inventors have conducted intensive research and succeeded in deleting both Kng1 and Kng2, and have found that the above problems can be solved if it is a non-human animal deficient in the Kng1 gene and the Kng2 gene. That is, the present invention includes the following aspects.

[0007] Item 1. A non-human animal deficient in the Kngl gene and the Kng2 gene.

[0008] Item 2. The non-human animal according to Item 1, which is a mammalian animal.

[0009] Item 3. The non-human animal according to Item 1 or 2, in which the Kng1 gene and the Kng2 gene have insertion mutations.

[0010] Item 4. A non-human animal as described in Item 3, wherein the insertion mutation results in the appearance of a stop codon in the N-terminal region.

[0011] Item 5. The non-human animal described in Item 4, wherein the N-terminal region is exon 1.

[0012] Item 6. A non-human animal as described in any of items 1 to 5, which is at least one selected from the group consisting of hypertension model animals, inflammation model animals, cancer model animals, autoimmune disease model animals, allergy model animals, and aging model animals.

[0013] Item 7. Cells lacking the Kng1 and Kng2 genes.

[0014] Item 8. A fertilized egg that develops in any of the non-human animals described in items 1 to 6.

[0015] Item 9. A screening method for at least one preventive and / or therapeutic agent, or a candidate substance, selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging, comprising the step of (a) bringing a test substance into contact with a non-human animal as described in any of items 1 to 6, a fertilized egg developing in the non-human animal, or a cell as described in item 8.

[0016] Item 10. (b) The screening method according to item 9, further comprising a step of evaluating the phenotype after step a.

[0017] According to the present invention, a non-human animal lacking the Kng1 gene and the Kng2 gene can be provided as a non-human animal useful for analyzing the kallikrein kinin system.

[0018] The first example shows the results of measuring the levels of kininogen and kinin in the plasma of WT mice and DKO mice. The vertical axis shows the kinin (bradykinin) equivalent. * indicates that the P-value between the two groups is less than 0.05. The second example shows the results of measuring blood pressure in WT mice and DKO mice. The vertical axis shows the systolic blood pressure. * indicates that the P-value between the two groups is less than 0.05.

[0019] 1. Definitions In this specification, the terms “contains” and “includes” include the concepts of “contains,” “includes,” “substantially consist of,” and “consist solely of.”

[0020] The "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA and its default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87:2264–2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90:5873–7 (1993)). A program called BLASTX has been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the 'identity' of a nucleotide sequence is defined in accordance with the above.

[0021] In this specification, "conservative substitution" means that an amino acid residue is substituted for an amino acid residue having a similar side chain. For example, substitutions between amino acid residues having basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. Other examples of conservative substitutions include amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine.

[0022] 2. Non-human animals and cells In one embodiment, the present invention relates to a non-human animal (sometimes referred to as "the non-human animal of the present invention" in this specification) that lacks the Kng1 gene and the Kng2 gene. This will be described below.

[0023] The animals used are not particularly limited and include mammals (non-human animals) such as monkeys, mice (Mus species), rats, dogs, cats, rabbits, pigs, horses, cattle, sheep, goats, and deer. Among these, animals that can be used as experimental animals are preferred, Mus species are more preferred, and Mus musculus is even more preferred. The mammals may be strains or hybrids. Examples of strains for mice include C57BL / 6, C3H, ICR, and BALB / c, but C57BL / 6 is preferred.

[0024] The Kng1 (kininogen 1) gene is a gene that codes for a protein that releases kinin through degradation by kallikrein. In various animals, the nucleotide sequence and amino acid sequence of the Kng1 gene are publicly known or can be easily determined based on the nucleotide sequence and amino acid sequence of known Kng1 genes (for example, by identity analysis). For example, the mouse Kng1 gene is a gene identified by NCBI Gene ID: 16644, and its amino acid sequence is, for example, the amino acid sequence (SEQ ID NO: 17) identified by NCBI RefSeq accession number: NP_001095881.1, and its mRNA sequence is, for example, the nucleotide sequence (SEQ ID NO: 18) identified by NCBI RefSeq accession number: NM_001102411.1.

[0025] The Kng2 (kininogen 2) gene is a gene that codes for a protein that releases kinin through degradation by kallikrein. In various animals, the nucleotide sequence and amino acid sequence of the Kng2 gene are publicly known or can be easily determined based on the nucleotide sequence and amino acid sequence of known Kng2 genes (for example, by identity analysis). For example, the mouse Kng2 gene is a gene identified by NCBI Gene ID: 385643, and its amino acid sequence is, for example, the amino acid sequence (SEQ ID NO: 19) identified by NCBI RefSeq accession number: NP_958763.1, and its mRNA sequence is, for example, the nucleotide sequence (SEQ ID NO: 20) identified by NCBI RefSeq accession number: NM_201375.2.

[0026] The Kng1 / Kng2 genes targeted by this invention include functionally normal mutants that may occur in nature. The Kng1 / Kng2 genes targeted by this invention may have base mutations such as substitutions, deletions, additions, and insertions, as long as the encoded protein can be degraded by kallikrein and release kinin. Preferred mutations are those that do not result in amino acid substitutions in the protein translated from the mRNA, or mutations that result in conservation substitutions of amino acids.

[0027] The Kng1 / Kng2 gene targeted by the present invention is, for example, a gene whose encoded protein amino acid sequence is identical, for example, 95% or more, preferably 98% or more, and more preferably 99% or more, to the amino acid sequence of the protein encoded by the wild-type Kng1 / Kng2 gene of the same animal species. Furthermore, the Kng1 / Kng2 gene targeted by the present invention is, for example, a gene whose encoded protein amino acid sequence is identical to the amino acid sequence of the protein encoded by the wild-type Kng1 / Kng2 gene of the same animal species, or is an amino acid sequence in which one or more (for example, 2 to 10, preferably 2 to 5, more preferably 2 to 3, even more preferably 2) amino acids are substituted, deleted, added, or inserted into the said amino acid sequence.

[0028] In the non-human animals of the present invention, the Kng1 / Kng2 gene targeted by the present invention is deficient. That is, in the non-human animals of the present invention, a mutation has been introduced into the Kng1 / Kng2 gene so that it cannot express a functionally normal protein. "Deficient" means that kininogen and kinin are not detected in the sample obtained from the non-human animals of the present invention. For example, the measured amounts of kininogen and kinin in the sample obtained from the non-human animals of the present invention are, for example, 1 / 100, 1 / 200, 1 / 500, 1 / 1000, 1 / 2000, 1 / 5000, and 1 / 10000 or less compared to the same measured amount in wild-type animals of the same species. The amounts of kininogen and kinin can be measured by the method described in Test Example 1.

[0029] The mutations introduced into the Kng1 / Kng2 genes are preferably insertion mutations. The base length of the insertion sequence is preferably 4 to 200, more preferably 8 to 100, and even more preferably 12 to 80. The base length of the insertion sequence in Kng1 is even more preferably 12 to 50, and particularly preferably 12 to 30. The base length of the insertion sequence in Kng2 is even more preferably 20 to 80, and particularly preferably 40 to 70.

[0030] In the Kng1 / Kng2 genes, it is preferable that a mutation (preferably an insertion mutation) results in the appearance of a stop codon in the N-terminal region. This prevents kinin production from the resulting protein, thereby achieving deletion of the Kng1 / Kng2 genes.

[0031] The site of the mutation (preferably an insertion mutation), the N-terminal region, is preferably one of exons 1 to 5, more preferably one of exons 1 to 3, even more preferably exon 1 or 2, and even more preferably exon 1.

[0032] In the non-human animals of the present invention, it is preferable that the mutation is present in both chromosomes of the pair.

[0033] Furthermore, in one embodiment, the present invention relates to cells (which may be referred to herein as "the cells of the present invention") that lack the Kng1 and Kng2 genes. The cells are not particularly limited, but examples include blood cells, hematopoietic stem cells / progenitor cells, gametes (sperm, egg), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratin-producing cells, muscle cells, epidermal cells, endocrine cells, immune cells, ES cells, iPS cells, tissue stem cells, cancer cells, etc. The cells may be primary cultured cells, their passaged cells, or cell lines.

[0034] 3. Method for Producing Non-Human Animals The method for producing non-human animals of the present invention is not particularly limited, and various known techniques for producing genetically modified animals can be used. Preferably, the following methods are used.

[0035] In one embodiment, the present invention relates to a method for producing mutant non-human animals (which may be referred to herein as "the production method of the present invention") that includes introducing mutations that cause deletion of the Kng1 gene and the Kng2 gene in a non-human animal.

[0036] The cells to be subjected to mutation introduction are not particularly limited, but from the viewpoint of efficiency in producing mutant non-human animals, fertilized eggs or early embryos are preferred.

[0037] The method for introducing mutations is not particularly limited, but from the viewpoint of efficiency in producing mutant non-human animals, one method is to introduce into cells an introduction product that includes at least one selected from the group consisting of a target-specific nuclease, an expression cassette of the nuclease, and the mRNA of the nuclease.

[0038] Target-specific nucleases are not particularly limited as long as they are nucleases that can specifically cleave a particular site on genomic DNA and induce mutation. Examples of target-specific nucleases include Cas proteins, TALEN proteins, and ZFN proteins.

[0039] The CRISPR / Cas system, which uses the Cas protein, utilizes the Cas protein, an RNA-guided nuclease (RGN), and guide RNA. By introducing this system into cells, the guide RNA binds to a target site, and the Cas protein, recruited to this binding site, can cleave the DNA.

[0040] The TALEN system, which utilizes TALEN proteins, employs an artificial nuclease (TALEN) that contains a DNA-binding domain of a transcription activator-like (TAL) effector in addition to a DNA-cleaving domain (e.g., a FokI domain). Upon introduction of this system into cells, the TALEN binds to a target site via its DNA-binding domain and cleaves the DNA there. The DNA-binding domain that binds to the target site can be designed according to known schemes (e.g., Zhang F et al. (2011) Nature Biotechnology 29 (2); this paper is incorporated herein by reference).

[0041] The ZFN system, which utilizes ZFN proteins, employs an artificial nuclease (ZFN) containing a nucleic acid cleavage domain conjugated to a DNA-binding domain including a zinc finger array. Upon introduction of this system into cells, the ZFN binds to a target site via its DNA-binding domain and cleaves the DNA there. The DNA-binding domain that binds to the target site can be designed according to known schemes.

[0042] Among target-specific nucleases, Cas proteins are preferred from the viewpoint that the cleavage site can be determined more freely. Preferred Cas proteins include Cas9 protein.

[0043] The target-specific nuclease expression cassette is not particularly limited as long as it is a DNA capable of expressing a target-specific nuclease in the cells of the object of the production method of the present invention. Typical examples of the target-specific nuclease expression cassette include DNA containing a promoter and a target-specific nuclease coding sequence arranged under the control of the promoter. Further, the target-specific nuclease expression cassette may constitute a vector alone or together with other sequences (for example, a drug resistance gene, a replication origin, etc.). The type of the vector is not particularly limited.

[0044] When the target-specific nuclease is a Cas protein, the introduced substance in the production method of the present invention further includes at least one selected from the group consisting of a guide RNA expression cassette and a guide RNA.

[0045] The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system. For example, various guide RNAs that can bind to a target site of genomic DNA and induce the Cas protein to the target site of genomic DNA by binding to the Cas protein can be used.

[0046] It is said that for the binding of the guide RNA to the target site, 12 bases on the 3'-side of the sequence that binds to the target sequence among the crRNA sequences are important. Therefore, when the sequence that binds to the target sequence among the crRNA sequences is not completely identical to the target strand, the bases different from the target strand preferably exist outside the 12 bases on the 3'-side of the sequence that binds to the target sequence among the crRNA sequences.

[0047] Also, the introduced substance in the production method of the present invention preferably contains donor DNA. This makes it easier to obtain the deletion of both the Kng1 gene and the Kng2 gene. The donor DNA is particularly preferably single-stranded DNA consisting of a sequence in which homologous sequences having a length of, for example, 10 to 200, preferably 20 to 150, more preferably 30 to 100, and particularly preferably 40 to 70 bases are added upstream and downstream from the predicted cleavage sites by the target-specific nuclease at both ends of the inserted sequence.

[0048] The method for introducing the introduced substance into cells is not particularly limited, and known methods such as the microinjection method, the lentivirus method, the retrovirus method, etc. can be adopted.

[0049] A mutant non-human animal can be obtained by a method including generating the cells into which the mutation has been introduced into embryos as needed, transplanting them into surrogate parents, and obtaining offspring.

[0050] The fertilized eggs obtained in the process of the above production method of the present invention are fertilized eggs that can develop into the non-human animals of the present invention, and such fertilized eggs are also one aspect of the present invention. The fertilized eggs are not particularly limited as long as they can be generated from the cryopreserved state into a living body, and examples include eggs immediately after fertilization, pronuclear stage embryos, early stage embryos, or blastocysts.

[0051] Matters other than the above description are the same as the description in "2. Non-human animals, cells".

[0052] 4. Use of non-human animals The non-human animals of the present invention can be used as various model animals related to the kallikrein-kinin system. The non-human animals of the present invention can be used, for example, as hypertensive model animals, inflammatory model animals, cancer model animals, autoimmune disease model animals, allergy model animals, aging model animals, etc.

[0053] The non-human animals of the present invention have a higher blood pressure at normal times than the same kind of wild-type animals. The blood pressure is, for example, 115 or more, preferably 120 or more, relative to 100 of the blood pressure of the same kind of wild-type animals.

[0054] In one aspect, the present invention relates to a drug screening method using the non-human animals of the present invention, the cells of the present invention, and the above fertilized eggs.

[0055] The screening method is not particularly limited as long as it uses the non-human animal of the present invention, the cells of the present invention, or the fertilized egg described above, but for example, it is a screening method for at least one preventive and / or therapeutic agent, or a candidate substance, selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging, comprising the step of (a) bringing the non-human animal of the present invention, the fertilized egg developed in the non-human animal, or the cells of the present invention into contact with a test substance.

[0056] The types of test substances are not particularly limited as long as they have the potential to be potential therapeutic agents. Examples include proteins (e.g., hormones), peptides, non-peptide compounds (nucleotides, amines, carbohydrates, lipids, etc.), organic small molecular weight compounds, inorganic small molecular weight compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc.

[0057] Contact, when applied to animals, constitutes administration. Administration can be carried out according to known methods. Examples include oral administration, enteral administration such as tube feeding and enema administration; and parenteral administration such as intravenous administration, intra-arterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, and intraperitoneal administration.

[0058] Contact can be made, for example, by adding it to the culture medium when cells are the target.

[0059] The screening method preferably further includes (b) a step of evaluating the phenotype after step a.

[0060] Phenotype evaluation can be performed by measuring blood pressure, measuring inflammation / autoimmune disease / allergy / aging markers, and evaluating inflammation / autoimmune disease / allergy / aging symptoms, thereby evaluating at least one phenotype selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging. If at least one phenotype selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging improves upon administration and / or contact with the test substance, the test substance can be selected as a preventive and / or therapeutic agent, or a candidate substance, for at least one of the conditions selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging.

[0061] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0062] Example 1. Generation of Kng1 and Kng2 gene-deficient mice. Mice lacking both the Kng1 gene (NCBI Gene ID: 16644) and the Kng2 gene (NCBI Gene ID: 385643) were generated using the CRISPR / Cas system. Specifically, the procedure was as follows.

[0063] The gRNA sequences to be introduced along with the Cas9 protein are as follows. Both are gRNAs that target exon 1. Kng1: ATGTTGCACCGAGTGATCGAGGG (Sequence ID 1). Kng2: AGTGACCAAGCGCGCTAAAATGG (Sequence ID 2).

[0064] In addition, ssDNA (single-strand DNA) was introduced along with the Cas9 protein. The ssDNA sequence consists of a restriction enzyme recognition sequence and a sequence containing stop codons (underlined below), with 50 bp homologous sequences added upstream and downstream from the expected cleavage site by the Cas9 protein at both ends. The ssDNA sequences are as follows: Kng1: TTTAACCCTGGGGTAAAAAGTGGCAACCAGTATATGTTGCACCGAGTGATAAGCTTCCTGACCTGACGAGGGCACTAAAACGGTGAGTAACAGCTTTCCTGTGAAACCACTTGTAA (Sequence ID 3). Kng2: GTTACAAAGCGGCAACCAGTTTGTGTTGTACCGAGTGACCAAGCGCGCTAGGATCCTGACCTGAAAATGGTGAGTAACAGCTTTCCTGTGAAACCACTTGTAATTGGTGCTCTC (Sequence ID 4).

[0065] Eight- to twelve-week-old female C57BL / 6J mice were treated for superovulation, and eggs were collected in 90 μl of modified HTF (mHTF). Approximately 1 μl of semen was collected from the epididymal tail of 13-week-old male C57BL / 6J mice in 100 μl of TYH gas-equalized with 5% CO2, and pre-culture was performed at 5% CO2, 37 °C, for 1.5 hours to acquire fertilization ability. 10 μl of the sperm culture medium after pre-culture was transferred to 90 μl of TYH and diluted 10-fold. Artificial insemination was performed by gently adding 10 μl of diluted sperm suspension to the culture medium in which the eggs were collected, and allowing it to stand at 5% CO2, 37 °C for 5 hours. Five hours after the start of artificial insemination, only fertilized eggs with pronuclei were transferred to kSOM medium and cultured at 5% CO2, 37 °C until ready for subsequent experiments. A working solution was prepared by diluting the reagents in opti-MEM to the following concentrations: gRNA (1 pmol / μl each), ssDNA (0.25 μg / μl each), and Cas9 (0.85 μg / μl). Genetic modification reagents were introduced into fertilized eggs using electroporation of the working solution. The fertilized eggs were then transferred to kSOM medium and cultured overnight at 5% CO2 and 37 °C. Fertilized eggs that differentiated normally into two cells were selected and transplanted into the oviducts of pseudo-pregnant ICR mice. Genomic DNA from the offspring (F0 founders) was extracted from tail samples and used for genotyping. Crossing yielded mice (referred to as DKO or KngDKO) in which both the Kng1 and Kng2 genes were deleted on both homologous chromosomes.

[0066] Table 1 shows a comparison of the Kng1 sequences between wild-type (WT) mice and DKO mice, and Table 2 shows a comparison of the Kng2 sequences between wild-type (WT) mice and DKO mice.

[0067]

[0068]

[0069] The levels of kininogen and kinin in plasma were measured in WT mice and DKO mice as follows. Specifically, the plasma was digested with trypsin (which generates kinin from kininogen, allowing both kininogen and kinin to be measured in kinin equivalents), and the bradykinin (kinin) concentration was measured by ELISA.

[0070] The results are shown in Figure 1. In DKO mice, it was confirmed that kininogen and kinin were absent from the plasma.

[0071] Test Example 2. Blood Pressure Measurement: Normal blood pressure was measured in WT mice and DKO mice using the unheated tail cuff method.

[0072] The results are shown in Figure 2. In DKO mice, the normal blood pressure was increased by 20%, indicating that kinin lowers the normal blood pressure.

Claims

1. Non-human animals lacking the Kng1 and Kng2 genes.

2. A non-human animal according to claim 1, which is a mammal.

3. The non-human animal according to claim 1, wherein the Kng1 gene and the Kng2 gene have insertion mutations.

4. The non-human animal according to claim 3, wherein the insertion mutation results in the appearance of a stop codon in the N-terminal region.

5. The non-human animal according to claim 4, wherein the N-terminal region is exon 1.

6. The non-human animal according to claim 1, which is at least one selected from the group consisting of hypertension model animals, inflammation model animals, cancer model animals, autoimmune disease model animals, allergy model animals, and aging model animals.

7. Cells lacking the Kng1 and Kng2 genes.

8. A fertilized egg that develops in a non-human animal according to any one of claims 1 to 6.

9. A screening method for at least one preventive and / or therapeutic agent, or a candidate substance, selected from the group consisting of hypertension, inflammation, cancer, autoimmune disease, allergy, and aging, comprising the step of (a) bringing a test substance into contact with a non-human animal according to any one of claims 1 to 6, a fertilized egg developing in the non-human animal, or a cell according to claim 8.

10. (b) The screening method according to claim 9, further comprising a step of evaluating the phenotype after step a.

Images