Use of a tmem43 inhibitor in the preparation of a medicament for treating gastric cancer

By targeting and silencing or knocking down TMEM43 expression with small molecule nucleotide interfering agents, the treatment challenge of peritoneal metastasis in gastric cancer has been solved, significantly inhibiting the migration and invasion of gastric cancer cells and providing a new direction for the treatment of gastric cancer.

CN121154672BActive Publication Date: 2026-03-27ZHEJIANG CANCER HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511715744.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-21
Publication Date
2026-03-27
Estimated Expiration
2045-11-21

AI Technical Summary

Technical Problem

In the current technology, patients with peritoneal metastasis of gastric cancer are resistant to traditional systemic therapy, lack specific targets and effective treatment strategies, and the mechanism of action of TMEM43 in gastric cancer is unclear.

Method used

Using TMEM43 inhibitors, especially small molecule nucleotides such as shRNA, we targeted and silenced or knocked down TMEM43 expression through lentiviral vectors to reduce its expression in gastric cancer cells. Single-cell sequencing technology was used to verify the abnormally high expression of TMEM43 in peritoneal metastases, and gastric cancer progression was inhibited by interfering with the TMEM43 gene.

Benefits of technology

It significantly reduces the migration and colony formation ability of gastric cancer cells, regulates the expression of EMT-related markers, provides a new treatment strategy for gastric cancer, and identifies TMEM43 as a novel molecular target for gastric cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121154672B_ABST
    Figure CN121154672B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biological medicine, and particularly relates to application of TMEM43 inhibitor in preparation of anti-gastric cancer drugs. The present application compares and analyzes the expression profiles of gastric cancer primary foci and peritoneal metastatic foci through single cell sequencing technology, and finds that TMEM43 is abnormally highly expressed in peritoneal metastatic foci. After further research, it is confirmed that when the expression of TMEM43 gene in human gastric cancer cells is knocked down, the migration ability and clonogenicity of the cells are significantly reduced; at the same time, the expression levels of various markers related to the epithelial-mesenchymal transition (EMT) process in the cells are also down-regulated (N-Cadherin, Snail, Twist1, TMEM43 up-regulated) or up-regulated (E-cadherin up-regulated) to different degrees, which finally can exert a therapeutic effect of inhibiting the progression of gastric cancer. The present application not only clearly defines the key role of TMEM43 in the occurrence and development of gastric cancer, but also provides a new theoretical guidance and technical direction for the research and development of gastric cancer treatment drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of TMEM43 inhibitor in the preparation of anti-gastric cancer drugs. BACKGROUND

[0002] Chemotherapy is still the main treatment method for advanced gastric cancer, and the first-line drugs are mostly cytotoxic drugs such as fluorouracil, platinum and paclitaxel. Compared with simple surgery, perioperative chemotherapy can significantly improve the prognosis of patients with resectable gastric cancer. However, gastric cancer patients with peritoneal metastasis have high tumor invasiveness and resistance to traditional systemic treatment. Therefore, finding specific targets for gastric cancer peritoneal metastasis and exploring new strategies for gastric cancer treatment are key issues that need to be addressed in gastric cancer-related research.

[0003] Transmembrane protein 43 (TMEM43) is a member of the TMEM subfamily, NCBI Gene ID: 79188. TMEM43 is a highly conserved gene widely expressed in most species from bacteria to humans. TMEM43 contains four transmembrane domains of alpha-helix, and is mainly located in the endoplasmic reticulum membrane and nuclear membrane. Studies have shown that TMEM43 is a non-selective cation channel protein that can permeate Na + , K + and Cs + ions. Studies have shown that TMEM43 interacts with gap junction protein subunits Connexin26 and Connexin30, leading to non-syndromic hearing deafness. In addition, the (p.Ser358Leu) mutation of TMEM43 can enhance the NF-κB-TGF β signal cascade, leading to arrhythmogenic right ventricular cardiomyopathy. The existing technology also relates to the related reports of TMEM43 siRNA for treating cardiomyopathy. Studies have shown that TMEM43 regulates sideroblastic anemia by reducing the expression of P53.

[0004] However, the relationship between TMEM43 and gastric cancer is not clear, and the specific mechanism has not been revealed. SUMMARY

[0005] (1) Technical problems to be solved

[0006] In view of the above shortcomings and deficiencies of the prior art, the present application provides the application of TMEM43 inhibitor in the preparation of anti-gastric cancer drugs, which provides a new direction for the treatment of gastric cancer and the development of targeted drugs.

[0007] (2) Technical solutions

[0008] The technical solutions adopted by the present application are as follows:

[0009] In a first aspect, the present application provides a use of a TMEM43 inhibitor in the preparation of a drug for resisting gastric cancer.

[0010] Preferably, the TMEM43 inhibitor is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression.

[0011] Preferably, the small molecule nucleotide is shRNA, and the shRNA is any one of the following double-stranded oligonucleotides:

[0012] TMEM43-shRNA1

[0013] Sense strand: CCGGCCTTATGACACGGATCCTCTACTCG

[0014] AGTAGAGGATCCGTGTCATAAGGTTTTTG (SEQ ID NO. 1);

[0015] Antisense strand:

[0016] AATTCAAAAACCTTATGACACGGATCCTC

[0017] TACTCGAGTAGAGGATCCGTGTCATAAGG (SEQ ID NO. 2);

[0018] TMEM43-shRNA2

[0019] Sense strand:

[0020] CCGGCCTTTGTCCAAATTGGCAGGTCTCGA

[0021] GACCTGCCAATTTGGACAAAGGTTTTTG (SEQ ID NO. 3);

[0022] Antisense strand:

[0023] AATTCAAAAACCTTTGTCCAAATTGGCAGG

[0024] TCTCGAGACCTGCCAATTTGGACAAAGG (SEQ ID NO. 4);

[0025] TMEM43-shRNA3

[0026] Sense strand:

[0027] CCGGGAGGTGTTTCATAGAGAACTACTCGA

[0028] GTAGTTCTCTATGAAACACCTCTTTTTG (SEQ ID NO. 5);

[0029] antisense strand: AATTCAAAAAGAGGTGTTTCATAGAGAACT

[0030] ACTCGAGTAGTTCTCTATGAAACACCTC (SEQ ID NO. 6).

[0031] Preferably, the medicine comprises an active ingredient which is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression and a vector which is a lentiviral vector.

[0032] Preferably, the lentiviral vector is pHBLV™.

[0033] Preferably, the medicine further comprises a helper vector which comprises pSPAX2 and pMD2G.

[0034] In a second aspect, the present application provides an anti-gastric cancer medicine comprising an active ingredient which is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression and a vector which is a lentiviral vector.

[0035] Preferably, the small molecule nucleotide is shRNA, which is any one of the following double-stranded oligonucleotides:

[0036] TMEM43-shRNA1

[0037] sense strand: CCGGCCTTATGACACGGATCCTCTACTCG

[0038] AGTAGAGGATCCGTGTCATAAGGTTTTTG (SEQ ID NO. 1);

[0039] antisense strand:

[0040] AATTCAAAAACCTTATGACACGGATCCTC

[0041] TACTCGAGTAGAGGATCCGTGTCATAAGG (SEQ ID NO. 2);

[0042] TMEM43-shRNA2

[0043] sense strand:

[0044] CCGGCCTTTGTCCAAATTGGCAGGTCTCGA

[0045] GACCTGCCAATTTGGACAAAGGTTTTTG (SEQ ID NO. 3);

[0046] Antisense strand:

[0047] AATTCAAAAACCTTTGTCCAAATTGGCAGG

[0048] TCTCGAGACCTGCCAATTTGGACAAAGG (SEQ ID NO. 4);

[0049] TMEM43-shRNA3

[0050] Sense strand:

[0051] CCGGGAGGTGTTTCATAGAGAACTACTCGA

[0052] GTAGTTCTCTATGAAACACCTCTTTTTG (SEQ ID NO. 5);

[0053] Antisense strand: AATTCAAAAAGAGGTGTTTCATAGAGAACT

[0054] ACTCGAGTAGTTCTCTATGAAACACCTC (SEQ ID NO. 6).

[0055] Preferably, the lentiviral vector is pHBLV™.

[0056] Preferably, the medicine further comprises a helper vector, which comprises pSPAX2 and pMD2G.

[0057] (III) Beneficial effects

[0058] The present application compares and analyzes the expression profiles of gastric cancer primary foci and peritoneal metastatic foci by single-cell sequencing technology, and finds that TMEM43 is abnormally highly expressed in peritoneal metastatic foci. After further research, it is confirmed that when the expression of TMEM43 gene in human gastric cancer cells is knocked down, the migration ability and clonogenic ability of the cells are significantly reduced; at the same time, the expression levels of various markers related to the epithelial-mesenchymal transition (EMT) process in the cells also present different degrees of down-regulation (up-regulation of N-Cadherin, Snail, Twist1, TMEM43) or up-regulation (up-regulation of E-cadherin), which can ultimately exert a therapeutic effect of inhibiting the progression of gastric cancer.

[0059] Based on the above findings, the present application further suggests that TMEM43 can be used as a new molecular target for the treatment of gastric cancer. Accordingly, targeted treatment methods can be developed, such as silencing or knocking down the expression of TMEM43 by small molecule nucleotides (such as small interfering RNA siRNA, short hairpin RNA shRNA), or developing small molecule compounds, protein antibodies, etc. targeting TMEM43, thereby providing a new intervention strategy for the treatment of gastric cancer. The research results not only clarify the key role of TMEM43 in the occurrence and development of gastric cancer, but also provide a new theoretical guidance and technical direction for the research and development of gastric cancer treatment drugs. BRIEF DESCRIPTION OF DRAWINGS

[0060] Figure 1 The expression of TMEM43 in gastric cancer tissue samples and control tissue samples was compared.

[0061] Figure 2 The fluorescence image of gastric cancer cells transfected with TMEM43 interfering lentivirus vector.

[0062] Figure 3 The relative expression level of TMEM43 protein in each group of cells was detected by WB.

[0063] Figure 4 The mRNA transcription level of TMEM43 in each group of cells was detected by qRT-PCR.

[0064] Figure 5 The changes in the migration ability (A) and clonogenic ability (B) of human gastric cancer cells after knocking down the expression of TMEM43 in the cells were shown.

[0065] Figure 6 The expression of EMT-related markers in human gastric cancer cells after knocking down the expression of TMEM43 was shown. DETAILED DESCRIPTION

[0066] In order to better explain the present application, so as to be understood, the present application is described in detail by specific embodiments in combination with the drawings.

[0067] Example 1

[0068] Single cell sequencing technology was used to compare the expression of TMEM43 in gastric cancer tissue samples and healthy control tissue samples. The experimental method is as follows:

[0069] I. Preparation of experimental samples

[0070] 1. Gastric cancer tissue samples: Patients diagnosed with primary gastric cancer by pathological diagnosis (clinical stages cover I-IV, excluding preoperative radiotherapy, combined with other malignant tumors or serious underlying diseases) were selected. Intraoperative cancer tissue (avoiding necrotic area, taking mixed tissue of tumor core and marginal area, about 100 mg per case) was obtained, and a total of n≥15 biological repeat samples were included.

[0071] Healthy control tissue samples: Patients undergoing surgical treatment for benign diseases (such as gastric ulcer, gastric polyp) during the same period were selected, and normal gastric mucosa tissue (verified by pathology without epithelial dysplasia or cancer) ≥5 cm from the lesion site was obtained. A total of n≥10 biological repeat samples were included.

[0072] All samples were obtained with the informed consent of the patients, and the samples were immediately placed in ice containing 1% penicillin-streptomycin tissue preservation solution, and transported to the laboratory for processing within 30 min.

[0073] 2. Sample clinical information matching

[0074] The clinical characteristics of the two groups of samples, such as patient age (mainly 50-70 years old), gender (balanced male to female ratio), and gastric mucosa lesion site (gastric antrum, gastric body, etc.), were recorded. Through propensity score matching, the influence of confounding factors on the results was reduced.

[0075] II. Single cell suspension preparation

[0076] 1. Tissue dissociation (avoiding cell damage and cross contamination)

[0077] Fresh tissue was washed with pre-cooled PBS (containing 1% double antibody) for 3 times to remove blood, mucus and other impurities, and the tissue was cut into 1 mm³ or smaller homogenate with a sterile scalpel; 5 mL of preheated tissue dissociation solution (containing 0.2% collagenase I, 0.1% hyaluronidase, 0.05% DNase I, solvent is serum-free DMEM / F12 medium) was added, and the mixture was placed in a 37°C, 5% CO2 incubator for shaking dissociation for 40 min. During this period, the mixture was gently blown every 10 min, and the cell dispersion was observed under a microscope. After dissociation, an equal volume of DMEM / F12 medium containing 10% fetal bovine serum (FBS) was added to terminate the reaction, and the mixture was filtered through 70 μm and 40 μm cell screens in sequence to remove undissociated tissue blocks and cell clusters. Then, the mixture was centrifuged at 1200 rpm and 4°C for 5 min, the supernatant was discarded, and the cells were resuspended with pre-cooled PBS. Then, trypan blue staining solution (final concentration 0.4%) was added, and the proportion of viable cells was counted under an inverted microscope. The viable cell rate should be ≥85% (viable cells are transparent, and dead cells are blue), and the cell concentration was adjusted to 1×10 6 -1.5×10 6 cells / mL for standby.

[0078] III. Single-cell sequencing library construction and sequencing

[0079] 1. Single-cell capture and cDNA synthesis

[0080] Using the 10x Genomics Chromium X single-cell sequencing platform, follow the kit instructions (such as Chromium Single Cell 3' Reagent Kits v3.1): take 10 μL of the adjusted single-cell suspension, combine a single cell with a reverse transcription primer containing a unique cell barcode (Cell Barcode) and molecular identifier (UMI) through a microfluidic chip to form water-in-oil droplets (GEMs); place in a PCR instrument for reverse transcription reaction (reaction conditions: 50°C for 90 min, 85°C for 5 min, 4°C for 5 min), reverse transcribe mRNA in cells into cDNA; collect all cDNA after demulsification, perform PCR amplification (amplification conditions: 98°C for 30 s, 15 cycles of 98°C for 10 s, 63°C for 30 s, 72°C for 30 s, and finally 72°C for 5 min), and obtain sufficient cDNA product.

[0081] 2. Library construction and quality detection

[0082] Fragment the amplified cDNA, perform end repair, add A tail, and connect adapters, enrich library fragments with TMEM43 gene-related sequences through PCR (primer design reference TMEM43 gene NM_001130822.2 sequence, upstream primer: 5'-ggcagctggctggatgg-3', downstream primer: 5'-atgttgaccaggtctcggaa-3'); use Agilent 2100 Bioanalyzer to detect library fragment size (target fragment range 200-600 bp), Qubit 4.0 fluorescence quantifier to detect library concentration (≥2 nM), and ensure that the library quality meets the sequencing requirements.

[0083] 3. High-throughput sequencing

[0084] Load the qualified library to the Illumina NovaSeq 6000 sequencing platform, use PE150 (double-end 150 bp) sequencing mode, set the sequencing depth to ≥50,000 reads per cell (to ensure coverage of TMEM43 gene transcripts); monitor the sequencing quality in real time during sequencing, require Q30 (error rate ≤0.1%) base proportion ≥90%, avoid adapter contamination or low-quality data interference.

[0085] IV. Bioinformatics analysis (focus on TMEM43 expression differences)

[0086] 1. Raw data preprocessing

[0087] Quality control of raw sequencing data (FASTQ files) using Cell Ranger (10x Genomics software, v6.1.2): remove reads containing adapter sequences, low-quality bases (Phred score <20), distinguish different cells by Cell Barcode, correct PCR amplification bias by UMI, and obtain gene expression matrix of each cell (row: gene, column: cell, value: UMI count); cell-level quality control: filter out the following cells to reduce noise: ① gene detection number <200 or >6000 (exclude dead cells, doublets or low-quality cells); ② mitochondrial gene proportion >15% (exclude stress-damaged cells); ③ cells with UMI count of 0 for TMEM43 gene (not included in subsequent gene expression analysis).

[0088] 2. Cell subpopulation and cell type annotation

[0089] Standardize the cell expression matrix after quality control using Seurat software (v4.0.5, R package) (Normalize Data function, using Log Normalize method), feature selection (Find Variable Features function, screen high-variable genes) and principal component analysis (PCA); based on the PCA results, reduce dimension by t-SNE (t-distributed Stochastic Neighbor Embedding) or UMAP (Uniform Manifold Approximation and Projection), use Find Clusters function (resolution set to 0.8) to cluster cells and obtain different cell subpopulations; refer to known gastric tissue cell type markers (such as epithelial cells: CDH1, KRT19; immune cells: CD45, CD3D; fibroblasts: COL1A1, FAP), identify the marker genes of each cluster by Find Markers function, complete cell type annotation (focus on gastric epithelial cell subpopulation, as TMEM43 is mainly expressed in epithelial cells).

[0090] 3. TMEM43 expression difference analysis

[0091] The UMI counts of TMEM43 gene of each cell type in the gastric cancer group and the healthy control group were extracted, and the UMI counts per 10,000 transcripts (TP10K) were standardized to eliminate the influence of cell sequencing depth difference on expression amount; the expression levels of TMEM43 in the two groups were compared by cell type: the Wilcoxon rank sum test (one-sided test) was used to calculate the significance of difference, and the screening criteria were set as |log2 (TP10K of gastric cancer group / TP10K of healthy control group)|>1 and the corrected p value (padj)<0.05, which was determined as significant differential expression of TMEM43; and the expression distribution of TMEM43 in each cell type in the two groups was shown by Violin Plot. The experimental results are shown in Figure 1 As shown in the table, the expression of TMEM43 in the gastric cancer tissue sample was significantly higher than that in the healthy control tissue sample.

[0092] Example 2

[0093] In this embodiment, siRNA target points for TMEM43 gene were designed, and the corresponding shRNA sequences were synthesized. The siRNA sequences and shRNA sequences are shown in Tables 1-2. The specific steps are as follows:

[0094] 1. Enzymatic digestion of lentiviral vector

[0095] The lentiviral vector plasmid pHBLVTM was subjected to double enzyme digestion with restriction enzymes BamHI and EcoRI (the reaction system contained the vector plasmid, BamHI, EcoRI, and enzyme digestion buffer), and incubated at 37°C for 4h. After enzyme digestion, the product was separated by agarose gel electrophoresis, and the linearized pHBLVTM vector fragment was recovered (the circular plasmid was removed).

[0096] 2. Preparation of shRNA insertion fragment

[0097] Two complementary single-stranded DNA oligonucleotides (about 70nt in length) were artificially synthesized: both single strands carried shRNA coding sequences targeting the target gene (TMEM43), and both ends were designed with BamHI, EcoRI restriction enzyme recognition sites and sticky end complementary sequences matched with the vector.

[0098] The two single-stranded DNAs were mixed in equal molar ratio and subjected to annealing reaction (the program was: heating at 95°C for 5min, and then slowly cooling to room temperature to allow the single strands to fully complement to form double strands), and finally the shRNA double-stranded insertion fragment with sticky ends was obtained.

[0099] 3. Connection and transformation identification of recombinant vector

[0100] The annealed shRNA double-stranded insert was ligated with the recovered pHBLVTM vector digested by BamHI / EcoRI using T4 DNA ligase at 16°C overnight to construct the recombinant lentiviral vector.

[0101] The ligation product was transformed into DH5a competent cells by heat shock method (after thawing the competent cells on ice, the ligation product was added, ice bath for 30 minutes; 42°C heat shock for 90 seconds, rapid ice bath for 2 minutes; after recovery by adding antibiotic-free medium, inoculated on LB plate containing ampicillin). After single colony growth, positive colonies were picked and expanded, plasmid was extracted and verified by sequencing (using vector universal primers or specific primers) to confirm the sequence accuracy and correct direction of the insert.

[0102] 4. Packaging, concentration and titer determination of lentivirus

[0103] Plasmid extraction: a large amount of recombinant pHBLVTM vector and helper plasmids pSPAX2 (providing viral structural proteins and regulatory factors), pMD2G (providing envelope protein VSVG) verified by sequencing were extracted.

[0104] Cell transfection: recombinant pHBLVTM, pSPAX2, pMD2G were co-transfected into 293T packaging cells by liposome transfection method (Lipofectamine 3000) (ensure cell confluence of 70%-80% before transfection, and in good condition).

[0105] Virus collection: 24h, 48h, 72h after transfection, the cell culture supernatant was collected, and all supernatants were combined.

[0106] Virus concentration: ultracentrifugation method (25,000 rpm, 4°C centrifugation for 2h) or PEG precipitation method was used to remove part of the culture medium components and concentrate the virus particles.

[0107] Titer determination: by fluorescence quantification method (using the fluorescence reporter gene GFP carried by the vector) or limiting dilution method, the concentrated virus solution was gradiently diluted and infected target cells (such as 293T cells), after culture, the proportion of fluorescent positive cells was detected by flow cytometry, combined with dilution times to calculate the virus titer (unit: TU / mL, transduction units per milliliter), to ensure that the titer is ≥1×10 8 TU / mL, to meet the needs of subsequent experiments.

[0108] Through the above steps, the construction, packaging and activity verification of recombinant lentiviral vector targeting the target gene can be completed, providing tool viruses for subsequent gene interference experiments.

[0109] Table 1: siRNA sequence

[0110]

[0111] Table 2: shRNA sequences

[0112] ;

[0113] After the TMEM43-shRNA is cleaved by Dicer enzyme in the cell, the corresponding siRNA with double-stranded structure is generated, and the siRNA is the "end product" of the enzyme cleavage of shRNA, which further exerts the silencing effect on the target gene TMEM43.

[0114] Example 3

[0115] In this example, the gastric cancer cells were infected with the lentivirus constructed in Example 2 to investigate the inhibitory effect of the lentivirus on TMEM43 in the gastric cancer cells, and the experimental steps were as follows:

[0116] 1. Gastric cancer cell culture and inoculation

[0117] Select human gastric cancer cells (such as HGC27, NUGC3; which are lymph node metastases of undifferentiated gastric cancer tissue and primary cancer tissue of gastric adenocarcinoma, respectively) in the logarithmic growth phase, resuspend them in RPMI-1640 culture medium containing 10% fetal bovine serum (FBS), and adjust the cell density to (2x10^5) cells / mL; add 2 mL of cell suspension to each well of a 6-well plate, and incubate in a 37°C, 5% CO2 incubator for 24 h. When the cells adhere and the confluence reaches 70%, perform lentivirus infection.

[0118] 2. Lentivirus infection and grouping test

[0119] Control group (shCtrl): add complete culture medium carrying TMEM43-shNC lentivirus;

[0120] shRNA1 group: add complete culture medium carrying TMEM43-shRNA1 lentivirus;

[0121] shRNA2 group: add complete culture medium carrying TMEM43-shRNA2 lentivirus;

[0122] shRNA3 group: add complete culture medium carrying TMEM43-shRNA3 lentivirus;

[0123] Each of the above lentiviruses carries a GFP fluorescent marker.

[0124] The multiplicity of infection (MOI) of each group is determined to be 10 according to the pre-experiment, and the mixture is gently mixed and then continued to be cultured.

[0125] 3. Observation of lentivirus transfection efficiency

[0126] After 48h infection, the green fluorescence (GFP) expression of each group of cells was observed under a fluorescence inverted microscope. Five fields were randomly selected, and the number of "fluorescent positive cells" and "total cells" was counted, respectively, to calculate the transfection efficiency (transfection efficiency = fluorescent positive cell number / total cell number x 100%). After 72h infection, GFP expression was observed again and photographed (transfection effect see Figure 2 ), and each lentivirus showed good transfection effect on gastric cancer cells.

[0127] 4. Western Blot (WB) detection of TMEM43 protein expression level

[0128] After 72h infection, total proteins were extracted from each group of cells using RIPA lysis buffer containing protease inhibitors. After determining the protein concentration using a BCA protein quantification kit, equal amounts of protein (about 30μg) were subjected to SDS-PAGE electrophoresis, followed by transfer to a PVDF membrane. The membrane was blocked with 5% skim milk at room temperature for 2h; primary antibody (rabbit anti-human TMEM43 polyclonal antibody, 1:1000 dilution; mouse anti-human Actin monoclonal antibody, 1:5000 dilution) was added and incubated at 4°C overnight; after washing the membrane, HRP-labeled secondary antibody (goat anti-rabbit IgG or goat anti-mouse IgG, 1:5000 dilution) was added and incubated at room temperature for 1h. Finally, the ECL chemiluminescence kit was used for development, and the ImageJ software was used for quantitative analysis of band gray value. Actin was used as an internal reference to calculate the relative expression of TMEM43 protein (experimental results see Figure 3 ). The results showed that compared with the shCtrl group, the three groups of lentivirus carrying TMEM43-shRNA could effectively knock down the expression of TMEM43 protein in gastric cancer cells NUGC3.

[0129] 5. qRT-PCR detection of TMEM43 mRNA transcription level

[0130] (1) Total RNA extraction and genomic DNA removal: After 72h infection, the cells of each group were collected, and total RNA was extracted using Trizol reagent; the RNA concentration and purity were determined (the requirement is OD 260 / OD 280 between 1.8-2.0). 1μg of total RNA was used for genomic DNA removal reaction using DNase I (37°C incubation for 30min, 65°C heating for 10min to inactivate the enzyme).

[0131] (2) cDNA synthesis: Using the total RNA after genomic DNA removal as a template, cDNA was synthesized using a reverse transcription kit (such as PrimeScript RT Master Mix), and the reaction conditions were as follows: 37°C, 15min; 85°C, 5s; 4°C storage.

[0132] (3) qPCR reaction adopts SYBR Green fluorescent quantitative PCR kit, and the reaction system is 20 μL (containing 2x SYBR Green PCR Master Mix 10 μL, 0.5 μL of upstream and downstream primers, 2 μL of cDNA template, 7 μL of RNase-free H2O).

[0133] Reaction procedure: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, a total of 40 cycles; finally, melt curve analysis (95℃, 15s, 60℃, 1min, 95℃, 15s) is performed.

[0134] Each sample is provided with 3 duplicate holes, and Actin is used as an internal reference, and method 2 is used to calculate the relative expression of TMEM43 mRNA (see experimental results in Table 1). -ΔΔCt The relative expression of TMEM43 mRNA is calculated (see experimental results in Table 1). Figure 4

[0135] The primer sequence used in qRT-PCR is as follows: TMEM43 primer: upstream primer (5'-{ggcagctggctggatgg}-3'), downstream primer (5'-{atgttgaccaggtctcggaa}-3').

[0136] Internal reference Actin primer: forward primer (5'-{CATGTACGTTGCTATCCAGGC}-3'), reverse primer (5'-{CTCCTTAATGTCACGCACGAT}-3').

[0137] As shown in Table 1, compared with the shCtrl group, three groups of lentivirus carrying TMEM43-shRNA can effectively inhibit the mRNA transcription level of TMEM43 in gastric cancer cells NUGC3. Figure 4

[0138] As shown in Table 1, compared with the shCtrl group, three groups of lentivirus carrying TMEM43-shRNA can effectively inhibit the mRNA transcription level of TMEM43 in gastric cancer cells NUGC3. Figure 5 As shown in Table 1, compared with the shCtrl group, three groups of lentivirus carrying TMEM43-shRNA can effectively inhibit the mRNA transcription level of TMEM43 in gastric cancer cells NUGC3.

[0139] As shown in Table 1, compared with the shCtrl group, three groups of lentivirus carrying TMEM43-shRNA can effectively inhibit the mRNA transcription level of TMEM43 in gastric cancer cells NUGC3. Figure 6 ​​The expression of various gastric cancer markers (E-Cadherin, N-Cadherin, Snail, Twist1, TMEM43) in gastric cancer cells HGC27 infected with lentivirus carrying TMEM43-shRNA1 and lentivirus carrying TMEM43-shRNA2 was detected using Olink neurology panel (95801). Among them, with TUBULIN as a reference, after successful lentivirus transfection, the expression levels of gastric cancer markers N-Cadherin, Snail, Twist1, TMEM43 and the like in HGC27 cells were all significantly down-regulated, indicating that the motility and invasiveness of cancer cells decreased; at the same time, the expression level of E-Cadherin increased, which means that the migration and invasion of tumor cells are inhibited.

[0140] The experiments of the present embodiment demonstrate that by designing shRNA or siRNA targeting knockdown of TMEM43, the motility and invasiveness of gastric cancer cells can be reduced, and the migration and clonogenicity of the cells can be inhibited.

[0141] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements, or in the case where the technical features in the above embodiments do not conflict with each other, can be combined in the manner recorded in the embodiments, and these modifications, replacements or combinations do not make the essence of the corresponding technical solution deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. The application of TMEM43 inhibitors in the preparation of anti-gastric cancer drugs, wherein the TMEM43 inhibitor is a small molecule nucleotide that targets, silences, or knocks down the expression of TMEM43, and the small molecule nucleotide is shRNA, wherein the shRNA is any one of the following double-stranded oligonucleotides: TMEM43-shRNA1, its sense strand is shown in SEQ ID NO.1, and its antisense strand is shown in SEQ ID NO.2; TMEM43-shRNA2, its sense strand is shown in SEQ ID NO.3, and its antisense strand is shown in SEQ ID NO.4; TMEM43-shRNA3, its sense strand is shown in SEQ ID NO.5, and its antisense strand is shown in SEQ ID NO.

6.

2. The application according to claim 1, characterized in that, The drug comprises an active ingredient and a carrier, wherein the active ingredient is a small molecule nucleotide that targets and silences or knocks down TMEM43 expression, and the carrier is a lentiviral vector.

3. The application according to claim 2, characterized in that, The lentiviral vector is pHBLVTM.

Citation Information

Patent Citations

  • Method of modulating stress-activated protein kinase system

    CN101360750A

  • Biomarker for diagnosing colon cancer and application thereof

    CN117089619A