Application of mitochondrial topoisomerase I or coding gene thereof

Abstract

The invention discloses an application of mitochondrial topoisomerase I or a coding gene thereof, relates to the technical field of biological medicines, and particularly provides an application of the mitochondrial topoisomerase I or the coding gene thereof as a therapeutic target in screening or preparing a medicine for treating Alzheimer's disease. The action mechanism of the mitochondrial topoisomerase I in the Alzheimer's disease is fully explored, it is found that deletion of the coding gene of the mitochondrial topoisomerase I can cause increase of APP and A beta levels and finally cause learning and memory impairment similar to the Alzheimer's disease, and the mitochondrial topoisomerase I can be used as a potential target for treatment of the Alzheimer's disease and can be used for treating the Alzheimer's disease. The overexpressed mitochondrial topoisomerase I can significantly reduce APP and A beta levels and treat the Alzheimer's disease.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of mitochondrial topoisomerase I or its encoding gene. Background Technology

[0002] Alzheimer's disease is a neurodegenerative disease characterized by progressive cognitive impairment and is the most common form of dementia. The most classic pathological feature of Alzheimer's disease is the formation of senile plaques due to the deposition of β-amyloid protein (Aβ). Amyloid precursor protein (APP) is initially cleaved by BACE1 (β-site amyloid precursor protein cleaving enzyme 1) to form soluble amylase precursor protein β (sAPPβ). The β-C-terminal fragment is further cleaved by γ-secretase to form a toxic oligopeptide containing 39 to 43 fragments, namely Aβ. The imbalance between the formation and clearance of Aβ in Alzheimer's patients leads to Aβ accumulation and deposition, ultimately resulting in neuronal degeneration.

[0003] Although some drugs, such as cholinesterase inhibitors and glutamate receptor antagonists (e.g., donepezil and lencanemab), can temporarily improve some clinical symptoms, their effects on inhibiting disease progression are limited, and there are currently no effective means to reverse or stop disease progression. There is currently no cure for Alzheimer's disease. This treatment predicament highlights the limitations of our current understanding of the pathogenesis of Alzheimer's disease. Therefore, exploring new mechanisms of Alzheimer's disease pathogenesis and identifying potential therapeutic targets have become the focus of current research.

[0004] Therefore, existing technologies still need to be improved and developed. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the purpose of this invention is to provide the application of mitochondrial topoisomerase I or its encoding gene, aiming to solve the problem of finding new targets and new methods for treating Alzheimer's disease.

[0006] The technical solution of the present invention is as follows: In a first aspect, the invention provides the use of mitochondrial topoisomerase I or its encoding gene as a therapeutic target in screening or preparing drugs for the treatment of Alzheimer's disease.

[0007] Optionally, the drug has any one of the following functions: (1) Increase the level of mitochondrial topoisomerase I; (2) Promotes the expression of the gene encoding mitochondrial topoisomerase I.

[0008] A second aspect of the present invention provides the use of a substance that promotes the expression of mitochondrial topoisomerase I or its encoding gene in the preparation of a medicament for treating Alzheimer's disease. Optionally, the substance that promotes the expression of the mitochondrial topoisomerase I encoding gene is a mitochondrial topoisomerase I encoding gene overexpression plasmid.

[0009] In a third aspect, the present invention provides a medicament for treating Alzheimer's disease, wherein the medicament comprises a substance that promotes the expression of mitochondrial topoisomerase I or its encoding gene.

[0010] Optionally, the substance that promotes the expression of mitochondrial topoisomerase I or its encoding gene is a plasmid overexpressing the mitochondrial topoisomerase I encoding gene.

[0011] Optionally, the dosage form of the drug includes injections, tablets, or capsules.

[0012] Optionally, the medicament may further include a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable additive.

[0013] Optionally, the pharmaceutically acceptable carrier includes at least one of a flow aid, diluent, wetting agent, suspending agent, solvent, and emulsifier.

[0014] Optionally, the pharmaceutically acceptable additives include at least one of preservatives, colorants, flavoring agents, stabilizers, and isotonic agents.

[0015] Beneficial Effects: This invention thoroughly explores the mechanism of action of mitochondrial topoisomerase I in Alzheimer's disease, finding that the level of mitochondrial topoisomerase I in the brains of Alzheimer's patients is significantly reduced, and knockout mice of the mitochondrial topoisomerase I encoding gene exhibit Alzheimer's-like learning and memory impairments. Further research revealed that deletion of the mitochondrial topoisomerase I encoding gene leads to increased APP and Aβ levels, ultimately resulting in Alzheimer's-like learning and memory impairments. Therefore, mitochondrial topoisomerase I can serve as a potential therapeutic target for Alzheimer's disease. Further research showed that overexpression of mitochondrial topoisomerase I can significantly reduce cellular APP and Aβ levels, improving learning and memory abilities in Alzheimer's mice.

[0016] In summary, this invention reveals that mitochondrial topoisomerase I is not only closely related to Alzheimer's disease but also a potential drug target. Promoting the expression of mitochondrial topoisomerase I could potentially lead to the treatment of Alzheimer's disease. Attached Figure Description

[0017] Figure 1 This is a graph showing the expression results of TOP1mt in the cerebral cortex and hippocampus of healthy individuals and AD patients in Example 1.

[0018] Figure 2 For WT mice and TOP1mt in Example 2 - / - The results of cognitive impairment tests in mice are shown in the following figures: a) Y-maze test results, b) new object recognition test results, c) time to find the platform during Morris water maze training, d) number of times mice crossed the original platform and time spent in the target quadrant 24 hours after the Morris water maze training ended, and e) number of times mice crossed the original platform and time spent in the target quadrant 72 hours after the Morris water maze training ended.

[0019] Figure 3 For WT mice and TOP1mt in Example 3 - / - Figures showing the results of APP, APP mRNA, and Aβ levels in the mouse brain. Figure a shows the results of APP levels in the cerebral cortex and hippocampus, figure b shows the results of APP mRNA levels in the cerebral cortex and hippocampus, and figure c shows the results of Aβ40, Aβ38, and Aβ42 levels in the cerebral cortex.

[0020] Figure 4 This is a map of the TOP1mt overexpression plasmid.

[0021] Figure 5 The image shows the results of APP and Aβ level tests in TOP1mt overexpressing N2a-sw cells in Example 4, where a is the APP level test result and b is the Aβ40, Aβ42, and Aβ42 / Aβ40 level test result.

[0022] Figure 6 The image shows the spectrum of adenovirus GL3049 pcAAV-CMV-EGFP-tWPA.

[0023] Figure 7 This is a map of an adenovirus overexpression plasmid.

[0024] Figure 8 The following are the results of the learning and memory ability tests of TOP1mt overexpressing 5×FAD mice in Example 5: a) Y maze test results; b) new object recognition test results; c) time to find the platform during Morris water maze training; d) number of times mice crossed the original platform and time spent in the target quadrant 24 hours after the Morris water maze training ended; e) number of times mice crossed the original platform and time spent in the target quadrant 72 hours after the Morris water maze training ended.

[0025] In the attached diagram, This indicates that p < 0.05, indicating a significant difference; This indicates that p < 0.01, indicating a highly significant difference; p < 0.001 indicates a highly significant difference; ns indicates no significant difference. Detailed Implementation

[0026] This invention provides applications of mitochondrial topoisomerase I or its encoding gene. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0028] Mitochondrial topoisomerase I (TOP1mt) is a DNA topoisomerase I specific to mitochondria, encoded by the nuclear gene TOP1MT, and plays a crucial role in maintaining the normal structure and function of mitochondrial DNA. Unlike TOP1 (topoisomerase I) in the cell nucleus, TOP1mt is specifically located in mitochondria, and its main function is to regulate the topological structure of mitochondrial DNA. Studies have found that TOP1mt deficiency leads to mitochondrial DNA damage, respiratory chain dysfunction, and abnormal energy metabolism; these changes can trigger neuronal dysfunction and even neurodegeneration.

[0029] This invention focuses on TOP1mt, revealing its impact on learning and memory and its role in the pathogenesis of Alzheimer's disease. It also verifies the effectiveness of TOP1mt or its encoding gene as a potential therapeutic target for Alzheimer's disease, which has significant scientific and social implications. Specifically, this invention provides the application of TOP1mt or its encoding gene as a therapeutic target in screening (or developing) or preparing drugs for the treatment of Alzheimer's disease.

[0030] This invention thoroughly explores the mechanism of action of TOP1mt in Alzheimer's disease, finding that the TOP1mt content in the brains of Alzheimer's patients is significantly reduced, and TOP1mt-encoding gene knockout mice exhibit Alzheimer's-like learning and memory impairments. Further research revealed that TOP1mt gene deletion leads to increased APP and Aβ levels, ultimately resulting in Alzheimer's-like learning and memory impairments; therefore, TOP1mt can serve as a potential therapeutic target for Alzheimer's disease. Further research showed that at the cellular level, TOP1mt overexpression significantly reduces cellular APP and Aβ levels; simultaneously, at the animal level, TOP1mt overexpression improves learning and memory abilities in Alzheimer's mice.

[0031] In some embodiments, the drug has any one of the following functions: (1) Increase the protein level of TOP1mt; (2) Promotes the expression of the TOP1mt encoding gene.

[0032] This invention also provides the use of a substance that promotes the expression of TOP1mt or its encoding gene in the preparation of a medicament for treating Alzheimer's disease. The nucleotide sequence of the TOP1mt encoding gene is shown in SEQ ID NO: 1.

[0033] This invention utilizes human brain tissue, animal models, and cell models to demonstrate that TOP1mt plays a crucial role in Alzheimer's disease. TOP1mt deficiency leads to increased levels of APP and Aβ, resulting in Alzheimer's-like learning and memory impairment. Furthermore, at both cellular and animal levels, overexpression of TOP1mt has been validated to significantly reduce APP and Aβ levels, potentially improving or even treating Alzheimer's disease.

[0034] In some embodiments, the substance that promotes the expression of TOP1mt or its encoding gene is a TOP1mt encoding gene overexpression plasmid (i.e., a plasmid that overexpresses the TOP1mt encoding gene).

[0035] This invention also provides a drug for treating Alzheimer's disease, wherein the drug includes a substance that promotes the expression of TOP1mt or its encoding gene.

[0036] In some embodiments, the substance that promotes the expression of TOP1mt or its encoding gene is a TOP1mt encoding gene overexpression plasmid (i.e., a plasmid that overexpresses the TOP1mt encoding gene).

[0037] In some embodiments, the dosage form of the drug includes, but is not limited to, injections, tablets, or capsules.

[0038] In some embodiments, the medicament further includes a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable additive.

[0039] In some embodiments, the pharmaceutically acceptable carrier includes at least one of a flow aid, diluent, wetting agent, suspending agent, solvent, and emulsifier.

[0040] In some embodiments, the pharmaceutically acceptable adjuvant includes at least one of preservatives, colorants, flavoring agents, stabilizers, and isotonic agents.

[0041] The present invention will be further described below through specific embodiments.

[0042] In the following examples, for statistical analyses, the experimental results were analyzed using ImageJ software, and the data are expressed as Mean ± SEM (standard error). All immunoblotting analyses used a t-test (Prism 10) with the internal reference (Gapdh or β-actin) band gray value set to 1.0.

[0043] Unless otherwise specified, the materials and equipment used in the following embodiments are all commercially available products.

[0044] Example 1 Human brain sample acquisition: Brain tissue and slices from healthy individuals, as well as brain tissue and slices from Alzheimer's disease (AD) patients, were obtained from samples from the National Developmental and Functional Human Brain Tissue Resource Bank. All related experiments were approved by the university's ethics committee.

[0045] Western blot analysis (WB): Proteins were extracted from brain tissue of healthy individuals (NDC group) and AD patients (AD group). Protein concentration was determined using the BCA (diquinoline carboxylic acid) method. After denaturation by boiling at 95°C, proteins were subjected to SDS-PAGE. Proteins were transferred to a PVDF (polyvinylidene fluoride) membrane using a wet transfer method, and non-specific binding sites were blocked with 5% skim milk. Primary antibody was incubated overnight at 4°C, and secondary antibody was incubated at room temperature for 1 hour. Changes in protein expression levels were detected using an ECL (electrochemiluminescence) imaging system.

[0046] The results are as follows Figure 1 As shown, the TOP1mt level in the cerebral cortex and hippocampus of AD patients is significantly reduced.

[0047] Example 2 Behavioral testing of mice: The experimental group was TOP1mt gene knockout (TOP1mt - / -Mice were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., while the control group consisted of wild-type (WT) mice from the same littermate. All mice were 7-8 months old and male. All animal experiments were approved by the university's animal experiment ethics committee.

[0048] Using WT mice and TOP1mt - / - Fifteen mice of each type were used for the following tests: (1) Y-maze test: The maze is divided into three arms, A, B and C. The mouse is placed at the end of arm A and explores the maze freely for 5 minutes. The number of times the mouse enters the arm is recorded.

[0049] (2) New object recognition test: Two identical objects A and B were placed in the experimental box, and the exploration time of the mouse was recorded; after 24 hours, A was replaced with a new object C for testing, and the exploration time was recorded.

[0050] (3) Morris water maze experiment: The mice were trained to navigate to the platform for 60 seconds each time for 5 consecutive days. The time it took for the mice to find the platform was recorded. After the training, the mice were tested for spatial exploration 24 hours and 72 hours later. The platform was removed and the time spent in the target quadrant and the number of times the mice crossed the original platform were recorded.

[0051] The results are as follows Figure 2 As shown, in the Y-maze experiment, TOP1mt - / - The spontaneous conversion rate of mice was much lower than that of WT mice, indicating that TOP1mt - / - Mice have decreased spatial memory (e.g.) Figure 2 As shown in a). New Object Recognition (NOR) experiments found (as shown in a). Figure 2 (as shown in b) TOP1mt - / - The discrimination index (DI) of the mice was significantly lower than that of the WT mice, indicating that TOP1mt - / - The absence of these features leads to impaired non-spatial learning, recognition, and memory abilities in mice. The Morris water maze test is a classic experiment for assessing hippocampal cognitive function. WT mice and TOP1mt mice... - / - The time to find a plateau in mice gradually decreased during training, but there was no significant difference between the two groups, indicating that TOP1mt - / - The absence did not significantly affect the spatial learning ability of mice (e.g. Figure 2 (as shown in c). TOP1mt was observed 24 and 72 hours after training. - / - Mice crossed the original platform significantly fewer times than WT mice, and the TOP1mt at 72 hours after training ended was also significantly lower. - / - The time mice spent in the target quadrant decreased (e.g. Figure 2 (as shown in d and e), these all indicate TOP1mt - / - The mice's memory was impaired.

[0052] Example 3 The experimental group consisted of TOP1mt gene knockout (TOP1mt - / - Mice were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., while the control group consisted of wild-type (WT) mice from the same littermate. All mice were 7-8 months old and male. All animal experiments were approved by the university's animal experiment ethics committee.

[0053] Mouse heart tissue was perfused with saline to obtain tissue samples. Bilateral cerebral cortex and hippocampal tissue were collected. The left side was flash-frozen in liquid nitrogen and stored at -80°C, while the right side was fixed in 4% paraformaldehyde for 36 hours to prepare 5-micron paraffin sections.

[0054] Western blot analysis (WB) was used to detect APP levels: Protein concentration was determined by BCA method after extraction from brain tissue. Following boiling denaturation at 95°C, SDS-PAGE was performed. Proteins were then transferred to a PVDF membrane using wet transfer, and non-specific binding sites were blocked with 5% skim milk. Primary antibody was incubated overnight at 4°C, and secondary antibody was incubated at room temperature for 1 hour. Protein expression levels were detected using an ECL imaging system.

[0055] APP mRNA expression was detected by reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR): Total RNA was extracted from mouse brain tissue using a triazine gel, and cDNA was synthesized using a reverse transcription kit. TaqMan probes were used to amplify APP and the internal control GAPDH via real-time quantitative PCR. This method calculates the expression level of APP mRNA.

[0056] Enzyme-linked immunosorbent assay (ELISA) was used to detect Aβ levels: Mouse cerebral cortex protein samples and standards were diluted and added to the wells of an ELISA plate. Biotinylated Aβ protein antibody was added according to the kit instructions and incubated for 1 hour. The enzyme conjugate-labeled protein was added and incubated again for 30 minutes. Finally, stop solution was added, and the absorbance was measured at 450 nm using an ELISA reader. The sample concentration was calculated using a standard curve.

[0057] The results are as follows Figure 3 As shown, compared with WT mice, Top1mt - / - APP levels in the cerebral cortex and hippocampus of mice were significantly increased (e.g. Figure 3 (as shown in a); RT-qPCR results showed that, compared with WT mice, Top1mt - / - The levels of APP mRNA in the cerebral cortex and hippocampus of mice were also significantly increased (e.g. Figure 3 (as shown in b) ELISA results showed that, compared with WT mice, Top1mt - / - Aβ40 was significantly increased in the mouse cerebral cortex, but Aβ38 and Aβ42 showed no significant changes (e.g., Figure 3 (as shown in c in the diagram).

[0058] Example 4 N2a-sw (N2a from the stable human APP Swiss mutant) was a gift from another laboratory. Cells were cultured in a cell culture incubator at a constant temperature of 37°C and 5% CO2, and aseptic techniques were strictly followed during the experiment.

[0059] The TOP1mt overexpression plasmid (purchased from Qianming Biotechnology (Shenzhen) Co., Ltd., model YM61350, details are as follows) was used. Figure 4 The plasmid (shown in the image) and the empty vector plasmid (purchased from Remy Biotech, model YM59392) were electroporated into N2a-sw cells, including the following steps: (1) When N2a-sw cells reach 70-80% confluence (approximately 8 × 10⁻⁶ cells), 6 (1 pc), digested with EDTA-free (ethylenediaminetetraacetic acid) trypsin, centrifuged (1200 rpm, 3 min) after digestion was terminated, and washed once with 5 mL of phosphate-buffered saline (PBS) preheated to 37 °C to remove serum and residual enzymes.

[0060] (2) Completely aspirate the PBS, resuspend the cells in 110 μL of R buffer (Neon® Kit Buffer R), and add 9 μg of the target plasmid.

[0061] (3) Electroporation parameter settings: pulse voltage is 1200V, pulse width is 10 milliseconds, and pulse count is 3 times.

[0062] (4) Electroporation procedure: Aspirate the cell suspension into the electroporation tube through the Neon micropipette, avoiding air bubbles (air bubbles can cause arc discharge); insert the electroporation tube vertically into the Neon™ NxT host, ensuring contact with the electrode; click “Start”, the system will automatically complete the electroporation and display “Complete”, immediately transfer the liquid in the electroporation tube to preheated complete culture medium (e.g., 1 mL culture medium / 100 μL sample), and mix gently.

[0063] (5) Culture the cells in 10 cm culture dishes (20 ml of culture medium per dish) (without penicillin / streptomycin). Replace with fresh culture medium after 4-6 hours and remove dead cells and electroporation debris.

[0064] (6) Observe the cells 24 hours after electroporation, and continue culturing for one day without changing the medium.

[0065] (7) Change the medium on the second day and add penicillin and streptomycin to the complete culture medium.

[0066] (8) Continue culturing for two more days and then collect the cells and supernatant.

[0067] (9) Test the expression levels of APP and Aβ by WB.

[0068] The results are as follows Figure 5 As shown, overexpression of TOP1mt can significantly reduce the APP level in N2a-sw cells (e.g., ...). Figure 5 As shown in a), Aβ40 levels decreased significantly, but Aβ42 levels and the Aβ42 / Aβ40 ratio (i.e., the ratio of Aβ42 levels to Aβ40 levels) remained unchanged (as shown in a figure). Figure 5 (as shown in b in the text).

[0069] Example 5 5×FAD mice (carrying human APP gene mutations: Swedish mutation (K670N / M671L), Florida mutation (I716V), London mutation (V717I); human PSEN1 gene mutations: M146L, L286V) were obtained from the Jackson Laboratory.

[0070] Adenovirus (GL3049 pcAAV-CMV-EGFP-tWPA, its spectrum is as follows) Figure 6 As shown, TOP1mt overexpression plasmid (purchase information is the same as the TOP1mt overexpression plasmid in Example 4) and empty vector plasmid (purchase information is the same as the empty vector plasmid in Example 4) are packaged separately. Then, the corresponding plasmids and corresponding helper packaging plasmids (pHelper, pAAVRC) are co-transfected into packaging cells to finally obtain purified adeno-associated virus solution. The specific steps include the following: (1) AAV 293T cells were plated into 10cm culture dishes. On the day of the experiment, the degree of polymerization was guaranteed to reach 80% and the cells were in good condition.

[0071] (2) Preparation of transfection solution 1. Gently mix 500 μL of OPTI-MEM medium, 6 μg of pHelper, 3 μg of pAAVRC and 9 μg of TOP1mt overexpression plasmid with a p1000 pipette and let stand for 5 minutes.

[0072] (3) Prepare transfection solution 2. Gently mix 500 μL of OPTI-MEM medium and 35 μL of Lipofiter (lipid fixative) with a p1000 pipette and let stand for 5 minutes.

[0073] (4) Gently add transfection solution 1 to transfection solution 2, mix gently with a p1000 pipette, and let stand for 5 minutes. Gently add the mixture dropwise to AAV 293T medium with a p200 pipette. Gently replace with fresh medium 6 hours after transfection.

[0074] (5) Start timing from after transfection. Observe the cell status after 48 hours. After 72 hours, culture the cells for several generations. The cell culture process completes the replication and release of rAAV virus.

[0075] (6) After the cell supernatant produces a sufficient amount of rAAV, the cells are lysed and purified by ultracentrifugation. The cell pellet is removed by centrifugation at 10,000 rpm, 4°C, and 3 minutes. The mixture is then filtered through a 0.45 μm filter. The virus solution is aliquoted into sterile and pre-cooled EP tubes, with each tube containing 50 μL. The viral titer of the target virus is detected by RT-qPCR. If the viral titer reaches the target, the tube wall information is marked, and the corresponding virus is stored at -80°C.

[0076] (7) After collecting the virus, the remaining cell precipitate is pasteurized and then discarded.

[0077] Sequencing was performed using the following primers, and the sequencing results confirmed that the adeno-associated virus successfully packaged the TOP1mt overexpression plasmid (i.e., the adenovirus overexpression plasmid, the image of which is shown below). Figure 7 (As shown).

[0078] Forward sequencing primers (CMV-F): CGCAAATGGGCGGTAGGCGTG (as shown in SEQ ID NO: 2); Reverse sequencing primer (EGFP-SEQR): GACACCGCTGAACTTGTGGC (as shown in SEQ ID NO: 3).

[0079] The viral titer of the adeno-associated virus fluid obtained above was determined, and the results are shown in Figure 1.

[0080] Table 1. Virus titer test results

[0081] In addition, the only difference between the adenovirus packaging empty vector plasmid and the above steps is that the TOP1mt overexpression plasmid is replaced with an empty vector plasmid.

[0082] Injecting adenovirus overexpression plasmid and adenovirus empty vector plasmid into the lateral ventricle of 5×FAD mice, specifically including the following steps: Anesthetize mice with isoflurane (induction concentration 3-4%, maintenance concentration 1.5-2%). Fix the mouse head in a stereotaxic apparatus, ensuring the incisor hooks are horizontally aligned with the ear rods. Locate the anterior fontanelle (Bregma): Use a stereotaxic apparatus to adjust the skull to a horizontal position (height difference between the anterior fontanelle and the Lambda point ≤ 0.1 mm). Ventricular coordinates: posterior to the anterior fontanelle: 0.5 mm; para-midline: 1.0 mm (unilateral injection); depth: 2.4 mm.

[0083] Aspirate the adeno-associated virus solution into a glass microneedle (avoiding air bubbles) and inject it into both lateral ventricles of the mouse brain according to the ventricular coordinates described above. Virus volume: 1 µL (2 × 10⁻⁶). 8 TU / mL); Speed: 100 nL / min (controlled by microinjection pump); Needle retention time: Leave the needle in place for 5-10 minutes after injection, then slowly withdraw the needle.

[0084] One month after injection, the expression level of TO1mt was detected by Western blotting, and related tests were performed.

[0085] Fifteen WT C57 / B6 mice (WT group), 15 5×FAD mice injected with empty vector plasmid (5×FAD (empty plasmid) group), and 15 5×FAD mice injected with TOP1mt overexpression plasmid (5×FAD (overexpression plasmid) group) were used. All mice were 4 months old. Following the experimental method in Example 2, the Y-maze test, new object recognition test, and Morris water maze test were performed. The results are as follows: Figure 8 As shown.

[0086] It is evident that in the Y-maze experiment, the spontaneous conversion rate of mice in the 5×FAD (empty plasmid) group was significantly lower than that in the WT group, indicating a decline in spatial memory ability in the 5×FAD (empty plasmid) group. Simultaneously, the spontaneous conversion rate of mice in the 5×FAD (overexpression plasmid) group showed some increase, but remained lower than that in the WT group (e.g., ...). Figure 8 (as shown in a).

[0087] New Object Recognition (NOR) experiments have found (e.g.) Figure 8 As shown in b), the discrimination index (DI) of mice in the 5×FAD (empty plasmid) group was significantly lower than that of mice in the WT group. At the same time, the DI of mice in the 5×FAD (overexpression plasmid) group increased, but was still lower than that of mice in the WT group.

[0088] The water maze experiment results showed that the time it took for the three groups of mice to find the platform gradually decreased during training, but overexpression of TOP1mt did not significantly improve the learning ability of the mice (e.g., Figure 8 (As shown in c). At 24 and 72 hours after training, the number of times mice in the 5×FAD (overexpression plasmid) group crossed the original platform and the time spent in the target quadrant were significantly higher than those in the 5×FAD (empty plasmid) group (as shown in c). Figure 8 As shown in d and e in the figure, these results all indicate that overexpression of TOP1mt can improve memory ability in AD mice.

[0089] In summary, this invention utilizes TOP1mt homozygous knockout mice (TOP1mt... - / -Using NN2a-sw as an animal model and NN2a-sw as a cell model, behavioral, immunoblotting, and RT-qPCR experiments were employed to investigate the role of TOP1mt in Alzheimer's disease (AD). The study found a significant decrease in TOP1mt levels in the brains of AD patients. - / - Mice exhibited Alzheimer's disease-like learning and memory impairment. TOP1mt deletion not only directly increased APP mRNA and protein expression levels but also led to elevated Aβ levels. At the cellular level, TOP1mt overexpression significantly reduced cellular APP and Aβ levels, improving learning and memory abilities in Alzheimer's mice. Therefore, it can be concluded that TOP1mt deletion promotes increased Aβ levels, ultimately leading to Alzheimer's-like learning and memory impairment. TOP1mt may serve as a potential target for Alzheimer's disease treatment, and overexpression of TOP1mt can significantly reduce APP and Aβ levels, improve learning and memory abilities in Alzheimer's mice, thus potentially enabling the treatment of Alzheimer's disease.

[0090] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. Application of mitochondrial topoisomerase I or its encoding gene as a therapeutic target in screening or preparing drugs for the treatment of Alzheimer's disease.

2. The application according to claim 1, characterized in that, The drug has any one of the following functions: (1) Increase the level of mitochondrial topoisomerase I; (2) Promotes the expression of the gene encoding mitochondrial topoisomerase I.

3. The use of a substance that promotes the expression of mitochondrial topoisomerase I or its encoding gene in the preparation of a drug for the treatment of Alzheimer's disease.

4. The application according to claim 3, characterized in that, The substance that promotes the expression of the mitochondrial topoisomerase I encoding gene is an overexpression plasmid of the mitochondrial topoisomerase I encoding gene.

5. A drug for treating Alzheimer's disease, characterized in that, The drug includes substances that promote the expression of mitochondrial topoisomerase I or its encoding gene.

6. The drug according to claim 5, characterized in that, The substance that promotes the expression of mitochondrial topoisomerase I or its encoding gene is a plasmid for overexpressing the mitochondrial topoisomerase I encoding gene.

7. The drug according to claim 5, characterized in that, The dosage forms of the drug include injections, tablets, or capsules.

8. The drug according to claim 5, characterized in that, The drug also includes pharmaceutically acceptable carriers and / or pharmaceutically acceptable additives.

9. The medicament according to claim 8, characterized in that, The pharmaceutically acceptable carrier includes at least one of the following: a flow aid, a diluent, a wetting agent, a suspending agent, a solvent, and an emulsifier.

10. The medicament according to claim 8, characterized in that, The pharmaceutically acceptable additives include at least one of preservatives, colorants, flavoring agents, stabilizers, and isotonic agents.

Images