Application of histone demethylase GmJD5L in regulating soybean flowering time and plant height

Abstract

This invention provides an application of the histone demethylase GmJD5L in regulating soybean flowering time and plant height. The method involves inactivating the soybean histone demethylases GmJD5La and GmJD5Lb. This addresses the lack of existing methods for regulating soybean flowering time and plant architecture, and is applicable to the field of soybean breeding.

Description

Technical Field

[0001] This invention relates to the field of soybean breeding, and more specifically, to the application of a histone demethylase GmJD5L in regulating soybean flowering time and plant height. Background Technology

[0002] Soybeans are rich in nutrients and have a wide range of uses, playing an indispensable role in the grain, oil, and feed industries for a long time. However, a major challenge currently facing soybean production is that supply is severely lagging behind market demand. Against this backdrop, utilizing cutting-edge bio-breeding technologies, especially molecular biology and genetic engineering, to rapidly increase soybean yield has become a key path to solving the domestic soybean supply shortage and ensuring food self-sufficiency.

[0003] As a light-sensitive crop, soybean growth and development are heavily influenced by light conditions. The choice of planting strategies and the fine-tuning of techniques directly determine the plant type and flowering sequence. Plant height is not only a core parameter for evaluating soybean plant type but also profoundly affects plant stability and the potential for optimizing planting density, making it a research hotspot for geneticists and breeders in recent years. On the one hand, ideal plant height enhances the lodging resistance of soybean plants; on the other hand, moderately tall plant types also have unique value in scientific research. For example, tall soybeans provide valuable experimental materials and theoretical models for exploring the lodging resistance mechanism of tall soybean materials under strong winds, improving crop stress resistance, and optimizing resource allocation efficiency. Furthermore, tall plant height can also affect ventilation and light penetration conditions to some extent, indirectly affecting pest and disease control and photosynthetic efficiency. Appropriately increasing soybean plant height can also address the yield reduction problem caused by excessively low plant height in low-latitude southern regions.

[0004] Precise control of flowering time is another cornerstone of soybean yield optimization. Different flowering times give soybean varieties ecological competitiveness in various climatic zones, enabling them to flower and bear fruit in their most suitable growing season, thereby ensuring optimal synchronization of the soybean growth cycle and achieving stable and high yields. Carefully selecting soybean varieties in different geographical regions based on local light and temperature conditions to ensure that their flowering time matches the local environment is an effective strategy to improve soybean planting efficiency and reduce losses caused by climate incompatibility.

[0005] Regulating soybean plant height and flowering time is not only a core element for achieving high-efficiency soybean production and variety improvement, but also a research focus for deeply exploring soybean biological characteristics, expanding its ecological adaptability, and enhancing overall agricultural productivity. However, current soybean breeding and genetic improvement mainly focus on improving stress resistance and yield potential, and existing technologies lack methods for regulating soybean plant architecture and flowering time. Summary of the Invention

[0006] The main objective of this invention is to provide an application of histone demethylase GmJD5L in regulating soybean flowering time and plant height, thereby solving the problem of the lack of methods for regulating soybean flowering time and plant type in the prior art.

[0007] To achieve the above objective, according to a first aspect of the present invention, a method for regulating the flowering time and plant height of soybean is provided, the method comprising: inactivating the histone demethylases GmJD5La and GmJD5Lb of soybean.

[0008] Furthermore, methods to inactivate the soybean histone demethylases GmJD5La and GmJD5Lb include gene editing.

[0009] Furthermore, gene editing methods include the modification of the histone demethylases GmJD5La and GmJD5Lb genes in soybean. GmJD5La and genes GmJD5Lb Gene editing, gene knockout GmJD5La and genes GmJD5Lb .

[0010] Furthermore, gene editing methods include the modification of the soybean protein demethylases GmJD5La and GmJD5Lb genes. GmJD5La and genes GmJD5Lb Editing exon regions to knock out genes GmJD5La and genes GmJD5Lb .

[0011] Furthermore, GmJD5La It has the nucleotide sequence shown in SEQ ID NO: 1.

[0012] Furthermore, GmJD5Lb It has the nucleotide sequence shown in SEQ ID NO: 2.

[0013] Furthermore, gene knockout GmJD5La The methods include: in genes GmJD5La Insert G at position 713; or insert T and A at positions 709 and 710, while deleting four bases from position 709 to position 712.

[0014] Furthermore, gene knockout GmJD5Lb The methods include: in genes GmJD5Lb A T is inserted at position 532; or two bases are deleted between positions 530 and 531.

[0015] Furthermore, gene editing tools include the CRISPR-Cas9 gene editing system.

[0016] Furthermore, the CRISPR-Cas9 gene editing system includes sgRNA, which has a nucleotide sequence as shown in SEQ ID NO: 3.

[0017] Furthermore, regulating soybean flowering time and plant height includes: extending the flowering time of soybeans and increasing the plant height of soybeans.

[0018] To achieve the above objectives, according to a second aspect of the present invention, the application of the above-described method for regulating soybean flowering time and plant height in soybean breeding is provided.

[0019] By applying the technical solution of this invention, the histone demethylases GmJD5La and GmJD5Lb in soybeans can be inactivated through gene editing, thereby enabling effective regulation of soybean plant height and flowering period. This provides a new direction for studying the growth and development mechanism of soybeans and creates germplasm resources for breeding soybean varieties with better plant type and adaptability to diverse planting environments, which can further promote the increase of soybean yield and the innovation of agricultural industry. Attached Figure Description

[0020] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0021] Figure 1 A schematic diagram of the structure of pGES201 in Embodiment 1 of this application specification is shown.

[0022] Figure 2 Example 2 of this application specification is shown. Gmjd5la and Gmjd5lb A diagram illustrating gene editing types.

[0023] Figure 3 The wild type (W82) under long-day growth conditions is shown in Example 3 of this application specification. Gmjd5la and Gmjd5lb Phenotypic diagrams of plant height for the double mutants (corresponding to dm-1 and dm-2, respectively) (scale bar = 8cm); among them, Figure 3 Figure A shows the phenotypic diagram of wild-type plant height under long-day growth conditions. Figure 3 Figure B shows the phenotype of plant height per dm⁻¹ under long-day growth conditions. Figure 3 The figure in C represents the phenotype of plant height in dm⁻² under long-day growth conditions.

[0024] Figure 4 This application specification shows the wild-type wild-type under long-day growth conditions in Example 3 of this application specification. Gmjd5la and Gmjd5lb Plant height statistics of double mutants.

[0025] Figure 5This application specification shows the wild-type wild-type under short-day growth conditions in Example 3 of this application specification. Gmjd5la and Gmjd5lb Phenotypic diagram of plant height of the double mutant (scale bar = 10cm); among which, Figure 5 Figure A shows the phenotypic diagram of wild-type plant height under short-day growth conditions. Figure 5 Figure B shows the phenotype of plant height per dm⁻¹ under short-day growth conditions. Figure 5 The figure in C represents the phenotype of plant height in dm⁻² under short-day growth conditions.

[0026] Figure 6 This application specification shows the wild-type wild-type under short-day growth conditions in Example 3 of this application specification. Gmjd5la and Gmjd5lb Plant height statistics of double mutants.

[0027] Figure 7 This application specification shows the wild-type wild-type under long-day growth conditions in Example 4 of this application specification. Gmjd5la and Gmjd5lb Flowering time typography of the double mutant (scale bar = 4cm); among which, Figure 7 Image A shows the phenotypic diagram of the first flower of the wild-type plant. Figure 7 Figure B shows the plant phenotypic diagram corresponding to the opening of the first flower of the wild-type plant. Figure 7 C represents the phenotypic diagram of the first flower (unopened) at the same time point in dm-1. Figure 7 In the diagram, D represents the plant phenotypic diagram corresponding to dm-1. Figure 7 E is the phenotypic diagram of the first flower (unopened) at the same time point in dm-2. Figure 7 F in the diagram represents the plant phenotype corresponding to dm-2.

[0028] Figure 8 This application specification shows the wild-type wild-type under long-day growth conditions in Example 4 of this application specification. Gmjd5la and Gmjd5lb Statistical chart of flowering time of double mutants. Detailed Implementation

[0029] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0030] Terminology Explanation:

[0031] Flowering time: In this application, flowering time refers to the total number of days from the time the soybean germinates until the first flower fully opens.

[0032] As mentioned in the background section, there is a lack of methods for regulating the flowering period and plant type of soybeans in the prior art. Based on this, the inventors of this application attempt to develop a new method for regulating the flowering time and plant height of soybeans, and thus propose a series of protection schemes in this application.

[0033] In a first typical embodiment of this application, a method for regulating the flowering time and plant height of soybean is provided, the method comprising: inactivating the histone demethylases GmJD5La and GmJD5Lb of soybean.

[0034] Delaying the flowering time of soybeans extends their growth period, allowing for more efficient photosynthesis and thus increasing yield per plant. Furthermore, delayed flowering allows soybeans to better cope with adverse conditions such as drought, water shortages, or cold snaps, avoiding the negative effects of flowering under harsh weather conditions. It also allows soybeans to avoid periods of frequent pest and disease outbreaks, reducing pest and disease pressure, further decreasing pesticide use, and promoting a healthy and balanced agricultural ecosystem. In addition, delayed flowering gives soybeans wider geographical adaptability; late-flowering varieties can grow and develop in more diverse climatic conditions, improving the stability of planting and yield in different regions.

[0035] Tall soybean plants are beneficial for research on crop growth regulation mechanisms, providing genetic and molecular biology researchers with abundant genetic material and promoting in-depth exploration of soybean growth habits and stress tolerance mechanisms. Furthermore, appropriately increasing soybean plant height can address the yield reduction problem caused by excessively short soybean plants in low-latitude southern regions. The existence of tall soybean plants enriches the germplasm resource bank, promotes soybean variety diversity, and provides more options for coping with constantly changing environmental conditions and market demands.

[0036] This application discovers that soybean histone demethylases GmJD5La and GmJD5Lb have the function of regulating plant height and flowering time, and that inactivation of GmJD5La and GmJD5Lb can significantly alter plant height and flowering time. The discovery of the function of GmJD5La and GmJD5Lb provides necessary genetic material for a deeper understanding of the mechanism of soybean plant height and flowering time regulation, and offers excellent germplasm resources for the establishment and application of ideal soybean plant architecture.

[0037] In a preferred embodiment, the method for inactivating the soybean histone demethylases GmJD5La and GmJD5Lb includes gene editing; preferably, the gene editing method includes gene editing of the soybean histone demethylases GmJD5La and GmJD5Lb. GmJD5La and genes GmJD5Lb Gene editing is performed to knock out the genes GmJD5La and GmJD5Lb; preferably, the gene editing method includes the gene editing of the soybean protein demethylases GmJD5La and GmJD5Lb. GmJD5La and genes GmJD5Lb Editing exon regions to knock out genes GmJD5La and genes GmJD5Lb .

[0038] The above gene editing includes, but is not limited to, the gene sequences corresponding to the above dehistone methyltransferases GmJD5La and GmJD5Lb (respectively...). GmJD5La and GmJD5Lb Adding, replacing, or removing one or more bases causes a frameshift mutation in the corresponding gene, resulting in the inactivation of histone demethylases GmJD5La and GmJD5Lb, thereby regulating soybean plant height and extending flowering time. This "knockout" is not limited to the complete removal of the histone demethylase genes GmJD5La and GmJD5Lb from the plant genome. "Knockout" includes modifying the genes through gene editing to cause mutations in one or more bases, which, through frameshift mutations or other methods, prevent the remaining gene sequence from functioning properly.

[0039] In a preferred embodiment, the gene GmJD5La Having the nucleotide sequence shown in SEQ ID NO: 1; gene GmJD5Lb It has the nucleotide sequence shown in SEQ ID NO: 2.

[0040]

[0041]

[0042] In a preferred embodiment, gene knockout GmJD5La The methods include: in genes GmJD5La Insert G at position 713; or insert T and A at positions 709 and 710, while deleting four bases from position 709 to position 712.

[0043] In a preferred embodiment, gene knockout GmJD5Lb The methods include: in genes GmJD5Lb A T is inserted at position 532; or two bases are deleted between positions 530 and 531.

[0044] GmJD5La and GmJD5Lb When the above mutation occurs in the exon region of the gene, the gene is knocked out, resulting in the inactivation of the corresponding dehistone methyltransferase proteins GmJD5La and GmJD5Lb. This has the potential to increase the plant height and prolong the flowering time of soybean, and provides theoretical support for the study of soybean plant height and flowering time. It can also provide good germplasm resources for the establishment and application of ideal soybean plant type.

[0045] In a preferred embodiment, the gene editing tool includes the CRISPR-Cas9 gene editing system.

[0046] In a preferred embodiment, the CRISPR-Cas9 gene editing system includes sgRNA having a nucleotide sequence as shown in SEQ ID NO: 3.

[0047] SEQ ID NO: 3: TCGCGAATTTGATATGGCAG.

[0048] Gene GmJD5La and genes GmJD5Lb As homologous genes, they share high sequence similarity, with a genome sequence similarity of 82.44% and a coding region similarity of 94.7%. Therefore, the sgRNA in this application can simultaneously target genes. GmJD5La and genes GmJD5Lb To achieve gene GmJD5La and genes GmJD5Lb The knockout is efficient and maintains a relatively stable editing effect. Those skilled in the art can, on the other hand, target genes separately. GmJD5La and genes GmJD5Lb Designing sgRNAs can simultaneously knock out two genes, and can also inactivate the histone demethylase proteins GmJD5La and GmJD5Lb, achieving the technical effects of this application. Those skilled in the art can choose flexibly according to the actual situation.

[0049] Using the sgRNA obtained above to edit soybean genes can produce two types of edited genes. GmJD5La and genes GmJD5Lb Double mutants, including: (1) in the gene GmJD5La Insert G at the 713th position, and in GmJD5Lb Insert T at position 532; (2) in the gene GmJD5La Insert T and A at positions 709 and 710, respectively, along with a 4-base deletion from positions 709 to 712, and in the gene... GmJD5Lb The two mutants have two bases deleted at positions 530 and 531. Under long-day conditions, these two double mutants have a significantly longer flowering time than the wild type, and their plant height is also significantly increased compared to the wild type. The acquisition of these two mutants provides germplasm resources for breeding soybean varieties with better plant type and adaptability to diverse planting environments, which can further promote soybean yield improvement and agricultural industry innovation.

[0050] In a preferred embodiment, regulating soybean flowering time and plant height includes: extending soybean flowering time and increasing soybean plant height.

[0051] In a second typical embodiment of this application, the above-mentioned method for regulating soybean flowering time and plant height is provided for application in soybean breeding.

[0052] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0053] Unless otherwise specified, the reagents used in the embodiments of this application are all commercially available products.

[0054] Example 1 Soybeans GmJD5La and GmJD5Lb Construction of gene knockout vector

[0055] To investigate the function of the soybean histone demethylase GmJMJD5, the gene number was determined based on the information provided in the literature (doi: 10.3389 / fpls.2016.01800). Glyma.12G055000 and Glyma.11G130600 The sequence information of the corresponding gene was found on the soybean database website Soybase (SoyBase.org). (The soybean genome is constantly updated and has three main versions; this application...) Glyma.12G055000 Corresponding to the V4 version sequence Glyma.11G130600 (corresponding to the V2 version sequence), and named them respectively. GmJD5La (GmJMJD5-LIKE a, SEQ ID NO: 1) and GmJD5Lb(GmJMJD5-LIKE b, SEQ ID NO: 2), then use the website http: / / crispor.tefor.net / to... GmJD5La and GmJD5Lb sgRNA was designed based on the exon region sequences of the genome.

[0056] Based on the score, select the sgRNA, and then design the primers required for the knockout vector based on the sgRNA sequence. The nucleotide sequences of the primers are as follows:

[0057] 201-F: GGATTGTCGCGAATTTGATATGGCAG (SEQ ID NO: 4);

[0058] 201-R: AAACCTGCCATATCAAATTCGCGACA (SEQ ID NO: 5).

[0059] The vector construction process is as follows: The upstream and downstream primer powders of sgRNA are diluted with water to 100 μmol, then mixed 1:1 and annealed. The annealed primers are then used to construct the gene knockout vector pGES201 (the vector structure diagram of pGES201 is shown below). Figure 1 As shown, where, Figure 1 In this context, "promotor" refers to the promoter, "terminator" refers to the terminator, "repeat" refers to the repeat sequence, "gRNA scaffold" refers to the gRNA backbone sequence, "Nucleoplasmin NLS" refers to the nucleoplasmic protein nuclear localization signal, "CAP binding site" refers to the CAP binding site, "pVS1 RepA" refers to the pVS1 replication protein, and "CaMVpolyA signal" refers to the CaMV polyA signal. BsaI endonuclease, T4 DNA ligase, and ligase buffer are mixed and used in a PCR instrument for simultaneous digestion and ligation. After the reaction, the ligation product is transformed into *E. coli* DH5α. Plasmids from the two correctly sequenced vectors are extracted and further transformed into *Agrobacterium* EHA105. The correctly identified bacteria are then sent to the biotechnology platform of the Institute of Modern Agriculture, Peking University for cotyledon transformation.

[0060] Example 2: Extraction and PCR detection of genomic DNA from transgenic soybean.

[0061] 2.1 Extraction of soybean genomic DNA using the CTAB method

[0062] Take leaf tissue samples with a diameter of 6 mm using a leaf sampling punch, place them in a 2 mL EP tube, add a clean steel ball with a diameter of 2 mm, pre-cool in liquid nitrogen, and then sample using a sampler at 50 Hz for 1 min; add 300 μL of CTAB extraction buffer, shake thoroughly, and incubate at 65 °C for 30 min; cool to room temperature, add 300 μL of phenol:chloroform:isoamyl alcohol (25:24:1), mix well; centrifuge at 12000 rpm for 10 min, aspirate the supernatant to a new 1.5 mL centrifuge tube, add 0.6 times the volume of isopropanol, gently invert to mix, and incubate at -20 °C for 30 min; centrifuge at 12000 rpm for 10 min at room temperature, discard the supernatant, add 1 mL of 70% ethanol to rinse; centrifuge at 12000 rpm for 5 min at room temperature, and blow under a clean bench for 5-10 min; add 50 μL of ddH2O, dissolve, and store at 4 °C.

[0063] 2.2 Identification of T1 generation gene-edited soybean genome amplification

[0064] Using extracted T1 generation transgenic soybean genomic DNA as a template, respectively... GmJD5La and GmJD5Lb The gene was amplified by PCR. The amplification reaction system is shown in Table 1, and the amplification reaction procedure is shown in Table 2.

[0065] Then, the PCR products were subjected to first-generation sequencing to obtain the transgenic material. GmJD5La and GmJD5Lb Gene sequence information was used to determine whether gene editing events had occurred in the transgenic material by comparing it with the reference genome sequence of wild-type W82 (NCBI taxonomy ID: 3847).

[0066] The nucleotide sequences of the amplification primers are as follows:

[0067] J19-CR-F: TGCTAATAGACGTGGCTTTACCTCATTC (SEQ ID NO: 6);

[0068] J19-CR-R: TCCAACATTAGTACTAACACTGGCATGG (SEQ ID NO: 7);

[0069] J20-CR-F: TGACGTTGCTAATAAACGTGGCTTCAC (SEQ ID NO: 8);

[0070] J20-CR-R: GCAGCCATAACACAAATCAACAAATCTCC (SEQ ID NO: 9).

[0071] Table 1

[0072]

[0073] Table 2

[0074]

[0075] Two μL of PCR product was analyzed by 1% agarose gel electrophoresis, and the remaining products were sequenced and compared. Sequencing and alignment revealed two types of editing. Gmjd5la and Gmjd5lb Double mutants, namely dm-1: Gmjd5la-1 + Gmjd5lb-1 And dm-2: Gmjd5la-2 + Gmjd5lb-2 . Gmjd5la and Gmjd5lb A diagram illustrating gene editing types is shown below. Figure 2 As shown, where, Figure 2 The underlined portion represents the sequence corresponding to the sgRNA. SEQ ID NO: 10 is wild-type soybean. GmJD5La The sequence located at positions 689-727 on the nucleotide sequence, SEQ ID NO: 11, represents the first double mutant (dm-1) after gene editing. GmJD5La The corresponding nucleotide sequence, SEQ ID NO: 12, represents the second double mutant (dm-2) after gene editing. GmJD5La The corresponding nucleotide sequence; SEQ ID NO: 13 Wild-type soybean GmJD5Lb The sequence located at positions 508-546 on the nucleotide sequence, SEQ ID NO: 14, represents the first double mutant (dm-1) after gene editing. GmJD5Lb The corresponding nucleotide sequence, SEQ ID NO: 15, represents the second double mutant (dm-2) after gene editing. GmJD5Lb The corresponding nucleotide sequence; the three bases highlighted in red are PAM sites (NGG, where "N" represents any base, as per this application). Figure 2 (The middle one is AGG).

[0076] SEQ ID NO: 10: TCGTCGATCGCGAATTTGATATGGCAGAGGTGAGGTCT.

[0077] SEQ ID NO: 11: TCGTCGATCGCGAATTTGATATGGGCAGAGGTGAGGTCT.

[0078] SEQ ID NO: 12: TCGTCGATCGCGAATTTGATTACAGAGGTGAGGTCT.

[0079] SEQ ID NO: 13: TCGTCGATCGCGAATTTGATATGGCAGAGGTGAGGTCG.

[0080] SEQ ID NO: 14: TCGTCGATCGCGAATTTGATATGGTCAGAGGTGAGGTCT.

[0081] SEQ ID NO: 15: TCGTCGATCGCGAATTTGATATCAGAGGTGAGGTCT.

[0082] Example 3 Soybeans Gmjd5la and Gmjd5lb Plant height determination of double mutant materials

[0083] Wild-type soybean material W82 and Gmjd5la and Gmjd5lb Seeds of gene knockout double mutant materials were germinated in nutrient pots filled with peat substrate (PINDSTRUP, 10-30 mm, pH 5.5) and placed in long-day and short-day soybean growing rooms, respectively.

[0084] The photoperiod for long-day soybeans was 16 hours, with lights off for 8 hours and a temperature of 25°C. The photoperiod for short-day soybeans was 12 hours, with lights off for 12 hours and a temperature of 25°C. When the transgenic soybean material showed a significant difference in plant height compared to the control material during its growth stage, its plant height was measured and statistically analyzed. The measurement standard was the length from the point where the soybean emerged from the soil to the highest point of the soybean plant stem.

[0085] Through observation and measurement Gmjd5la and Gmjd5lb The plant height phenotype of the double mutant materials showed that, compared with the wild-type control material W82, the plant height was significantly lower under both long-day and short-day conditions. Gmjd5la and Gmjd5lb The double mutant materials (dm-1 and dm-2) both exhibited a significant increase in plant height, as shown in the results. Figures 3 to 6 As shown. Among them, Figure 3 Wild type under long-day growth conditions Gmjd5la and Gmjd5lb Phenotypic diagram of plant height of double mutants. Figure 3 Figure A shows the phenotypic diagram of wild-type plant height under long-day growth conditions. Figure 3 Figure B shows the phenotype of plant height per dm⁻¹ under long-day growth conditions. Figure 3 The figure in C represents the phenotype of plant height in dm⁻² under long-day growth conditions. Figure 4 Wild type under long-day growth conditions Gmjd5la and Gmjd5lbPlant height statistics of double mutants (W82, dm-1 and dm-2) p <0.05, p <0.01, p <0.001 (t-test)).

[0086] Figure 5 Wild type under short-day growth conditions Gmjd5la and Gmjd5lb Phenotypic diagram of plant height of the double mutant, in which... Figure 5 Figure A shows the phenotypic diagram of wild-type plant height under short-day growth conditions. Figure 5 Figure B shows the phenotype of plant height per dm⁻¹ under short-day growth conditions. Figure 5 C represents the phenotype of plant height in dm⁻² under short-day growth conditions; Figure 6 Wild type under short-day growth conditions Gmjd5la and Gmjd5lb Plant height statistics of double mutants (W82, dm-1 and dm-2) p <0.05, p <0.01, p <0.001 (t-test)). From the above results, it can be seen that this invention, through knockout... Gmjd5la and Gmjd5lb Genes can regulate soybean plant height.

[0087] Example 4 Soybeans Gmjd5la and Gmjd5lb Flowering time statistics of double mutant materials

[0088] Wild-type soybean material W82 and Gmjd5la and Gmjd5lb Seeds of the gene knockout material were germinated in nutrient pots filled with substrate soil and placed in a long-day growing room. The long-day growing room had 16 hours of light exposure, 8 hours of darkness, and a temperature of 25°C. The emergence time and the time when the first flower fully opened for each soybean plant were recorded, and the difference in days between the two was counted as the flowering time. The results were analyzed using the wild-type control material W82 and... Gmjd5la and Gmjd5lb Flowering time of double mutant materials was observed under long-day conditions, revealing wild-type and... Gmjd5la and Gmjd5lb The flowering time of the double mutant material was significantly later than that of the control wild-type W82, as shown in the results. Figure 7 and Figure 8 As shown.

[0089] in, Figure 7Wild type under long-day growth conditions Gmjd5la and Gmjd5lb Flowering morphological phenotypic diagrams of the double mutants at the same time point, among which... Figure 7 Image A shows the phenotypic diagram of the first flower of the wild-type plant. Figure 7 Image B shows the phenotypic diagram of a wild-type plant with its first flower open. Figure 7 C represents the phenotypic diagram of the first flower (unopened) at the same time point in dm-1. Figure 7 D represents the phenotypic diagram of dm-1 plants. Figure 7 E is the phenotypic diagram of the first flower (unopened) at the same time point in dm-2. Figure 7 The F-type phenotypic diagram is for dm-2 plants, located in... Figure 7 The upper middle part of the picture ( Figure 7 The first flower in A, C, and E all originate from Figure 7 The lower middle part of the picture ( Figure 7 The corresponding plants in B, D, and F; Figure 8 Wild type under long-day growth conditions Gmjd5la and Gmjd5lb Flowering time statistics of double mutants (W82, dm-1 and dm-2) ( p <0.05, p <0.01, p <0.001 (t-test)).

[0090] The above results demonstrate that the present invention can be achieved by knocking out... GmJD5La Genes and GmJD5Lb Genes regulate the flowering time of soybeans.

[0091] As can be seen from the above description, the embodiments of the present invention achieve the following technical effects: This application achieves the following technical effects by knocking out... GmJD5La and GmJD5Lb Genes have been developed to produce tall soybeans with extended flowering time. The extended flowering time allows for a longer period of vegetative growth in soybean plants, contributing to increased yield. Tall soybeans provide excellent germplasm resources for establishing and applying the ideal soybean plant architecture. The discovery of the functions of the soybean histone demethylases GmJD5La and GmJD5Lb provides essential genetic material for a deeper understanding of the mechanisms regulating soybean plant height and flowering time, which is beneficial for soybean agricultural production and development.

[0092] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for regulating the flowering time and plant height of soybeans, characterized in that, The method includes: inactivating the histone demethylases GmJD5La and GmJD5Lb in soybeans; The method for inactivating the histone demethylases GmJD5La and GmJD5Lb in soybean includes gene editing; The gene editing method includes editing the exon regions of the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 to knock out the genes encoding the protein demethylases GmJD5La and GmJD5Lb; The regulation of soybean flowering time and plant height includes: extending the flowering time of soybeans and increasing the plant height of soybeans.

2. The method according to claim 1, characterized in that, Knockout of genes encoding the protein demethylases GmJD5La and GmJD5Lb includes: 1) Insert G at position 713 of SEQ ID NO: 1; or T and A are inserted at positions 709 and 710, respectively, while four bases from positions 709 to 712 are deleted. 2) Insert a T at position 532 of SEQ ID NO: 2; or Two bases are missing at positions 530 and 531.

3. The method according to claim 1, characterized in that, The gene editing tools include the CRISPR-Cas9 gene editing system.

4. The method according to claim 3, characterized in that, The CRISPR-Cas9 gene editing system includes sgRNA. The sgRNA has a nucleotide sequence as shown in SEQ ID NO:

3.

5. The application of the method for regulating soybean flowering time and plant height according to any one of claims 1 to 4 in soybean breeding.

Images