Methionine gamma-lyase mutant and application thereof

Abstract

The invention belongs to the technical field of enzyme gene engineering, and particularly relates to a methionine gamma-lyase mutant with improved enzyme activity and application thereof. The methionine gamma-lyase mutant CqMGLV160I / V265I with high activity is obtained by taking methionine gamma-lyase (CqMGL) which is derived from Calorama quimayensis and of which cysteine residues at 116 sites are replaced by histidine residues as a parent and carrying out site-specific mutagenesis on amino acid residues at key sites through transformation. The methionine gamma-lyase mutant CqMGLV160I / V265I with high activity can be obtained by using the methionine gamma-lyase mutant CqMGLV160I / V265I as the parent. By adopting the CqMGLV160I / V265I mutant disclosed by the invention, the conversion rate of enzyme catalysis can be improved, allicin is efficiently synthesized, and the mutant is successfully applied to the aspects of food, feed, chemical industry, medicine preparation and the like.

Description

Technical fields: This invention belongs to the field of enzyme genetic engineering technology, specifically relating to a methionine γ-lyase mutant with enhanced enzyme activity and its applications. Background technology: Alliinase isoenzymes are a class of enzymes structurally similar to alliinase that possess the ability to catalyze the synthesis of allicin from alliin. Currently, enzymes known to catalyze alliin primarily originate from two categories: plants and microorganisms. Plant-derived enzymes are mainly from species of the genus *Allium*, including onions (…). Allium cepa ), mountain leeks ( Allium senescens ) and scallions ( Allium schoenoprasum Research on enzymes from microbial sources is relatively limited, with only a few strains of CS lyases reported to have similar functions, such as *Streptococcus appendiculatus*. Ensifer adhaerens ) and copper-loving bacteria ( Cupriavidus necator Enzymes derived from sources such as methionine γ-lyase (MGL, EC 4.4.1.11) belong to the alliinase isoenzyme family, specifically the cystathionine γ-lyase (CGL) subfamily. Their core function is to catalyze the cleavage of the γ-CS bond of methionine, regulating sulfur metabolism pathways. This enzyme is a pyridoxal (PLP)-dependent multifunctional enzyme that catalyzes the production of biologically active allicin, pyruvate, and ammonia from alliin via a β-elimination reaction. The allicin molecule generated during this catalytic reaction can irreversibly covalently target the thiol group (-SH) of the cysteine ​​residue in the enzyme's active site, leading to permanent enzyme inactivation. Existing studies have shown that allicin has a variety of physiological activities, including antibacterial, antioxidant, anti-inflammatory, anti-diabetic, anti-Alzheimer's disease, and anti-cholesterol effects, and has high application value in health care. However, there is very little research on its enzymatic synthesis production method to date.

[0001] Currently, the main methods for producing allicin include natural extraction, chemical synthesis, and enzymatic synthesis. Natural extraction relies on garlic as a raw material, resulting in low extraction rates and limited purity, and is significantly affected by variety and origin. Chemical synthesis is prone to triggering unnecessary side reactions, and deviations in reaction parameters and conditions can significantly impact the synthesis effect, making it unsuitable for large-scale production. Therefore, utilizing green and safe bio-enzymatic methods for the efficient production of allicin has broad application prospects.

[0002] However, the currently obtained MGLs are limited in terms of catalytic activity and stability due to their inherent protein chemical properties. Therefore, obtaining MGLs with high activity and good performance is of great significance for the large-scale production of allicin. SUMMARY The present application aims at: 1) providing a methionine gamma-lyase mutant with improved enzyme activity; 2) providing a recombinant vector or host bacteria expressing the methionine gamma-lyase mutant; and 3) providing the application of the methionine gamma-lyase mutant.

[0003] The present application takes the methionine gamma-lyase from Allium Fistulosum L. Caloramator quimbayensis as the parent, replaces the cysteine residue at position 116 with a histidine residue (the obtained amino acid sequence and gene sequence are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively), solves the problem of oxidation of the thiol group during the reaction of allicin and the suicidal behavior of the enzyme, and then obtains a high-activity alliinase isozyme through site-directed mutagenesis of key amino acid residues.

[0004] One of the technical solutions provided by the present application is a high-activity methionine gamma-lyase mutant, which is obtained by mutating the amino acid residues at positions 160 and 265 from valine (Val) to isoleucine (Ile) based on the original methionine gamma-lyase (CqMGL) amino acid sequence shown in SEQ ID NO. 1, and the mutant is named CqMGL V160I / V265I , and the amino acid sequence is shown in SEQ ID NO. 3.

[0005] The second technical solution provided by the present application is the coding gene of the methionine gamma-lyase mutant in the first technical solution. Further, the coding gene of the methionine gamma-lyase mutant cqmgls , and the nucleotide sequence is shown in SEQ ID NO. 4.

[0006] The third technical solution provided by the present application is a recombinant vector or recombinant strain containing the coding gene in the second technical solution. Further, the expression vector used by the recombinant vector includes but is not limited to pET-22b(+), pET-28a(+), pPIC9K, pBSA43; preferably pET-22b(+). Further, the host cell used by the recombinant strain includes but is not limited to Escherichia coli, Pichia pastoris, and Bacillus subtilis; preferably Escherichia coli.

[0007] The fourth technical solution provided by the present application is the application of the recombinant vector or recombinant strain in the third technical solution, particularly in the preparation of the methionine gamma-lyase mutant in the first technical solution.

[0008] The fifth technical solution provided by this invention is the application of the methionine γ-lyase mutant described in one of the technical solutions; particularly its application in catalyzing the cleavage reaction of the CS bond at the γ position of methionine; even more particularly its application in catalyzing the cleavage reaction of heterocyclic compounds containing sulfur or nitrogen; and even more particularly its application in the catalytic synthesis of allicin using allicin as a substrate.

[0009] Beneficial effects: 1. This invention utilizes site-directed mutagenesis to mutate CqMGL, obtaining a mutant CqMGL with enhanced activity. V160I / V265I .

[0010] 2. Using the CqMGL of this invention V160I / V265I The mutant can improve the conversion rate of enzyme catalysis and efficiently synthesize allicin.

[0011] 3. The present invention also relates to the application of the mutant and allicin obtained from the mutant in food, feed, chemical industry, and pharmaceutical preparation. Attached image description: Figure 1 The recombinant plasmid pET-22b(+)- of this invention cqmgl Enzyme digestion verification diagram Where: M is the DNA Marker, and 1 is the recombinant plasmid pET-22b(+)- from E. coli. cqmgl through Nde I and Xho I. Double enzyme digestion electrophoresis image; Figure 2 The KOD kit of this invention is for the recombinant plasmid pET-22b(+)- cqmgl Reverse PCR amplification electrophoresis image Where: M represents DNA Marker, and 1 represents the number of DNA markers. cqmgl Linear recombinant plasmids of mutant genes; Figure 3 SDS-PAGE image of the purified CqMGL sample. Where: M is the protein marker, and 1 is the original CqMGL purified sample; Figure 4 The mutant CqMGL of this invention V160I / V265I SDS-PAGE image of purified sample Where: M is the protein marker, and 1 is the mutant CqMGL V160I / V265I Purify the sample; Figure 5 The mutant CqMGL of this invention V160I / V265I Colorimetric reaction diagram for the catalytic production of allicin Wherein: the left is the blank control without the addition of reaction sample, and the right is the experimental group reaction solution with the addition of sample solution. DETAILED DESCRIPTION The technical content of the present application will be further described below in conjunction with examples, but the present application is not limited to these examples, and the protection scope of the present application cannot be limited by the following examples.

[0012] 1. The technical route to achieve the purpose of the present application is as follows: The methionine gamma-lyase gene derived from Caloramator quimbayensis was synthesized by Suzhou Silicon-based Biotechnology Co., Ltd., codon-optimized in Escherichia coli, and 5'-end Nde I) and 3'-end Xho I) enzyme cutting sites were added, and the cysteine residue at position 116 was replaced with a histidine residue (the obtained amino acid sequence and gene sequence are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively), in order to prevent the product allicin from oxidizing the thiol group during the reaction, and the enzyme from committing suicide, and the gene was ligated to the vector pET-22b(+) through Nde I and Xho I enzyme cutting sites to prepare recombinant plasmid DNA to obtain recombinant plasmid pET-22b(+) cqmgl , and on this basis, mutation and screening were performed, and the finally screened recombinant plasmid pET-22b(+) cqmgls was transformed into Escherichia coli expression strain BL21(DE3) to obtain recombinant strain BL21(DE3) / pET-22b(+) cqmgls .

[0013] 2. Nomenclature of amino acid and DNA nucleic acid sequences The recognized IUPAC nomenclature of amino acid residues is used in the form of three-letter / one-letter code. The recognized IUPAC nomenclature is used for DNA nucleic acid sequences.

[0014] 3. Identification (nomenclature) principle of CqMGL mutants The amino acid mutation in the CqMGL mutant is represented by "original amino acid residue + residue position + replaced amino acid residue". For example, Val160Ile (V160I), which means that the amino acid at position 160 is replaced from valine (Val) of the original CqMGL to isoleucine (Ile), and the position number corresponds to the amino acid sequence number of the original CqMGL in SEQ ID NO. 1.

[0015] In the present application, the lower italic cqmgl represents the encoding gene of the original CqMGL, and the lower italic cqmgls represents the encoding gene of the mutant CqMGL V160I / V265I , and the information is as follows.

[0016]

[0017] In the present application, the wild-type methionine gamma-lyase derived from Caloramator quimbayensis has the following amino acid sequence: MDKEKLKKMGFATKAIHGGYEHNDKGALATPIYQTSTFIFDSAEQGGRRFALEEGGHIYTRLGNPTNDQVEEKVALLEGAEAAVSTGSGIGAITSALWTILKSGDHIIASDTLYGCTFAFLNHGLTRFGVEVTFVDATDPENVRKAMKENTKAVYLESPVNPTLEVVDIEAISKIAHEKEGCMVVVDNTFCTPYIQRPIELGADVVVHSATKFLNGHGDVIAGFVAGKQEYIKNVRLFGIKDMTGSCLSPFNAYLILRGMKTLEVRMEKHCSNAMKVAEFLESHPAVEKVYYPGLKSFPQYELAKKQMSLPGAIIAFEIKGGVEEGKKVMNNVKLCTLAVSLGDTETLIEHPASMTHSPYTAEERLEAGISDGLIRLAVGLEDPQDIIDDLKQALDLIL.

[0018] In the present application, the enzyme in which the cysteine residue at position 116 is replaced by a histidine residue based on the wild-type methionine gamma-lyase is named original CqMGL, and has the following amino acid sequence: MDKEKLKKMGFATKAIHGGYEHNDKGALATPIYQTSTFIFDSAEQGGRRFALEEGGHIYTRLGNPTNDQVEEKVALLEGAEAAVSTGSGIGAITSALWTILKSGDHIIASDTLYGHTFAFLNHGLTRFGVEVTFVDATDPENVRKAMKENTKAVYLESPVNPTLEVVDIEAISKIAHEKEGCMVVVDNTFCTPYIQRPIELGADVVVHSATKFLNGHGDVIAGFVAGKQEYIKNVRLFGIKDMTGSCLSPFNAYLILRGMKTLEVRMEKHCSNAMKVAEFLESHPAVEKVYYPGLKSFPQYELAKKQMSLPGAIIAFEIKGGVEEGKKVMNNVKLCTLAVSLGDTETLIEHPASMTHSPYTAEERLEAGISDGLIRLAVGLEDPQDIIDDLKQALDLIL.

[0019] In the present application, the mutant CqMGL V160I / V265I , the amino acid sequence of which is shown in SEQ ID NO. 3: MDKEKLKKMGFATKAIHGGYEHNDKGALATPIYQTSTFIFDSAEQGGRRFALEEGGHIYTRLGNPTNDQVEEKVALLEGAEAAVSTGSGIGAITSALWTILKSGDHIIASDTLYGHTFAFLNHGLTRFGVEVTFVDATDPENVRKAMKENTKAVYLESPINPTLEVVDIEAISKIAHEKEGCMVVVDNTFCTPYIQRPIELGADVVVHSATKFLNGHGDVIAGFVAGKQEYIKNVRLFGIKDMTGSCLSPFNAYLILRGMKTLEIRMEKHCSNAMKVAEFLESHPAVEKVYYPGLKSFPQYELAKKQMSLPGAIIAFEIKGGVEEGKKVMNNVKLCTLAVSLGDTETLIEHPASMTHSPYTAEERLEAGISDGLIRLAVGLEDPQDIIDDLKQALDLIL.

[0020] 4. The culture medium used in the embodiments of the present application is as follows: LB medium (g / L): yeast extract 5.0, tryptone 10.0, NaCl 10.0.

[0021] The solid medium of the above-mentioned culture medium is added with 2% agar.

[0022] 5. Principle of methionine γ-lyase enzyme activity determination Methionine γ-lyase depends on the cofactor pyridoxal phosphate (PLP) to catalyze the β-elimination reaction of alliin, break the C-S bond, and generate pyruvic acid, NH3 and allicin. Pyruvic acid has a maximum absorbance at 520 nm, so by detecting the amount of pyruvic acid generated, the catalytic efficiency of methionine γ-lyase within a certain time can be quantitatively calculated, and thus the enzyme activity size is obtained.

[0023] Enzyme activity definition: under the conditions of 40℃ and pH 7.5, the amount of enzyme required to catalyze the production of 1 μmol of pyruvic acid per minute by methionine γ-lyase is 1 enzyme activity unit (U).

[0024] 6. Enzyme activity determination method The enzyme activity of methionine γ-cleavage enzyme was determined in 50 mmol / L PBS buffer (pH 7.5), and the total volume of the reaction system was 100 μL. The detailed operation steps are as follows: 10 μL of substrate buffer (20 mmol / L alliin, 20 mmol / L PLP, 50 mmol / L PBS), 10 μL of methionine γ-cleavage enzyme solution were added to a 96-well enzyme plate, incubated at 40°C for 1 min, immediately added with 10% trichloroacetic acid 10 μL, and the reaction was terminated. Then 20 μL of 0.1% DNPH (2,4-dinitrophenylhydrazine) solution was added, and the reaction was carried out for 5 min, followed by adding 50 μL of 1.5 mol / L NaOH, and the reaction was colored for 1 min. Then, the multifunctional enzyme label was used to detect the reaction absorbance value at 520 nm.

[0025] The application is further explained and described below through specific examples.

[0026] Example 1: Preparation of CqMGL mutant (1) Construction of recombinant plasmid pET-22b(+) cqmgl According to the original CqMGL amino acid sequence (shown in SEQ ID NO. 2), the gene sequence thereof was synthesized and connected to the restriction enzyme cutting site of the E. coli expression vector pET-22b(+) between I and I, to obtain the recombinant plasmid pET-22b(+) Nde , 2 μL of the recombinant plasmid was taken for double enzyme digestion verification (see Xho I and I cqmgl ). Nde Xho (2) Construction of mutant expression vector Figure 1 The amino acid residues V160 and V265 of the original CqMGL interacting with the substrate Alliin were determined as the mutation sites, and the recombinant plasmid pET-22b(+) was taken as the template to perform NNK mutation on the codons corresponding to the amino acids at positions V160 and V265 of the original CqMGL. The mutation primers are as follows:

[0027] Upstream P1: NNKAACCCGACGTTAGAGGTGGTAGATATCGAGGCA; Downstream P2: AGGGCTTTCCAGATACACGGCTTTGGTGTTCT; cqmgl Upstream P3: NNKCGTATGGAGAAGCATTGCAGCAACGC; ​​​Downstream P4: TTCCAGAGTTTTCATACCGCGCAAAATCAGATATGCGTT; PCR amplification: pET-22b(+)- was amplified using the KOD-Plus mutant kit (purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.). cqmgl The target gene was mutated. The total volume of the reaction system was 12.45 μL, and the reaction system is shown in the table below:

[0028] The KOD double mutation employs overlap extension PCR technology, introducing the mutation site through two PCR reactions. The first round of PCR uses two primers (P1 and P2), and the second round of PCR uses the product from the first round as a template, employing two additional primers (P3 and P4).

[0029] The PCR reaction program was as follows: 94℃, 2 min (pre-denaturation); 98℃, 10 s (denaturation); 68℃, 8 min (extension); 8 cycles; 4℃ (storage).

[0030] After the reaction, 2 μL of the PCR product was taken for agarose gel electrophoresis to verify the bands (see [link]). Figure 2 The corresponding target band is approximately 6564 bp, which is the area containing... cqmgl Linear recombinant plasmid of the mutant gene). Add 0.3 μL of [unclear text - possibly a specific ingredient or compound] to the PCR product with the correct band size. Dpn I. The enzyme digestion reaction was carried out at 37℃ for 1 h. After the enzyme digestion reaction was completed, the gene fragment of the digestion product was circularized and ligated. The total volume of the circularization system was 15 μL, and the components are shown in Table 2.

[0031]

[0032] After gently mixing the above cyclization system, it was placed at 16°C for 1 h to react.

[0033] After the reaction was completed, the above reaction products were transformed into Escherichia coli BL21(DE3) competent cells.

[0034] (3) Screening of effective mutants The positive clone single colony was inoculated into a 24-well plate containing 5 mL (containing 100 μg / mL of ampicillin) LB liquid medium, and cultured at 220 r / min and 37°C for 6 h. Then, 0.5 mM IPTG was added to induce protein expression at 16°C and 120 r / min for 20 h. Then, the bacterial cells were collected by centrifugation at 5000 r / min for 10 min. The bacterial cells were resuspended with 200 μL of resuspension solution (50 mM PBS, pH 7.8), and then 30 μL of lysozyme working solution with a concentration of 50 mg / mL was added. The mixture was shaken at 300 r / min and 25°C for 2 h, and then the supernatant containing the enzyme was collected by centrifugation. 10 μL of the supernatant was added to a 96-well plate containing 10 μL of substrate buffer (20 mmol / L alliin, 20 mmol / L PLP, pH 7.5 50 mmol / L PBS), and incubated at 40°C for 1 min. Then, 10% trichloroacetic acid was immediately added to terminate the reaction. 20 μL of DNPH with a concentration of 0.1% was added, and the reaction was performed for 5 min. Then, 50 μL of NaOH with a concentration of 1.5 mol / L was added, and the color was developed for 1 min. Finally, the reaction absorbance was detected at 520 nm using a multifunctional enzyme label instrument. Mutant strains with improved enzyme activity were obtained. Then, plasmid extraction and DNA sequencing were performed on the mutant strains to obtain the mutant expression vector pET-22b(+) cqmgls .

[0035] The results show that the optimal mutant gene screened in the first round of screening encodes an amino acid mutation from V to I at position 160, and the optimal mutant gene screened in the second round of mutation based on the above-mentioned gene encodes an amino acid mutation from V to I at position 265. That is, the final obtained methionine γ-cleavage enzyme mutant is CqMGL V160I / V265I , the amino acid sequence is shown as SEQ ID NO. 3, and the nucleotide sequence is shown as SEQ ID NO. 4.

[0036] (4) Expression and purification of the enzyme The recombinant vectors pET-22b(+) cqmgl , and pET-22b(+) cqmgls were transformed into E. coli BL21 (DE3) cells, respectively, to obtain recombinant strains BL21 (DE3) / pET-22b(+) cqmgl , and BL21 (DE3) / pET-22b(+) cqmgls . Positive transformants were inoculated in LB medium at 37°C and 220 rpm for overnight culture to obtain seed liquid; the seed liquid was inoculated into LB medium at a volume ratio of 2%, and cultured at 37°C until the OD 600The value is 0.6-0.8, then the temperature is decreased to 16℃, IPTG is added to a final concentration of 0.5 mM to induce for 16-18 h, and the fermentation liquor is obtained.

[0037] The above two fermentation liquors are collected by centrifugation at 8000 r / min for 10 min, and the supernatant is discarded. After resuspension with solution A (50 mM sodium phosphate buffer, pH 7.8, 300 mM NaCl), ultrasonic disruption (2 s disruption, 4 s interval, 300 W power) is performed on ice, and finally low-temperature high-speed centrifugation (4℃, 12000 r / min) is performed to remove cell debris to obtain the supernatant.

[0038] The above two supernatants are subjected to nickel affinity chromatography: 1 mL Ni-NTA resin is added to an open column; the resin is equilibrated with 20 mL of solution A, and then the supernatant is combined with 1 mL of resin at 4℃ for 60 min; the mixture is passed through the open column, and the protein-bound resin is retained; then the resin is rinsed with 50 mL of solution B (50 mM sodium phosphate buffer, pH 7.8, 300 mM NaCl, 10 mM imidazole); finally, the target protein is eluted with 9 mL of solution C (50 mM sodium phosphate buffer, pH 7.8, 300 mM NaCl, 200 mM imidazole). The eluted protein is replaced into PBS buffer (pH 7.8) using an ultrafiltration tube to remove imidazole and other metal ions in the eluent, and the obtained protein is stored in a 4℃ refrigerator. The purified enzyme solution is subjected to SDS-PAGE analysis, and the results are shown in Figure 3 and Figure 4 A single band with a size of 43.5 kDa is obtained. The purified enzyme solution is stored in a -80℃ refrigerator after adding 20% glycerol, and is prepared to a working concentration for use.

[0039] Example 2: Determination of enzyme activity The enzyme activity of the original methionine γ-lyase and the methionine γ-lyase mutant CqMGL V160I / V265I is determined by using the methionine γ-lyase enzyme activity determination method, and the results are shown in the following table: Original CqMGL and mutant CqMGL V160I / V265I Specific activity (U / mg) and relative enzyme activity determination results

[0040] The above results show that after the V160I / V265I mutation, the enzyme activity of the methionine γ-lyase mutant CqMGL V160I / V265I is 4.47 times that of the original CqMGL, indicating that the mutant CqMGL V160I / V265IThe catalytic efficiency of CqMGL is obviously improved compared with the original CqMGL.

[0041] Example 3: Determination of the enzymatic reaction kinetics of CqMGL According to the enzyme activity determination method, the absorbance at 520 nm was measured after the reaction under different gradient concentrations of alliin substrate (3, 6, 9, 12, 15, 18, 24, 30, 36 mmol / L). Based on the Origin 2022 software platform, the initial reaction rate was analyzed by non-linear regression using the Michaelis-Menten model, and the enzyme kinetic parameters were obtained V max Compared with K m The concentration of the original CqMGL and its mutants was used to calculate the catalytic constant V max = k cat The catalytic constant k cat .

[0042] The original CqMGL and mutant CqMGL V160I / V265I The catalytic constant k cat The determination results

[0043] The above results show that compared with the original CqMGL, the mutant CqMGL V160I / V265I The value of K m indicates that the affinity of CqMGL V160I / V265I for the substrate is increased, making it more efficient in completing the reaction steps in the catalytic process; the value of V160I / V265I The value of k cat / K m The value of the original CqMGL is 2.52 times that of CqMGL V160I / V265I The catalytic efficiency of CqMGL is obviously improved compared with the original CqMGL.

[0044] Example 4: Color reaction for catalytic synthesis of allicin The reaction system catalyzed by MGL to generate allicin from alliin is difficult to achieve accurate quantitative detection, the main reason is that allicin is inherently extremely unstable. Allicin will rapidly hydrolyze, disulfide and polymerize in the aqueous reaction system, resulting in a continuous dynamic decrease in its concentration during sampling, processing and detection, which cannot accurately capture its initial generation amount. In addition, the complex enzyme reaction matrix may interfere with the subsequent determination accuracy based on the color reaction, so that the detection signal cannot establish a stable and reliable quantitative relationship with the real content of allicin, so the product analysis of this catalytic system is usually limited to qualitative evaluation.

[0045] CqMGL catalyzes the reaction of alliin to generate allicin, and the generated allicin can react with cysteine. Therefore, the determination of allicin can be realized by the color reaction with cysteine. After allicin reacts with excess cysteine to generate colorless S-AMC (C3H5-S-S-CH2CH-(NH)2COOH), the remaining cysteine in the system will react with the DTNB reagent to generate a characteristic yellow product, 2-nitro-5-thiobenzoic acid (NTB). With the increase of allicin content, the cysteine that can participate in the color reaction gradually decreases, resulting in a significant decrease in the yellow color of the system. When allicin completely consumes cysteine, the solution will be colorless or milky white.

[0046] CqMGL V160I / V265I The study on the catalytic synthesis of allicin showed that 100 μL of 10 mM cysteine, 10 μL of CqMGL V160I / V265I enzyme solution and 20 μL of 50 mM alliin were added in a 1.5 mL EP tube, and 50 mM PBS buffer (pH 7.5) was added to make up the system to 1 mL, and the reaction was carried out at room temperature for 10 min to make the allicin catalyzed by the enzyme combined with cysteine; then 50 μL of 0.1 mM DTNB color reagent was added, and the reaction was continued for 10 min in the dark, which was recorded as the experimental group. At the same time, the blank control group was set up, that is, the enzyme solution in the above reaction system was replaced with an equal amount of 50 mM PBS buffer (pH 7.5).

[0047] The results are shown in Figure 5 Compared with the blank control Figure 5 (left), the color of the reaction solution in the experimental group was obviously lighter, indicating that CqMGL V160I / V265I can catalyze the synthesis of allicin from alliin, and the combination of allicin with cysteine can significantly reduce the remaining cysteine in the system, and the color reaction is lighter than the blank group.

[0048] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the patent scope. It should be noted that for ordinary skilled persons in the art, the above embodiments can also be modified, combined and improved without departing from the concept of the present patent, and these all belong to the protection scope of the present patent. Therefore, the protection scope of the present patent should be subject to the claims.

Claims

1. A methionine γ-lyase mutant characterized in that, The amino acid sequence of the mutant is shown as SEQ ID NO.

3.

2. A gene encoding the methionine γ-lyase mutant according to claim 1.

3. The genetic code of claim 2, wherein, The nucleotide sequence of the gene is shown as SEQ ID NO.

4.

4. A recombinant vector or a recombinant strain comprising the gene according to claim 2.

5. The recombinant vector of claim 4, wherein, The expression vector used is pET-22b(+).

6. The recombinant bacterial strain of claim 4, wherein The host cell is Escherichia coli BL21 (ED3).

7. Use of the recombinant vector or the recombinant strain according to claim 4 in the production of the methionine γ-lyase mutant according to claim 1.

8. Use of the methionine γ-lyase mutant according to claim 1.

9. Use according to claim 8, wherein the compound is ###0002### In catalyzing the cleavage reaction of the C-S bond at the γ position of methionine.

10. The use according to claim 8, wherein the compound is ###00002### In catalyzing the synthesis of allicin from alliin.

Images