Use of a kit for detecting SNP molecular markers in identification of mastitis traits in dairy cows
By using a kit to detect SNP molecular markers, superior alleles can be selected and the somatic cell scores of dairy cows can be improved generation by generation. This solves the problems of long breeding cycles and high costs in traditional breeding methods, and achieves efficient genetic improvement and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2025-11-26
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies that use traditional phenotypic selection methods to genetically improve somatic cell scores in dairy cows suffer from problems such as long breeding cycles, high costs, and limited effectiveness, making it difficult to effectively control the occurrence of mastitis.
Develop a kit for detecting SNP molecular markers, and improve the somatic cell scores of offspring cattle by selecting dominant alleles of SNPs, thereby reducing the risk of mastitis and improving the health of breeding cattle.
By selecting optimal SNP molecular markers, increasing the frequency of dominant alleles generation by generation, optimizing somatic cell scoring traits in breeding cattle, accelerating the progress of cattle genetic improvement, and improving the economic benefits of breeding cattle.
Smart Images

Figure CN121204263B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology technology, specifically to the application of a kit for detecting SNP molecular markers in the identification of mastitis traits in dairy cows. Background Technology
[0002] Mastitis is one of the most common and serious diseases in dairy farming. It not only leads to decreased milk production, deterioration of milk quality, and increased treatment costs, but also causes premature culling of dairy cows, resulting in huge economic losses to the global dairy industry. Somatic cell count is an internationally recognized core indicator for assessing the health of the dairy cow's udder and the quality of raw milk. There is a highly significant positive correlation between somatic cell count and mastitis, especially the difficult-to-detect but widespread subclinical mastitis. Therefore, genetically modifying the somatic cell count of dairy cows is a fundamental strategy to control the occurrence of mastitis at its genetic root and improve the overall health of the herd.
[0003] However, somatic cell scores are typical quantitative traits, and their expression is jointly regulated by numerous minor genes, environmental factors, and management conditions. Traditional phenotypic selection methods for genetic improvement of somatic cell scores suffer from long breeding cycles, high costs, and limited effectiveness. With advancements in molecular biology techniques, marker-assisted selection offers a new solution for the genetic improvement of important economic traits in dairy cows. Therefore, it is necessary to develop new marker-based genetic breeding approaches for dairy cows. Summary of the Invention
[0004] To develop a novel approach for marker-based dairy cattle genetic breeding, this invention provides an application of a kit for detecting SNP molecular markers in the identification of mastitis traits in dairy cattle. By selecting the dominant allele of this SNP, this invention can progressively improve the somatic cell scores of offspring, reduce the risk of mastitis in offspring, enhance overall health, and breed superior cattle with the aforementioned traits. This helps accelerate the progress of cattle genetic improvement and effectively improve the economic benefits of cattle breeding.
[0005] This invention provides an application of a kit for detecting SNP molecular markers in the identification of mastitis traits in dairy cows. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. In the sequence of SEQ ID NO.1, N at position 549 represents G or A. The polymorphism of the base at this position affects the bovine somatic cell score. Among them, the somatic cell score of cows with the AA genotype is higher than that of cows with the AG or GG genotypes, and they have a higher risk of mastitis.
[0006] The bovine reference genome version is: International Bovine Reference Genome Version 2.0.
[0007] This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, optimize the somatic cell score trait of breeding cattle, select superior breeding cattle with low somatic cell score traits, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding.
[0008] Furthermore, the kit for detecting SNP molecular markers includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.
[0009] Further, the application involves: extracting genomic DNA from the cattle to be tested; using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3, and using the obtained genomic DNA as template DNA, performing PCR amplification to obtain PCR amplification products; sequencing the PCR amplification products to obtain sequencing results; determining the genotype of the SNP molecular marker based on the sequencing results; culling individuals with the AA genotype and retaining individuals with the AG or GG genotypes according to the SNP sites of the SNP molecular markers; wherein, cattle with the AA genotype have higher somatic cell scores than cattle with the AG or GG genotypes, and have a higher risk of mastitis.
[0010] Furthermore, the PCR amplification system consisted of 10 μL: 1 μL DNA template, 3.4 μL double-distilled water, 5 μL 2×Taq PCR MasterMix with Loading Dye, and 0.3 μL each of upstream and downstream primers.
[0011] Furthermore, the PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle first denaturing at 94℃ for 30 s, then annealing at 64.5℃ for 30 s, and finally extending at 72℃ for 45 s; after 35 cycles, a final extension at 72℃ for 5 min was performed.
[0012] The present invention also provides a primer pair, including the primers shown in SEQ ID NO.2 to SEQ ID NO.3, wherein the primer pair is used to amplify the SNP molecular marker.
[0013] The present invention also provides a detection kit containing the primer pair.
[0014] Furthermore, the test kit also includes 2×Taq PCR Master Mix with Loading Dye and double-distilled water.
[0015] This invention also provides a method for screening cattle breeds with low somatic cell counts, comprising the following steps:
[0016] The SNP molecular markers on bovine chromosome 27 were detected. Based on the SNP loci of the SNP molecular markers, individuals with the AA genotype were culled, while individuals with the AG or GG genotypes were retained. Among them, cattle with the AA genotype had higher somatic cell scores than cattle with the AG or GG genotypes and had a higher risk of mastitis. The bovine reference genome version used was: International Bovine Reference Genome 2.0.
[0017] This invention also provides a method for genetic improvement of cattle, comprising the following steps:
[0018] The SNP molecular marker loci in the core breeding cattle herd were identified, and corresponding selections were made based on the molecular markers: breeding cattle individuals with the AG or GG genotype at locus 26,709,580 on chromosome 27 of the International Bovine Reference Genome 2.0 were selected from the core breeding cattle herd, while breeding cattle individuals with the AA genotype were culled, in order to increase the frequency of the G allele at this locus generation by generation, thereby improving the somatic cell score of offspring cattle and reducing the risk of mastitis in offspring.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0020] This invention, by selecting the dominant allele of the SNP, can increase the frequency of the dominant allele generation by generation, optimize the somatic cell score trait of breeding cattle, select superior breeding cattle with low somatic cell score traits, accelerate the progress of cattle genetic improvement, and thus effectively improve the economic benefits of cattle breeding.
[0021] This invention studies and identifies molecular markers related to bovine somatic cell scoring located on nucleotide sequences on bovine chromosome 27, verifies their effects on somatic cell scoring, and ultimately establishes an efficient and accurate molecular marker-assisted breeding technology. This technology can be applied to the genetic improvement of mastitis traits in breeding cattle, thereby reducing somatic cell scores in offspring, improving milk quality, increasing enterprise economic profits, and enhancing core competitiveness.
[0022] This invention provides a primer pair and kit for detecting the above-mentioned SNP molecular markers. With this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established, enabling rapid and accurate selection of somatic cell scoring traits and accelerating the breeding process. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is a graph showing the genotypic differences at position 549 (5' end) in Chinese Holstein cattle.
[0025] Figure 2 Manhattan plot of genome-wide association analysis (GWAS) on somatic cell scoring traits on chromosome 27 in Chinese Holstein cattle using EMMAX software based on a linear mixture model; where: x-axis represents the chromosome number of the cattle; principal y-axis represents -log 10 P value. Detailed Implementation
[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0027] This invention, based on whole-genome resequencing data from a Chinese Holstein dairy herd, performed GWAS analysis of somatic cell scoring and successfully identified a SNP molecular marker on bovine chromosome 27 that is significantly associated with the somatic cell scoring trait. GTF2E2 The exon region of the gene. The discovery of this marker provides a key tool for breeding new dairy cow breeds with strong mastitis resistance through molecular marker-assisted selection technology, and has significant breeding application value and broad market prospects.
[0028] Example 1: Application of a SNP molecular marker located on bovine chromosome 27 that is associated with somatic cell scoring traits and a reagent for detecting the SNP molecular marker in the identification of mastitis traits in dairy cows.
[0029] I. Experimental subjects, phenotypic determination, and DNA sample collection
[0030] (1) Experimental animals
[0031] The experimental cattle herds used in this invention are Chinese Holstein dairy cows from multiple ranches in Shaanxi, Ningxia, Anhui and Jiangsu provinces.
[0032] This experiment used a herd of 597 Chinese Holstein dairy cows, with detailed herd pedigree records. The herd maintained normal feed and water intake, and all feeding methods and conditions remained consistent throughout the experiment, adhering to standard practices.
[0033] (2) Phenotype
[0034] For the determination of mastitis indicators, milk samples are collected monthly from the farm and sent to the Dairy Herd Improvement Center (DHI) for laboratory analysis. The average of five measurements is then taken to obtain the somatic cell count of the milk. The average somatic cell score (SCC) for the entire lactation period is calculated from the logarithmic average of the monthly somatic cell counts and is defined as: Somatic Cell Score = 3 + log2(SCC / 100,000).
[0035] (0) Bovine tissue sample collection
[0036] To extract DNA, blood samples were collected from 597 Chinese Holstein dairy cows and stored at -80°C for subsequent DNA extraction and sequencing.
[0037] II. Development of SNP Molecular Markers
[0038] (1) Sample DNA extraction
[0039] DNA from collected blood samples was extracted using a Magnetic Universal Genomic DNA kit (purchased from TIANGENBIOTECH (BEIJING) CO.,LTD.). Five 96-well deep-well plates were prepared, each containing 200 μL Buffer NAL + 25 μL proteinase K, 500 μL Wash 1 + 20 μL magnetic beads, 500 μL Wash 2, 500 μL Wash 3, and 80 μL Elution Buffer, respectively. 350 μL of sample was transferred to the deep-well plate containing 200 μL Buffer NAL + 25 μL proteinase K. The Kingfisher (Thermofisher, USA) instrument was started, the corresponding DNA extraction program was selected, and each deep-well plate was placed in its corresponding position on the instrument. The program was run. After lysis was complete, the program was paused, and 400 μL Buffer MBD was added as prompted. The program was then resumed. After the program finished, the DNA solution in the Elution Buffer deep-well plate was transferred to a 1.5 mL centrifuge tube for storage.
[0040] (2) Whole genome resequencing
[0041] The whole-genome resequencing data were all completed by BGI Genomics Co., Ltd. in Shenzhen. The specific methods and steps are as follows:
[0042] ① Library construction: The qualified DNA extracted in step (1) is randomly fragmented and processed into a sequencing library through steps such as DNA fragment end repair, 3' end addition of polyA, sequencing adapter configuration, and PCR amplification.
[0043] ② Sequencing: Resequencing was performed on BGI's DNB SEQ-T7 platform, with an average sequencing depth greater than 10×, yielding raw sequencing data in FASTQ format.
[0044] (3) Resequencing data analysis
[0045] ① Use the Fastp software (v0.23.4) with default parameters to perform quality control on the raw sequencing data obtained in step (2), including filtering out adapter sequences and low-quality reads, to obtain the quality-controlled sequencing data in FASTQ file format;
[0046] ②Use the mem module in the BWA-mem2 software (v2.2.1) with default parameters to align the quality-controlled sequencing data from step ① to the International Bovine Reference Genome 2.0, and obtain the aligned BAM file;
[0047] ③ Use the sort function of Samtools software (v1.17) and the MarkDuplicates function of GATK software (v4.4.0.0) to sort the BAM files after alignment in step ② and remove duplicate sequences;
[0048] ④ SNP calling was performed using the HaplotypeCaller module of GATK software (v4.4.0.0) to accurately identify SNPs and obtain a VCF file containing information on all SNP sites; the VariantFiltration module of GATK software was used to further filter the variants, and finally 23,842,307 SNPs were identified.
[0049] (4) Genome-wide association analysis (GWAS)
[0050] The selected Plink (v1.90) and EMMAX software were used to perform GWAS analysis on the relationship between variant sites and traits using a linear mixed model.
[0051] The SNP locus information results (VCF file) obtained in step (3) were converted into Plink binary format files using Plink software (v1.90), and variants with a variant detection rate of less than 10% and a minor allele frequency (MAF) of less than 5% were filtered out. GWAS analysis was performed on the entire population, using SNP variants. Association analysis was performed using the efficient mixed-model association expedited (EMMAX) software based on a linear mixed model, in which the kinship matrix and population structure were included as random effects for correction. The significance thresholds for all traits were calculated according to the formula. P=0.05 / n Evaluation (where n is the number of independent valid SNPs). 1×10 −6 (Bonferroni correction) serves as a genome-wide significance threshold, annotating regions within 200 kb upstream and downstream of significant sites.
[0052] (6) Association analysis between different genotypes and somatic cell scoring traits
[0053] Table 1. Correlation analysis of SNP sites g.549 G>A of molecular markers with breast inflammation traits.
[0054]
[0055] To identify SNP loci influencing somatic cell scoring, this invention performed a genome-wide association analysis, the results of which are shown below. Figure 2 GWAS analysis revealed a significant associated site, g.549 G>A (the G>A mutation at positions 26,709,580 on chromosome 27 in the International Bovine Reference Genome 2.0 version), located on an exon of the GTF2E2 gene on chromosome 27. Therefore, this site was given special attention. Figure 1 Analysis of Table 1 shows that the SNP site g.549 G>A of the molecular marker is highly significantly correlated with somatic cell scoring traits. P The value <0.001 indicates that this molecular marker significantly affects bovine somatic cell scoring traits. It is hoped that bovine somatic cell scoring traits can be improved during the breeding process through assisted selection of this SNP site.
[0056] Additionally, according to Table 1 and... Figure 1 Furthermore, it was found that the proportion of individuals with the AA and AG genotypes was relatively high in the Chinese Holstein dairy cattle population, while the proportion of individuals with the AA genotype was relatively low. This indicates that for the somatic cell score trait, the AA genotype is a low-frequency genotype in the Chinese Holstein dairy cattle population, meaning that the AA genotype may be associated with high somatic cell scores in some Chinese Holstein dairy cattle populations. This suggests that, for mastitis indicators in the Chinese Holstein dairy cattle population, the AA genotype may be unfavorable for the mastitis trait, a conclusion that corroborates the previous one.
[0057] The above analysis indicates that high somatic cell scores in cattle with the AA genotype are associated with an increased risk of mastitis, or may indicate the presence of existing inflammation. Therefore, during breeding, it is necessary to cull cattle with the AA genotype and retain those with the AG and GG genotypes to progressively increase the frequency of the G allele at this locus. Currently, the GG gene frequency in the Chinese Holstein dairy cattle population is approximately 40.03%, suggesting significant potential for genetic improvement.
[0058] III. Amplification and Sequencing of Target DNA Sequence
[0059] (1) Primer design
[0060] The DNA sequence of SEQ ID NO:1 on bovine chromosome 27 was downloaded from the Ensemble website (https: / / asia.ensembl.org / ). Primers were designed using the primer design software Primer Premier 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:
[0061] P001-F: 5'-GACAGGTAGTGGTTGAGAG-3' (SEQ ID NO. 2);
[0062] P002-R: 5'-CTATACTGACACGCTGATTAC-3' (SEQ ID NO. 3).
[0063] (2) PCR amplification
[0064] PCR amplification: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCRMaster Mix with Loading Dye, and 0.3 μL each of upstream primer P001-F and downstream primer P002-R to a 10 μL reaction system. The PCR reaction conditions are: pre-denaturation at 94℃ for 5 min to allow the DNA double strands to fully unwind; then perform 35 cycles of amplification. In each cycle, denature at 94℃ for 30 s to allow the DNA double strands to unwind into single strands, then anneal at 64.5℃ for 30 s to allow the primers to specifically bind to the template DNA single strands, and finally extend at 72℃ for 45 s to synthesize a new DNA strand under the action of DNA polymerase. After 35 cycles, perform a final extension at 72℃ for 5 min to ensure that the newly synthesized DNA strand is fully extended.
[0065] (3) DNA sequencing
[0066] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the Ensemble genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:
[0067] SEQ ID NO.1:
[0068] GTGCGGTCCGGAGGGACAGGTAGTGGTTGAGAGTCTCCAAGTGAGTCTGAGTTTCAGGTAGCTCAGTACTACGGTAGGTCGGTAGAGTAGAGAGAGACAGGGGAAGGAGGAGCGGGGTTAGGAAGGGTCGTAGTCCTAGAAAAGGTTACTCAGTCGAGAAGCGTACTTCACGGTTTCATAACCTCAAAGTAGAAGTCGTAGTCAGGAAGGTTACTTGGGTCCTACTAGAGGAAGTCTTACCTGACCAACCTAGAGGAACGTCAGATTCCCTGAGAGTTCTCCAGAAGAGGTTGTGGTTGTGTAGCAAGTTTTCGTAGTTAAGAACACTTACAGACAAATTCAAGAAACAGGCAAAATTTGGAACAAATTTAATGTCTTAAAATCTCAAGAAATAAGACCTATGTTTCAGAGAATCTTTTAAATAAGGAAACACTAATAAAAGAAGGTAAGACCACCTAACAGAGAGAGATGATAGAACATAGAAAACACTATGTTTTCAAAAATAAAACTACTTGTATTGTAAAATAAAATAACAGAAAACAAC N(G / A)
[0069] The one marked in SEQ ID NO.1 N Mutation sites are indicated by underlining (the mutated bases are in parentheses, representing allele mutations). The positions of the designed primer sequences are indicated by bolding at the beginning and end of the sequence.
[0070] IV. Analysis of the SNP site g.549 G>A effect of molecular markers
[0071] According to Table 1 and Figure 1 It is known that, for somatic cell scores, cows with the AG and GG genotypes at the SNP site g.549 G>A in the Chinese Holstein dairy herd have lower somatic cell scores (compared to the AA genotype). Lower somatic cell scores in cattle indicate a lower risk of mastitis, and long-term monitoring can steadily improve overall production performance and herd health. This will significantly increase economic benefits in dairy farming and generate wealth for enterprises. By selecting the allele (G) for this SNP in individuals with SNP markers within the Chinese Holstein dairy herd, economic benefits can ultimately be improved, thereby increasing enterprise profits.
[0072] This invention utilizes the detection of the mutation site at position 549 in the sequence of SEQ ID NO.1 to conduct preliminary association analysis between its genotype and the mastitis trait in cattle, providing a new molecular marker for marker-assisted selection in cattle.
[0073] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.
[0074] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of a kit for detecting SNP molecular markers in the preparation of products for identifying bovine mastitis traits, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1. In the sequence of SEQ ID NO.1, N at position 549 represents G or A. The polymorphism of the base at this position affects the bovine somatic cell score. Among them, the somatic cell score of cattle with the AA genotype is higher than that of cattle with the AG or GG genotypes, and they have a higher risk of mastitis. The dairy cows mentioned are Chinese Holstein cattle.
2. The application of the kit for detecting SNP molecular markers according to claim 1 in the preparation of products for identifying bovine mastitis traits, characterized in that, The kit for detecting SNP molecular markers includes the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.
3.
3. The application of the kit for detecting SNP molecular markers according to claim 1 in the preparation of products for identifying bovine mastitis traits, characterized in that, The application includes: extracting genomic DNA from the cattle to be tested; using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3, and using the obtained genomic DNA as template DNA, performing PCR amplification to obtain PCR amplification products; sequencing the PCR amplification products to obtain sequencing results; determining the genotype of the SNP molecular marker based on the sequencing results; culling individuals with the AA genotype and retaining individuals with the AG or GG genotypes according to the SNP sites of the SNP molecular markers; wherein, cattle with the AA genotype have higher somatic cell scores than cattle with the AG or GG genotypes, and have a higher risk of mastitis.
4. The application of the kit for detecting SNP molecular markers according to claim 3 in the preparation of products for identifying bovine mastitis traits, characterized in that, The PCR amplification system consisted of 10 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCRMaster Mix with Loading Dye, and 0.3 μL each of upstream and downstream primers.
5. The application of the kit for detecting SNP molecular markers according to claim 3 in the preparation of products for identifying bovine mastitis traits, characterized in that, The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, 35 cycles, each cycle consisting of denaturation at 94℃ for 30 s, followed by annealing at 64.5℃ for 30 s, and finally extension at 72℃ for 45 s; after 35 cycles, a final extension at 72℃ for 5 min was performed.