A primer and method for identifying citrus fruits with low temperature induced color potential

Abstract

The application discloses a primer and a method for identifying whether citrus fruits have low-temperature color promoting potential. CitHB7 After the specific primer designed for the promoter is used for PCR amplification reaction on the DNA of the citrus plant, whether the fruit has the low-temperature color promoting potential after harvesting is judged according to the target band after amplification. The citrus plant with the 750 bp target band has the low-temperature color promoting potential after harvesting; the citrus plant with the 100 bp target band does not have the low-temperature color promoting potential. The method provided by the application can quickly identify whether the citrus fruit has the low-temperature color promoting potential, and provides guarantee for accurate application of the low-temperature color promoting technology in postharvest treatment of the citrus fruit.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a primer and method for identifying whether citrus fruits have the potential for postharvest low-temperature color enhancement. Background Technology

[0002] Citrus fruits are among the world's most important economic fruit trees, and the appearance and color of the fruit are key indicators for evaluating their commercial value. Carotenoids are the main pigments that constitute the color of citrus peel. In production practice, appropriate low-temperature treatment of citrus fruits after harvest can effectively promote the synthesis and accumulation of carotenoids, thereby significantly improving peel color and enhancing market competitiveness.

[0003] However, postharvest low-temperature color enhancement technology is not effective for all citrus varieties. Currently, determining whether a variety has the potential for low-temperature color enhancement relies entirely on traditional postharvest physiological methods: conducting actual low-temperature treatment experiments after fruit harvesting and observing color changes. This method takes weeks or even months to validate, failing to provide timely information for postharvest treatment decisions and greatly limiting the precise application of low-temperature color enhancement technology.

[0004] In recent years, although some studies have attempted to explore the physiological and molecular mechanisms of low-temperature color enhancement, no key molecular markers have yet been discovered that can be directly and effectively used to identify the ability of citrus varieties to promote color enhancement through low temperatures after harvest. Therefore, there is an urgent need in this field for a technical solution that can quickly and accurately identify whether a variety has the potential for low-temperature color enhancement before or during fruit harvest, in order to overcome the drawbacks of existing technologies that rely on post-harvest physical verification and to achieve on-demand and efficient application of post-harvest treatment technologies. Summary of the Invention

[0005] To address the aforementioned technical problems, the main objective of this invention is to provide primers and a method for identifying whether citrus fruits possess the potential for postharvest low-temperature color enhancement, thereby providing a rapid, accurate, and convenient tool for identifying whether citrus fruits possess this potential and offering an efficient auxiliary tool for postharvest quality management of citrus fruits.

[0006] To achieve the objectives of this invention, the following technical solutions are provided:

[0007] In a first aspect, a primer for identifying whether citrus fruits have the potential for postharvest low-temperature color enhancement, said primer being a primer combination containing nucleotide sequence 1F and sequence 1R, said nucleotide sequence 1F being as shown in SEQ ID.1 and said nucleotide sequence 1R being as shown in SEQ ID.2.

[0008] Secondly, the present invention also provides a detection reagent, kit, or chip containing the above-mentioned primers.

[0009] Furthermore, the detection reagents, kits, or chips may also include other reagents for PCR amplification.

[0010] Thirdly, the detection reagents, kits, or chips described in this invention can be used to identify whether citrus fruits have the potential for low-temperature color enhancement.

[0011] Fourthly, the present invention also provides a method for identifying whether citrus fruits possess the potential for postharvest low-temperature color enhancement, comprising the following steps:

[0012] Step 1: Extract genomic DNA from the citrus plants to be tested.

[0013] Step 2: Using the genomic DNA extracted in Step 1 as a template, perform PCR amplification using primers. The primers are a combination of primers containing nucleotide sequence 1F and sequence 1R. The nucleotide sequence 1F is shown in SEQ ID.1, and the nucleotide sequence 1R is shown in SEQ ID.2.

[0014] Step 3: Genuinely genotype the PCR amplification products obtained in Step 2, and perform band analysis on the genotyping results:

[0015] If a product of 750 bp is obtained by amplification, the citrus variety is deemed to have the potential for postharvest low-temperature color enhancement, and the low-temperature color enhancement technology can be used to improve the peel color. If a product of 100 bp is obtained by amplification, the citrus variety is deemed not to have the potential for low-temperature color enhancement, and it is not recommended to use the low-temperature color enhancement technology to improve the peel color.

[0016] Furthermore, the PCR amplification reaction system in step 2 contains 10 μL of 2 × Taq Master Mix, 0.5 μL of nucleotide sequence 1F, 0.5 μL of nucleotide sequence 1R, 1.0 μL of genomic DNA from the citrus plant to be tested, and 8 μL of ddH. The concentrations of nucleotide sequence 1F and nucleotide sequence 1R are both 10 μmol / L.

[0017] Furthermore, the PCR amplification reaction conditions are as follows: initial pre-denaturation at 95 °C for 5 min; followed by 34 cycles, each cycle including denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 sec and extension at 72 °C for 30 sec; final extension at 72 °C for 5 min after the cycle; and finally storage at 4 °C.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] The primers and identification methods provided by this invention can quickly and accurately help identify whether the fruits of citrus plants have the potential for postharvest low-temperature color enhancement, thus ensuring the accurate application of low-temperature color enhancement technology in citrus fruits. Attached Figure Description

[0020] The disclosure of this invention will become more readily understood with reference to the accompanying drawings. It will be readily understood by those skilled in the art that these drawings are merely illustrative of the technical solutions of this invention and are not intended to limit the scope of protection of this invention.

[0021] Figure 1 A gel image showing the results of PCR amplification of DNA from 58 citrus varieties.

[0022] Figure 2 The images show the effects of low-temperature treatment on some of the citrus varieties selected for this invention. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments in this application without inventive effort are within the scope of protection of this application.

[0024] The primers and usage methods provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0025] I. Fifty-eight citrus varieties were selected for comparative experiments, as shown in Table 1.

[0026] Table 1. 58 Citrus Varieties Selected

[0027]

[0028] II. Plant sample collection.

[0029] For each of the 58 selected citrus varieties, 2-3 healthy young leaves (approximately 0.5 g) were collected from the selected varieties, placed in a labeled sealed bag, and immediately flash-frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80 ℃ for long-term storage.

[0030] III. DNA Extraction from Sample Plants

[0031] Genomic DNA was extracted from the control sample plants using the CTAB method, as follows.

[0032] Grind the DNA in a centrifuge tube containing the blades using steel balls until finely ground. Add 600 μL of CTAB extraction buffer, shake well to suspend the DNA, and incubate at 65°C for 60 min, gently inverting the tube several times every 20 min. After the water bath, add 400 μL of a chloroform:isoamyl alcohol (24:1) mixture and agitate for 8-10 min. Centrifuge at 10000-12000 rpm at 4°C for 5-10 min. Transfer the supernatant to another centrifuge tube, add an equal volume of -20°C pre-chilled isopropanol, and mix gently. Refrigerate at -20°C for at least 30 min to precipitate the DNA. Centrifuge at 8000-10000 rpm at 4°C for 5-10 min. Discard the supernatant, add 1 ml of pre-cooled 70% ethanol and soak for 10-15 min, centrifuge at 8000 rpm for 5 min at 4 ℃, discard the ethanol and air dry the DNA on the workbench, then dissolve in 50 μl of ddH2O.

[0033] IV. PCR Amplification

[0034] Using the genomic DNA extracted in step three as a template, PCR amplification was performed using primers designed in this invention for identifying whether citrus fruits possess the potential for low-temperature color enhancement, yielding PCR products. The primers are primer combinations containing nucleotide sequences 1F and 1R, where nucleotide sequence 1F is shown in SEQ ID.1 and nucleotide sequence 1R is shown in SEQ ID.2.

[0035] Nucleotide sequence 1F: AAGTCAGGCTCAGTGGCTTT (Sequence 1F, SEQ ID NO.1).

[0036] Nucleotide sequence 1R: GACGGTAAATCACAGATTCACAG (Sequence 1R, SEQ ID NO.2).

[0037] The PCR amplification system consisted of 20 μL, containing 10 μL of 2 × Taq Master Mix, 0.5 μL of upstream primer nucleotide sequence 1F (10 μmol / L), 0.5 μL of downstream primer nucleotide sequence 1R (10 μmol / L), 1.0 μL of template DNA extracted by CTAB method, and 8 μL of ddH2O.

[0038] The PCR amplification program was as follows: initial pre-denaturation at 95 °C for 5 min; followed by 34 cycles, each cycle consisting of denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 sec, and extension at 72 °C for 30 sec; final extension at 72 °C for 5 min after each cycle; and finally storage at 4 °C.

[0039] V. Detection of PCR products by agarose gel electrophoresis

[0040] After the PCR reaction, take 7 μL of the PCR product and electrophoresis it on a 1.5%–2% agarose gel at a constant voltage of 120 V for 15–20 min. Finally, observe the results using a gel imaging system.

[0041] The gel image showing the PCR amplification results of DNA from 58 citrus varieties in the example is shown below. Figure 1 As shown.

[0042] VI. Result Determination

[0043] The results were determined by observing the size of the amplified bands using a gel imaging system: if a product of 750 bp was obtained, the citrus variety was deemed to have the potential for postharvest low-temperature color enhancement, and the peel color could be improved using this technology; if a product of 100 bp was obtained, the citrus variety was deemed not to have the potential for low-temperature color enhancement, and the peel color was not recommended to be improved using this technology.

[0044] Based on the judgment results, combined with Figure 1 The results show that: for the selected citrus varieties 1-18, which are more sensitive to low-temperature treatment and have the potential for low-temperature color enhancement, the primers designed in this invention can amplify a band of 750 bp; for the selected citrus varieties 19-58, which are not sensitive to postharvest low-temperature treatment and do not have the potential for low-temperature color enhancement, the primers designed in this invention can amplify a band of 100 bp.

[0045] A selection of citrus varieties were subjected to low-temperature color-enhancing treatment. Specifically, the varieties were No. 11-Newhall Navel Orange, No. 13-Gannan Early Navel Orange, No. 17-Lunwan Navel Orange, and No. 22-Eucalyptus Lemon. The treatment effects were as follows: Figure 2 As shown.

[0046] The experimental results show that the primers designed in this invention can be used to identify whether citrus fruits have the potential for low-temperature color enhancement.

[0047] The above description, in conjunction with specific / preferred embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various substitutions or modifications can be made to these described embodiments without departing from the inventive concept, and all such substitutions or modifications should be considered within the scope of protection of the present invention.

Claims

1. A primer for identifying whether citrus fruits possess the potential for postharvest low-temperature color enhancement, characterized in that, The primers are primer combinations containing nucleotide sequences 1F and 1R, wherein nucleotide sequence 1F is shown in SEQ ID.1 and nucleotide sequence 1R is shown in SEQ ID.

2.

2. Detection reagents, kits, or chips containing the primers described in claim 1.

3. The application of the detection reagent, kit, or chip according to claim 2 in identifying whether citrus fruits have the potential for postharvest low-temperature color enhancement.

4. A method for identifying whether citrus fruits possess the potential for postharvest low-temperature color enhancement, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from the citrus plants to be tested; Step 2: Using the genomic DNA extracted in Step 1 as a template, perform PCR amplification using primers, wherein the primers are those described in claim 1; Step 3: Genuinely genotype the PCR amplification products obtained in Step 2, and perform band analysis on the genotyping results: If a product of 750 bp is obtained by amplification, the citrus variety is deemed to have the potential for postharvest low-temperature color enhancement, and the peel color can be improved by using postharvest temperature treatment. If a product of 100 bp is obtained by amplification, the citrus variety is deemed not to have the potential for low-temperature color enhancement, and it is not recommended to use low-temperature color enhancement technology to improve the peel color.

5. The method for identifying whether citrus fruits possess the potential for low-temperature color enhancement according to claim 4, characterized in that, The PCR amplification reaction system in step 2 contains 10 μL of 2 × Taq Master Mix, 0.5 μL of nucleotide sequence 1F, 0.5 μL of nucleotide sequence 1R, 1.0 μL of genomic DNA from the citrus plant to be tested, and 8 μL of ddH2O. The concentration of nucleotide sequence 1F and nucleotide sequence 1R is 10 μmol / L.

6. The method for identifying whether citrus fruits possess the potential for low-temperature color enhancement according to claim 5, characterized in that, The PCR amplification reaction conditions were as follows: initial pre-denaturation at 95 °C for 5 min; followed by 34 cycles, each cycle consisting of denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 sec, and extension at 72 °C for 30 sec; final extension at 72 °C for 5 min after the cycle; and finally storage at 4 °C.

Images