A tilapia ferroprotein, a preparation method and application thereof, and a bacteriostatic agent
By preparing recombinant Nile tilapia ferritin heavy chain protein and applying it to antibacterial agents, the problem of inhibiting the proliferation of pathogens in existing technologies has been solved, achieving effective inhibition of pathogens in aquaculture and host immune protection.
Patent Information
- Application Number
- CN202511351088.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-22
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2045-09-22
AI Technical Summary
Existing technologies are insufficient to effectively utilize ferritin heavy chain recombinant proteins to inhibit the proliferation of pathogens in aquaculture, and there is a lack of in-depth understanding of the role of iron homeostasis in host antimicrobial infection.
Recombinant Nile tilapia ferritin heavy chain protein was prepared by prokaryotic expression and Ni2+-NTA column affinity chromatography and applied to an antibacterial agent to inhibit the proliferation of Streptococcus agalactiae and Aeromonas hydrophila.
In vitro experiments showed that the recombinant protein could effectively inhibit the proliferation of pathogens, and in vivo experiments showed that it improved the survival rate of the host, proving its important role in host immune protection.
Smart Images

Figure CN121226527B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of aquaculture technology, and in particular to a Nile tilapia ferritin, its preparation method and application, and an antibacterial agent. Background Technology
[0002] Ferritin, an iron storage protein widely distributed in organisms, is highly conserved across different species. The ferritin heavy chain is primarily responsible for retaining free iron in the body. 2+ Furthermore, its oxidation gives it biological functions such as defending against pathogenic infections, regulating inflammatory responses, and regulating iron homeostasis. It also regulates iron metabolism in terms of release and storage, playing an important role in the host's innate immune defense. Therefore, the successful preparation of recombinant ferritin heavy chain protein is a prerequisite for conducting research on its biological functions. Summary of the Invention
[0003] To address the aforementioned problems, this invention provides Nile tilapia ferritin, its preparation method and applications, and an antibacterial agent. This invention utilizes prokaryotic expression and Ni... 2+ -NTA column affinity chromatography and other methods were used to successfully develop Nile tilapia ferritin and to demonstrate that the recombinant Nile tilapia ferritin heavy chain (OnFth) protein (Nile tilapia ferritin) can effectively inhibit the proliferation of pathogens and play an important role in the host's defense against pathogen infection. This provides a solid foundation for a deeper understanding of the key role of iron homeostasis in the antibacterial infection of bony fish.
[0004] To achieve the above objectives, the present invention provides the following technical solution:
[0005] The present invention provides a Nile tilapia ferritin, the amino acid sequence of which is shown in SEQ ID No. 1.
[0006] This invention also provides a method for preparing the Nile tilapia ferritin described in the above technical solution, comprising the following steps:
[0007] 1) Extract RNA from Nile tilapia and reverse transcribe it into cDNA;
[0008] 2) Using the cDNA obtained in step 1) as a template, PCR amplification was performed using OnFth-F primers and OnFth-R primers to obtain the amplification product; the nucleotide sequence of the OnFth-F primer is shown in SEQ ID No. 2, and the nucleotide sequence of the OnFth-R primer is shown in SEQ ID No. 3;
[0009] 3) The amplification product described in step 2) is ligated into the pMD-18T vector to obtain pMD-18T-EOnFth;
[0010] 4) The pMD-18T-EOnFth and pET-32a vectors obtained in step 3) are digested with enzymes and then ligated to obtain pET-32a-OnFth. The pET-32a-OnFth is then transformed into Escherichia coli to obtain the transformed bacteria.
[0011] 5) The transformant bacteria described in step 4) were induced with isopropyl-β-D-thiogalactoside, and then subjected to Ni 2+ -NTA column affinity purification yielded Nile tilapia ferritin.
[0012] Preferably, the PCR amplification system in step 2) includes: 12.5 μL of LA-Taq DNA Polymerase, 2.5 μL of cDNA, 1 μL of 0.5 μM OnFth-F primer, 1 μL of 0.5 μM OnFth-R primer, and 8 μL of RNase-free ddH2O;
[0013] The conditions included: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 40 s, 35 cycles; 72℃ for 10 min.
[0014] Preferably, the conditions for ligating the amplification product into the pMD-18T vector in step 3) include: 2 μL of amplification product, 0.5 μL of pMD-18T vector, and 2.5 μL of Solution I, ligated overnight at 4°C.
[0015] Preferably, the enzymes used in step 4) include BamHI and HindIII; the digestion conditions include: 20 μL of pMD-18T-EOnFth vector or pET-32a vector, 7 μL of 10× Green Buffer, 1.5 μL of restriction endonuclease BamHI and 1.5 μL of restriction endonuclease HindIII, reacted at 37°C for 6 h;
[0016] The ligation conditions included: 6 μL of pMD-18T-OnFth fragment, 4 μL of pET-32A fragment, and 5 μL of Solution I, ligated overnight at 4°C.
[0017] Preferably, the concentration of isopropyl-β-D-thiogalactoside induced in step 5) is 1 mol / L, and the conditions are: induction at 37°C and 180 rpm for 6 h.
[0018] The present invention also provides the application of the Nile tilapia ferritin described in the above technical solution in the preparation of products that inhibit Streptococcus agalactiae.
[0019] The present invention also provides the application of the Nile tilapia ferritin described in the above technical solution in the preparation of products that inhibit Aeromonas hydrophila.
[0020] The present invention also provides an antibacterial agent containing the Nile tilapia ferritin described in the above technical solution;
[0021] The antibacterial agent inhibits Streptococcus agalactiae and / or Aeromonas hydrophila.
[0022] Preferably, the concentration of Nile tilapia ferritin in the antibacterial agent is 10 μg / g.
[0023] Beneficial effects of this invention:
[0024] This invention provides Nile tilapia ferritin, and in vitro experiments have confirmed that this recombinant protein can effectively inhibit the proliferation of pathogens. Further in vivo experimental results show that ferritin heavy chain (Nile tilapia ferritin) has important functions in inhibiting pathogen proliferation and improving the survival rate of the organism, playing a crucial role in immune protection. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0026] Figure 1 The results of SDS-PAGE analysis of (r)OnFth protein induction, expression, and purification.
[0027] Figure 2 To analyze the antibacterial function of tilapia ferritin OnFth using ultraviolet spectrophotometry;
[0028] Figure 3 To analyze the antibacterial function of tilapia ferritin OnFth using the Oxford cup method;
[0029] Figure 4 The effect of (r)OnFth on the survival rate of tilapia after infection with Streptococcus agalactiae;
[0030] Figure 5 To analyze the antibacterial function of tilapia ferritin OnFth in histopathological studies;
[0031] Figure 6 The expression levels of OnFth in the head kidney, spleen, liver, and intestine of tilapia after infection with Streptococcus agalactiae;
[0032] Figure 7 This is the technical route of the technical solution of the present invention. Detailed Implementation
[0033] This invention provides a Nile tilapia ferritin, the amino acid sequence of which is shown in SEQ ID No. 1, and is as follows:
[0034] MSSQVRQNFHQDCEAAVNRQINLELYASYVYLSMSYYFDDRDDQALHNFAKFFHHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDRDEWGSGVEALECALQLEKSVNQSLLDLHKLCSEHNDPHMCDFIETHYLDEQVKSIKELADWVTNLRRMGAPQNGMAEYLFDKHTLGKESS.
[0035] The main inventive point of this invention lies in the use of restriction endonucleases BamHI and HindIII to maintain the complete amino acid sequence of ferritin heavy chain. During the double digestion process, it is crucial to ensure that the target gene does not contain the cleavage sites of the selected enzymes; otherwise, the target gene will be damaged (this process can be verified through gene sequence alignment). Simultaneously, 6-base recognition sequences (such as EcoRI and BamHI) are preferentially selected due to their low frequency in the genome and higher specificity. Combining these two requirements, this study selected BamHI and HindIII for digestion. This ensures both amino acid integrity and improves the specificity of each digestion. The results show that the double digestion is effective, yielding the target protein with high content and a single band.
[0036] This invention also provides a method for preparing the Nile tilapia ferritin described in the above technical solution, comprising the following steps:
[0037] 1) Extract RNA from Nile tilapia and reverse transcribe it into cDNA;
[0038] 2) Using the cDNA obtained in step 1) as a template, PCR amplification was performed using OnFth-F primers and OnFth-R primers to obtain the amplification product; the nucleotide sequence of the OnFth-F primer is shown in SEQ ID No. 2, and the nucleotide sequence of the OnFth-R primer is shown in SEQ ID No. 3;
[0039] 3) The amplification product described in step 2) is ligated into the pMD-18T vector to obtain pMD-18T-EOnFth;
[0040] 4) The pMD-18T-EOnFth and pET-32a vectors obtained in step 3) are digested with enzymes and then ligated to obtain pET-32a-OnFth. The pET-32a-OnFth is then transformed into Escherichia coli to obtain the transformed bacteria.
[0041] 5) The transformant bacteria described in step 4) were induced with isopropyl-β-D-thiogalactoside, and then subjected to Ni 2+-NTA column affinity purification yielded Nile tilapia ferritin.
[0042] This invention extracts RNA from Nile tilapia and reverse transcribes it into cDNA. The method for extracting Nile tilapia RNA and then reverse transcribing it into cDNA is not particularly limited; those skilled in the art can use conventional methods.
[0043] This invention uses the cDNA as a template and performs PCR amplification using OnFth-F primers and OnFth-R primers to obtain amplification products. The nucleotide sequence of the OnFth-F primer is shown in SEQ ID No. 2, and the nucleotide sequence of the OnFth-R primer is shown in SEQ ID No. 3. In this invention, the preferred PCR amplification system includes: 12.5 μL of LA-Taq DNA Polymerase, 2.5 μL of cDNA, 1 μL of 0.5 μM OnFth-F primer, 1 μL of 0.5 μM OnFth-R primer, and 8 μL of RNase-free ddH2O; the preferred conditions include: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 40 s, 35 cycles; 72℃ for 10 min.
[0044] SEQ ID No.2: AGCACGCTGAGAAGCTAATGAAAC;
[0045] SEQ ID No. 3: TGCCCCACTCGTCCCTGT.
[0046] In this invention, the amplification product is ligated into the pMD-18T vector to obtain pMD-18T-EOnFth. In this invention, the preferred conditions for ligating the amplification product into the pMD-18T vector include: 2 μL of amplification product, 0.5 μL of pMD-18T vector, and 2.5 μL of Solution I, ligated overnight at 4°C.
[0047] In this invention, the pMD-18T-EOnFth and pET-32a vectors are digested with enzymes and then ligated to obtain pET-32a-OnFth. The pET-32a-OnFth is then transformed into *E. coli* to obtain transformed bacteria. In this invention, the enzymes used for digestion preferably include BamHI and HindIII; the digestion conditions preferably include: 20 μL of pMD-18T-EOnFth or pET-32a vector, 7 μL of 10× Green Buffer, 1.5 μL of restriction endonuclease BamHI, and 1.5 μL of restriction endonuclease HindIII, reacted at 37°C for 6 h; the ligation conditions preferably include: 6 μL of pMD-18T-OnFth fragment, 4 μL of pET-32A fragment, and 5 μL of Solution I, ligated overnight at 4°C. The present invention does not specifically limit the method of converting pET-32a-OnFth into Escherichia coli; those skilled in the art can use conventional methods.
[0048] This invention involves inducing the transformed bacteria with isopropyl-β-D-thiogalactoside, followed by Ni... 2+ -NTA column affinity purification yielded Nile tilapia ferritin. In this invention, the concentration of isopropyl-β-D-thiogalactoside for induction is preferably 1 mol / L, and the conditions are: induction at 37°C and 180 rpm for 6 h. This invention provides Ni 2+ There are no special limitations on the conditions for affinity purification using NTA columns; those skilled in the art can use standard methods.
[0049] The present invention also provides the application of the Nile tilapia ferritin described in the above technical solution in the preparation of products that inhibit Streptococcus agalactiae.
[0050] The present invention also provides the application of the Nile tilapia ferritin described in the above technical solution in the preparation of products that inhibit Aeromonas hydrophila.
[0051] This invention also provides an antibacterial agent containing Nile tilapia ferritin as described in the above-described technical solution. In this invention, the antibacterial agent preferably inhibits *Streptococcus agalactiae* and *Aeromonas hydrophila*. In this invention, the concentration of Nile tilapia ferritin in the antibacterial agent is preferably 10 μg / g.
[0052] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0053] Example 1
[0054] Expression and purification of tilapia ferritin heavy chain recombinant protein
[0055] (1) Extraction of total RNA from tissues
[0056] This embodiment uses the Trizol lysis method for total RNA extraction. The specific steps are as follows:
[0057] 1) Place the tilapia liver sample, which is frozen at -80°C, on ice. Add 200 μL of Trizol. Homogenize on ice using a homogenizer, and after thorough grinding, add Trizol to a final volume of 1 mL. Incubate on ice for 10 min.
[0058] 2) Discard the precipitate and transfer the supernatant to a pre-sterilized RNase-free centrifuge tube. Add 350 μL of pre-chilled chloroform and vortex thoroughly. Place the centrifuge tube on ice for 10 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4°C.
[0059] 3) Use a pipette to aspirate the upper aqueous phase, strictly controlling the pipetting angle during the operation to avoid aspirating the middle or lower layer of liquid, in order to ensure the purity of nucleic acid. Transfer to a 1.5 mL RNase-free centrifuge tube containing 600 μL isopropanol, invert to mix well, and incubate on ice for 10 min at low temperature.
[0060] 4) Centrifuge at 12,000 rpm and 4°C for 15 min, slowly discard the supernatant, and slowly add 1 mL of pre-cooled 75% ethanol solution to the centrifuge tube along the wall. Gently invert the tube to ensure the RNA precipitate is thoroughly washed. Centrifuge at 12,000 rpm and 4°C for 5 min, discard the ethanol solution, and repeat this step 3 times.
[0061] 5) After the final centrifugation, remove the supernatant, place the centrifuge tube on sterile filter paper, and let it stand at room temperature for 5 minutes to evaporate any residual organic solvent. Add an appropriate amount of DEPC-treated Water to dissolve the RNA precipitate, obtaining a colorless and transparent solution.
[0062] 6) RNA purity was assessed using a Nano Drop 2000 ultra-micro spectrophotometer. RNA concentration was recorded, and the samples were transferred to an ultra-low temperature freezer at -80°C for long-term storage.
[0063] (2) cDNA synthesis
[0064] This example demonstrates cDNA synthesis following the instructions of the Hifair III reverse transcription kit (Yisheng Biotechnology, China). The template RNA was mixed with 5×gDNA digester buffer, gDNA digester, and RNase-free H2O and incubated at 42°C for 2 min to remove residual genomic DNA. After incubation, 10 μL of cDNA was added to each tube. After mixing with the II Super Mixplus, incubate at 25°C for 5 minutes, then at 42°C for 30 minutes, and finally at 85°C for 5 minutes. Store the obtained cDNA sample at -20°C for later use.
[0065] (3) Cloning of the open reading frame sequence of tilapia ferritin heavy chain
[0066] The predicted full-length sequence (XM_003445695.4) of Nile tilapia ferritin heavy chain (OnFth) mRNA was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Open reading frame (ORF) amplification primers were designed using PrimerPremier 5.0 software and named OnFth-F and OnFth-R, respectively. These primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd. PCR amplification was performed using cDNA from the liver of healthy tilapia obtained in (2) as a template. The PCR amplification system and procedure are as follows:
[0067] Table 1 System and Procedures
[0068]
[0069] The state and size of PCR products were detected using 1% agarose gel electrophoresis, and PCR products matching the target band size were excised and recovered. The recovered products were ligated into the pMD18-T vector and transformed into Top10 competent cells. Single-clone colony screening and colony PCR identification were performed. The bacterial cultures that identified positive clones by PCR were sequenced, and the bacterial cultures with correct sequencing results were used for subsequent expression vector construction.
[0070] OnFth-F (SEQ ID No. 2): AGCACGCTGAGAAGCTAATGAAAC;
[0071] OnFth-R (SEQ ID No. 3): TGCCCCACTCGTCCCTGT.
[0072] (4) Construction of prokaryotic expression vectors
[0073] Plasmids were extracted from pMD-18T-EOnFth (obtained in step 3) and pET-32a bacterial culture (Sangon Biotech (Shanghai) Co., Ltd., China) using a rapid plasmid miniprep kit (Tiangen Biotech, China). pMD-18T-EOnFth and pET-32a were double-digested with restriction endonucleases BamHI and HindIII in a 37°C water bath for 6 hours. The target gene fragment was recovered and ligated to construct the pET-32a-OnFth expression vector. pET-32a-OnFth was transformed into BL21 competent cells, and single colonies were detected by bacterial culture PCR. Bacterial cultures with positive PCR results were sequenced. Cultures with correct sequencing results were treated with a solution containing 15% glycerol and Amp... + Store in LB medium at 1 mg / mL at -80°C for later use.
[0074] (5) Induced expression of tilapia ferritin heavy chain recombinant protein (r) OnFth
[0075] Take 2 mL of correctly sequenced bacterial culture and inoculate it into 200 mL of Amp. + The cells were cultured in LB liquid medium at 37°C with shaking at 180 rpm until the absorbance at OD600 nm reached 0.6. IPTG was added to a final concentration of 1 mM, and the cells were induced at 37°C with shaking at 180 rpm for 6 h. After induction, the cells were centrifuged at 4°C with shaking at 8000 rpm for 10 min, and the precipitate was collected. The cells were resuspended in 20 mL of 10 mM sterile PBS, mixed well, and 200 μL of lysozyme (1 mg / mL) was added. The cells were incubated at room temperature for 1 h, continuously inverting to mix. The bacterial culture was then sonicated at low temperature for 2 h until the culture became clear. The cells were centrifuged at 4°C with shaking at 8000 rpm for 15 min, and the precipitate and supernatant were collected separately. The precipitate was resuspended in 6 mL of 1× binding buffer containing 8 M urea and dissolved overnight at 4°C. The expression of the recombinant protein in the form of inclusion bodies was detected by SDS-PAGE gel electrophoresis.
[0076] (6)Ni 2+ -NTA column affinity purification
[0077] 1) Gently shake the packing bottle to mix the medium, then fill the gravity column with 2 mL of Ni-NTAHis-BindAgarose Resin solution. Allow the packing to settle naturally under gravity. After the storage buffer has completely flowed out, rinse the packing twice with 5 mL of deionized water.
[0078] 2) Inject 5 mL of 1× ion buffer into the gravity purification column to ensure that nickel ions bind to the packing material.
[0079] 3) Add 5 mL of 1× denaturing binding buffer containing urea to the gravity column to equilibrate the nickel column.
[0080] 4) Based on the SDS-PAGE results, the target protein (r)OnFth was mainly expressed in the inclusion bodies of the bacterial precipitate. 3 mL of the protein precipitate solution successfully induced in step (5) was injected into the gravity purification column, and the column chromatography solution was collected and repeated three times.
[0081] 5) Sequentially inject 5 mL of 20, 40, 60, 100 and 250 mM imidazole elution buffer containing urea into the gravity column for gradient elution, collect the eluent, and repeat the column pass twice.
[0082] 6) After the protein elution is complete, inject a total volume of 5 mL of stripping solution into the nickel column in several portions, collect the stripping solution, and repeat the column elution twice to strip the target protein.
[0083] 7) After protein stripping, inject a total of 20 mL of deionized water into the nickel column in several portions for cleaning. After cleaning, inject 5 mL of deionized water to seal the column and store it in a 4°C refrigerator for later use.
[0084] 8) Take 60 μL of the above column buffer and add 20 μL of 4× Loading buffer. Denature in a boiling water bath for 10 min. Use 12% SDS-PAGE gel electrophoresis to detect the protein purification effect and take pictures for recording.
[0085] 9) Dialysis. Based on the gel analysis results after Cochlear staining, select the eluent with a single and distinct target protein band for dialysis to remove excess imidazole and inorganic salts. Transfer the protein solution to an MD44 dialysis bag, place the dialysis bag in a beaker containing 2 L of 1×PBS dialysis buffer, and incubate at 4°C with a magnetic stirrer at low speed. Change the dialysis buffer every 2 hours, for a total of 4 times.
[0086] 10) Concentration. Remove the dialysis bag and place it in an open box. Sprinkle PEG 20000 evenly onto the surface of the dialysis bag in small, repeated applications to concentrate the protein solution. The concentration process is also carried out at 4°C. When the volume of the remaining solution in the dialysis bag drops to 1-2 mL, use a pipette to transfer the protein solution to a sterile 2 mL centrifuge tube. Measure the concentrated protein concentration using a NanoDrop 2000 ultraviolet spectrophotometer. Aliquot the protein according to the required volume for subsequent experiments and store temporarily at -20°C. Store the remaining protein at -80°C, avoiding repeated freeze-thaw cycles.
[0087] Example 2
[0088] In vitro antibacterial function of Nile tilapia ferritin
[0089] (1) Analysis of the antibacterial function of OnFth by ultraviolet spectrophotometry
[0090] Prepare Brain Heart-Heart Extract (BHI) and LB broth media. Remove the preserved *S. agalactiae* and *A. hydrophila* strains from the -80°C cryopreservation freezer and thaw them on ice. In a clean bench, transfer 1 mL of BHI media into a 1.5 mL sterile centrifuge tube, and then inoculate 10 μL of *S. agalactiae* into the centrifuge tube at a 1:100 inoculation ratio. Incubate at 37°C and 180 rpm on a shaker until the absorbance at OD600 nm reaches 0.6. Immediately return the original strains to the -80°C freezer for storage. Perform the same procedure as above, inoculating and culturing *Aeromonas hydrophila* on LB broth.
[0091] Take a 50 mL sterile centrifuge tube and add 30 mL of BHI medium to a laminar flow hood. Transfer the activated *S. agalactiae* bacterial suspension into the tube. Incubate at 37°C and 180 rpm in a shaker until the absorbance at OD600 nm reaches 0.6. Take 1 mL of the bacterial suspension from the centrifuge tube and centrifuge at 5000 rpm for 10 min. Place the tube in a laminar flow hood, discard the supernatant, resuspend the bacterial suspension in sterile 1×PBS, and serially dilute it 10⁻¹⁰ times. 4 10 5 10 6 10 7 Spread 100 μL of the diluted bacterial solution onto BHI solid medium, with three plates for each concentration as parallels. Seal the petri dishes with sealing film, invert them in a constant temperature incubator, and incubate at 37°C for 12 h. Count the number of single colonies to determine the bacterial concentration.
[0092] The expansion and counting methods for *Aeromonas hydrophila* were the same as above, using LB medium for expansion and determination of bacterial concentration. After obtaining the concentrations of each bacterial culture, it was diluted with BHI liquid medium or LB liquid medium to achieve a final concentration of 1 × 10⁻⁶. 7 CFU / mL.
[0093] This experiment consisted of eight groups: *Streptococcus agalactiae* / *Aeromonas hydrophila* group, *Streptococcus agalactiae* / *Aeromonas hydrophila* + BSA group, *Streptococcus agalactiae* / *Aeromonas hydrophila* + (r)OnFth group, and *Streptococcus agalactiae* / *Aeromonas hydrophila* + antibiotic group. Four parallel controls were set up for each group. Depending on the group, 140 μL of *Streptococcus agalactiae* (S. agalactiae) or *Aeromonas hydrophila* (A. hydrophila) bacterial suspension was added to each well. Then, BSA protein solution (100 μg / mL), (r)OnFth protein solution (100 μg / mL), and antibiotic (10 μg / mL) were added respectively. Finally, PBS was added to a final volume of 200 μL for incubation. Ampicillin (Amp) was used as a positive control for the Streptococcus agalactiae group, and levofloxacin (LO) was used as a positive control for the Aeromonas hydrophila group.
[0094] The absorbance at OD600nm was measured using a UV spectrophotometer at seven time points: 0, 2, 4, 6, 8, 10, and 12 hours, and growth curves were plotted (e.g., ...). Figure 2 (As shown). Adding PBS buffer or bovine serum albumin (BSA) to the culture medium did not inhibit the proliferation of *Streptococcus agalactiae* and *Aeromonas hydrophila*. Ampicillin significantly inhibited the proliferation of *Streptococcus agalactiae*, and levofloxacin significantly inhibited the proliferation of *Aeromonas hydrophila*. After the addition of either antibiotic, the pathogens essentially lost their ability to proliferate. Although *Streptococcus agalactiae* and *Aeromonas hydrophila* showed proliferative ability after the addition of recombinant ferritin heavy chain protein (rOnFth), their proliferation effect was significantly lower than that of the PBS and BSA groups, indicating that OnFth has a certain antibacterial effect.
[0095] (2) Analysis of the antibacterial function of OnFth using the Oxford cup method
[0096] 1) In a clean bench, take 100 μL of a solution with a concentration of 1×10⁻⁶. 7 CFU / mL of Streptococcus agalactiae or Aeromonas hydrophila bacterial suspension. The bacterial suspension was evenly spread onto BHI or LB solid medium using a spreader, with three technical replicates per experiment.
[0097] 2) Using sterile forceps, place the three sterilized Oxford cups vertically on the solid culture medium, ensuring that they are spaced appropriately and in contact with the culture medium without any gaps. Number them ①, ②, and ③ in a clockwise direction.
[0098] 3) Add 100 μL of LSA protein solution to Oxford cup ① as a negative control. Add 100 μL of (r)OnFth protein solution to Oxford cup ② as the experimental group. Add 100 μL of antibiotic to Oxford cup ③ as a positive control. Ampicillin (Amp) was used as a positive control for the *Streptococcus agalactiae* group, and levofloxacin (LO) was used as a positive control for the *Aeromonas hydrophila* group. Finally, seal the petri dishes with sealing film and label them accordingly.
[0099] 4) Transfer the petri dish smoothly to a 37°C constant temperature incubator and incubate upright for 12 to 14 hours.
[0100] 5) After the incubation period, take photos and record the data. Observe the inhibition zones and perform image analysis. Measure and statistically analyze the diameter (mm) and area (mm²) of the inhibition zones. 2 )(like Figure 3 (As shown in the image). The results showed that the addition of BSA protein to Oxford cups did not produce inhibition zones on the pathogenic bacteria agar plates, while the addition of antibiotics such as ampicillin or levofloxacin produced large inhibition zones on plates of Streptococcus agalactiae and Aeromonas hydrophila, respectively, indicating that the two antibiotics had a bactericidal effect on the pathogenic bacteria. The addition of ferritin also produced obvious inhibition zones on the plates, indicating that the ferritin heavy chain recombinant protein expressed in this study has antibacterial / bactericidal effects.
[0101] Example 3
[0102] Preliminary Study on the In Vivo Antibacterial Function of Nile Tilapia Ferric Protein
[0103] (1) Collection of S. agalactiae stress-induced tilapia and tissue samples
[0104] Prepare and sterilize 10 mM PBS. Activate and expand the culture of *S. gallatiae*. Mix the *S. gallatiae* culture with sterile 10 mM PBS to achieve a final bacterial concentration of 1 × 10⁻⁶. 7 CFU / mL.
[0105] All tilapia were domesticated in a semi-automatic circulation system for more than 2 weeks. Thirty healthy tilapia weighing 50-60g were selected and randomly divided into three groups: PBS group, PBS + *S. agalactiae* group, and *S. agalactiae* + (r)OnFth group. According to their groups, the tilapia were injected intramuscularly (slightly above the lateral line in the middle of the fish) with 100μL of PBS or intraperitoneally with 100μL of *Streptococcus agalactiae* (1×10⁻⁶). 7 CFU / mL and (r)OnFth protein solution (10 μg / g) were injected. After injection, the samples were placed in the corresponding culture tanks according to their groups.
[0106] Twenty-four hours post-infection, fish were anesthetized with MS-2,2,2 (150 mg / L), and three fish from each group were randomly selected for tissue sample collection. Liver, spleen, intestine, and head kidney tissue samples were sequentially collected into 1.5 mL RNase-free centrifuge tubes.
[0107] (2) Real-time quantitative PCR (qRT-PCR)
[0108] Based on the ORF sequence of Nile tilapia OnFth, primers qOnFth-F and qOnFth-R were designed using Primer Premier 5 software for quantitative real-time analysis. β-actin was used as the internal reference gene, and the primers were β-actin-F and β-actin-R.
[0109] Total RNA was extracted using Trizol reagent and cDNA was synthesized. The synthesized cDNA from head kidney, spleen, liver, and intestinal tissue samples was diluted with 180 μL of DEPC water. Primers were diluted to 10 μM. The qRT-PCR reaction system consisted of 20 μL of 10 μL L YBR Green MasterMix (Yisheng Biotechnology, China), 2 μL each of forward and reverse primers, 3 μL template, and 3 μL RNase-free ddH2O.
[0110] Three independent technical replicates were set up for each experimental group to control experimental error. After sample loading, the 96-well plates were immediately sealed with sealing film to ensure the airtightness of the reaction system. The 96-well plates were centrifuged at 500×g, 4℃ for 3 min to ensure that the samples settled to the bottom and avoid air bubble residue. This experiment used a Thermo Fisher QuantStudio 5 real-time fluorescence quantitative PCR instrument for detection. Through 2 -ΔΔCT The method calculates the relative expression level of OnFth mRNA in each tissue.
[0111] (3) Extraction of total protein from tissue
[0112] This embodiment uses an animal whole protein extraction kit (Sangon Biotech, China). The specific steps are as follows:
[0113] 1) Prepare and pre-cool the Lysis Buffer mixture. Tissue samples of tilapia head kidney, spleen, liver, and intestine before and after Streptococcus agalactiae infection were obtained in step (1). Remove the samples to be extracted from the -80℃ freezer and place them on ice for slow freezing. Add 5 μL of phosphatase inhibitor, 1 μL of protease inhibitor, and 10 μL of LPMSF to each 1 mL of pre-cooled Lysis Buffer according to the instructions. Mix thoroughly and pre-cool on ice until ready for use.
[0114] 2) Add 200 μL of pre-chilled sterile 10 mM PBS to the sample tube, gently invert to mix, and wash away impurities from the tissue surface. Centrifuge at 5000 rpm, 4°C for 5 min, and discard the supernatant. Repeat the operation twice.
[0115] 3) Take 300 μL of pre-cooled Lysis Buffer mixture into a sample tube and homogenize it thoroughly using an electric homogenizer. Incubate the lysis buffer on ice for 10 min, removing it during this time and shaking it vigorously three times.
[0116] 4) After the ice bath, centrifuge the sample at 12,000 rpm, 4°C for 5 min. Carefully aspirate 200 μL of the supernatant and transfer it to a new, pre-chilled centrifuge tube. This supernatant is the tissue whole protein extract. The concentration of the extracted protein was determined using a Nano Drop 2000 ultraviolet spectrophotometer. The extracted protein sample was then stored at -80°C for subsequent experiments.
[0117] (4) Western blot
[0118] 1) Dilute the total protein samples from the head, kidney, spleen, liver, and intestine of tilapia to a final concentration of 20 μg / μL with sterile 1×PBS, in a volume of 60 μL. Add 20 μL of 4×Loading Buffer to each sample and heat denature in a boiling water bath for 10 min.
[0119] 2) Prepare a 15% SDS-PAGE gel for electrophoresis (70V, 30min; 120V, 60min). The initial loading volume is 5μL, and the loading volume is adjusted according to the imaging results until the expression level of the β-actin internal reference protein is consistent.
[0120] 3) Prepare the transfer buffer and pre-cool it at 4°C for later use.
[0121] 4) After electrophoresis, remove the gel and transfer it to a PVDF membrane at 100V for 60 minutes (the electrophoresis tank is placed in an ice box to maintain a low temperature environment). After the transfer is complete, remove the PVDF membrane with tweezers and wash it with 1×TTBS for 10 minutes.
[0122] 5) Discard the washing solution, add blocking solution (3% BSA-TTBS) to the incubation box, place it on a horizontal shaker, block at 37℃ and 80rpm for 1 hour, and wash 3 times with 1×TTBS for 10 minutes each time.
[0123] 6) Add rabbit anti-zebrafish β-actin polyclonal antibody (1:1000) or rabbit anti-zebrafish ferritin polyclonal antibody (1:1000). Incubate at 37°C for 1 hour, recover the antibody, and wash three times with 1×TTBS for 10 minutes each time.
[0124] 7) Add HRP-labeled goat anti-rabbit IgG (1:2000), incubate at 37°C for 1 hour, recover the antibody and wash 3 times with 1×TTBS for 10 minutes each time.
[0125] 8) Prepare the chromogenic solution using the enhanced ECL chemiluminescence colorimetric kit (Affinity, USA). Mix equal volumes of solution I and solution II and store in the dark. Scan the membrane using the ChemiDoc Touch chemiluminescence imaging system to detect the internal control protein β-actin in each group and take pictures for later use. Under the condition that the expression level of the β-actin internal control protein is consistent, compare the changes in the expression level of the target protein OnFth.
[0126] (5) Histopathological sections: The liver, spleen, and intestinal tissue samples of tilapia obtained in (1) from the PBS group, PBS+S. agalactiae group, and S. agalactiae+(r)OnFth group were transferred to 4% paraformaldehyde solution and fixed overnight at 4°C. Afterwards, the samples were numbered and sent to Wuhan Servi Biotechnology Co., Ltd. Histopathological sections of the tilapia tissue samples were obtained through paraffin embedding, dewaxing to water, HE staining, dehydration and mounting, and microscopic imaging to analyze the pathological changes in the tilapia tissue samples of each group.
[0127] (6) Mortality Rescue: Eighty Nile tilapia weighing approximately 20-30g were randomly selected from the aquaculture system and divided into four groups: PBS group, *S. agalactiae* group, *S. agalactiae*+BSA group, and *S. agalactiae*+(r)OnFth group. The tilapia were anesthetized with 40mg / L MS-2,2,2. According to their groups, the tilapia were either intramuscularly injected (on the upper part of the lateral line in the middle of the fish) with 100μL PBS or intraperitoneally injected with 100μL of *Streptococcus agalactiae* (1×10⁻⁶). 7 CFU / mL). According to the design groups, the *S. agalactiae* + BSA group and the *S. agalactiae* + (r)OnFth group were intraperitoneally injected with either BSA protein solution (10 μg / g) or (r)OnFth protein solution (10 μg / g). After injection, the fish were returned to their corresponding rearing tanks, one tank per group, with a capacity of 150L per tank. Tilapia in each group were reared normally. From the day of immunization, the survival and mortality of tilapia were recorded daily for 10 days (e.g., CFU / mL). Figure 4 As shown, tilapia did not die after injection of PBS alone. However, tilapia died after intraperitoneal injection of Streptococcus agalactiae and a mixture of Streptococcus agalactiae and BSA protein, and there was no significant difference in mortality between the two groups. Intraperitoneal injection of a mixture of Streptococcus agalactiae and (r)OnFth significantly reduced the mortality rate of tilapia, indicating that tilapia ferritin plays an important role in regulating the body's resistance to pathogen infection.
[0128] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of Nile tilapia ferritin in the preparation of products inhibiting Streptococcus agalactiae, characterized in that, The amino acid sequence of the Nile tilapia ferritin is shown in SEQ ID No.
1.
2. The application of Nile tilapia ferritin in the preparation of products inhibiting Aeromonas hydrophila, characterized in that, The amino acid sequence of the Nile tilapia ferritin is shown in SEQ ID No. 1.