Application of TCN1 and inhibitor thereof in preparation of product for diagnosing and treating autoimmune system diseases
By integrating DNA methylome and transcriptome data, TCN1 was screened as a novel autoantigen for psoriasis. Diagnostic kits and therapeutic drugs were developed, solving the problems of unclear pathogenesis and insufficient therapeutic targets for psoriasis, and achieving highly specific diagnosis and multi-dimensional treatment effects.
Patent Information
- Application Number
- CN202511377111.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-12-30
AI Technical Summary
The pathogenesis of psoriasis is not fully understood in current technologies, and the number of therapeutic targets is limited, which restricts the development of precision treatment. Furthermore, existing diagnostic methods lack highly specific biomarkers.
By integrating DNA methylome and transcriptome data, TCN1 was screened as a novel autoantigen associated with psoriasis. Using the expression level and methylation status of TCN1 as diagnostic biomarkers, diagnostic kits and therapeutic drugs were developed. Targeting TCN1 to inhibit its expression or function led to the design of multi-dimensional diagnostic and treatment strategies.
It provides highly specific diagnostic methods and multidimensional treatment options for psoriasis, effectively inhibiting excessive proliferation of keratinocytes, activation of the IL-17 signaling pathway and autoimmune response, and alleviating psoriatic skin lesions and inflammatory reactions.
Smart Images

Figure CN121227872A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and medical technology, specifically relating to the application of TCN1 and its inhibitors in the preparation of diagnostic and therapeutic products for autoimmune diseases. Background Technology
[0002] Psoriasis is a prevalent chronic autoimmune inflammatory skin disease worldwide, with a global prevalence of approximately 2-3%. Its clinical characteristics include well-defined, erythematous plaques covered with silvery-white scales, with plaque psoriasis accounting for up to 90% of cases. This disease not only affects patients' skin health but is also frequently accompanied by various complications, leading to a decline in quality of life, increased economic burden, and even psychological problems, placing a heavy burden on individuals, the healthcare system, and society.
[0003] The pathogenesis of psoriasis is not yet fully understood, but genetic susceptibility, immune dysregulation, and environmental factors are known to participate in its development. Inflammatory responses and excessive proliferation of keratinocytes are the most prominent features of psoriasis, and activation of the interleukin-17 (IL-17) signaling pathway has been confirmed as a key driver of psoriasis progression. IL-17 is mainly secreted by CD4+ helper T cells (Th17 cells) and innate lymphocyte subsets, promoting disease development by regulating the expression of downstream inflammatory factors. Although anti-IL-17 / IL-23 drugs have shown some effectiveness in psoriasis treatment, some patients still do not respond well. Therefore, further exploration of the molecular mechanisms of psoriasis pathogenesis and the discovery of new therapeutic targets are crucial.
[0004] Autoantigens are components or molecules of the body's own tissues that are mistakenly identified as "foreign substances" by the immune system under pathological conditions, triggering an immune response. They play a central role in the pathogenesis of autoimmune diseases such as psoriasis. For example, LL37, as a T-cell autoantigen, can activate type I interferon and pro-inflammatory factors in dendritic cells after forming a complex with its own DNA / RNA. However, the number of psoriasis-related autoantigens identified so far is limited, and their regulatory mechanisms are not yet fully understood, restricting the development of precision treatment for psoriasis.
[0005] DNA methylation, as an important epigenetic regulatory mechanism, typically regulates gene expression by affecting the methylation level of gene promoter regions. Studies have shown that DNA hypomethylation can lead to the reactivation of previously silenced genes; these abnormally expressed proteins are often immunogenic and may become autoantigens. Based on this, screening for psoriasis-related autoantigens by integrating DNA methylome and transcriptome data holds promise for providing new directions for the study of the disease's mechanisms and treatment. Summary of the Invention
[0006] To address the limitations of existing technologies in treating psoriasis with limited therapeutic targets and an incompletely understood pathogenesis, this invention provides a novel psoriasis-associated autoantigen, TCN1 (Transcobalamin 1), clarifying its mechanism of action in the pathogenesis of psoriasis and other autoimmune diseases. Based on this mechanism, it provides applications of TCN1 in the diagnosis and treatment of psoriasis and other autoimmune diseases, as well as related drugs, offering a new strategy for the precision diagnosis and treatment of these diseases. Specifically, it relates to the uses of the novel autoantigen TCN1, particularly its applications in diagnostic products for psoriasis and other autoimmune diseases, drugs for the prevention or treatment of psoriasis and other autoimmune diseases, and the screening of lead compounds for the treatment of psoriasis, including but not limited to the development of therapeutic drugs targeting TCN1 for autoimmune diseases.
[0007] ①Application of TCN1 as a biomarker for psoriasis.
[0008] This invention confirms that TCN1 is almost not expressed in normal skin tissue, but its expression level is significantly activated in psoriatic lesions. The TCN1 protein is mainly located in acanthotic keratinocytes, granular keratinocytes, and circulating keratinocytes in psoriatic lesions. This invention provides the application of TCN1 as a biomarker in the preparation of products for assisting in the diagnosis of psoriasis or determining the severity of psoriasis. These products include, but are not limited to, diagnostic kits, gene chips, or sequencing services that detect the mRNA expression level, protein expression level, or methylation status of the promoter region of TCN1 in skin tissue or blood samples. Diagnostic criteria: When the mRNA or protein expression level of TCN1 in a sample is detected to be significantly higher than that in healthy controls, it suggests that the subject may have psoriasis or other autoimmune diseases.
[0009] ②Application of TCN1 as an autoantigen in psoriasis.
[0010] Psoriasis is a chronic autoimmune inflammatory skin disease whose pathogenesis is related to genetic and environmental factors. Autoantigens play a crucial role in the development of autoimmune diseases. This invention is the first to demonstrate that TCN1 (a naturally occurring autogenous gene in the human genome) is a novel autoantigen. In normal skin tissue, the TCN1 gene is almost completely silent and cannot be expressed. Unknown genetic and environmental factors induce promoter DNA hypomethylation, leading to the reactivation of TCN1 mRNA and protein in psoriatic lesions. Ectopic protein expression is often misrecognized by the autoimmune system, triggering an autoimmune response. This invention reveals that TCN1 significantly co-localizes with the MHC class II molecule HLA-DRB1 and is positively correlated with dendritic cell (DC) infiltration levels, consistent with the characteristics of autoantigens triggering adaptive immune responses through the antigen presentation system. Consistent with the findings of this invention, in another autoimmune disease, pemphigus, TCN1 is almost not expressed in normal tissue but is significantly activated in pemphigus tissue. Therefore, the application of TCN1 as a diagnostic and therapeutic target proposed in this invention will include psoriasis and other autoimmune diseases characterized by significant upregulation of TCN1 expression.
[0011] ③The role of TCN1 in the pathogenesis of psoriasis.
[0012] Promoting excessive proliferation of keratinocytes: TCN1 co-localizes with the cell proliferation marker Ki-67 in psoriatic tissues, and its expression is highly co-expressed with circulating keratinocyte (also known as proliferative keratinocyte) marker genes (such as TK1, MKI67, CENPW, STMN1, PTTG1, BIRC5, CENPF, TYMS, TOP2A, and UBE2C). Furthermore, overexpression of TCN1 in HaCaT keratinocytes significantly accelerates cell growth rate, increases the proportion of EdU-positive cells, promotes colony formation, and accelerates the G1 / S cell cycle transition, while upregulating the expression of keratinocyte-related proteins (KRT1, KRT10, KRT13, and SPRR1B).
[0013] Activation of the IL-17 signaling pathway: IL-17A-F genes are generally specifically expressed on immune cells (T cells) and are silenced in keratinocytes (HaCaT). Overexpression of TCN1 alone in HaCaT cells significantly activates the expression of downstream effector inflammatory cytokines S100A7, S100A8, S100A9, and LCN2 of the IL-17 signaling pathway. This indicates that TCN1 can activate the IL-17 signaling pathway in keratinocytes without IL-17A-F dependence, significantly upregulating the expression of downstream inflammatory cytokines S100A7, S100A8, S100A9, and LCN2, thereby promoting the inflammatory response process in psoriasis.
[0014] Mediating Autoimmune Responses: As an autoantigen, TCN1 can mediate autoimmune responses. In psoriasis, the TCN1 protein expressed by keratinocytes interacts with the HLA-DRB1 protein, a histocompatibility complex of antigen-presenting cells (DCs), thereby mediating alterations in the immune microenvironment.
[0015] In summary, this invention aims to provide the application of TCN1 and its inhibitors in the preparation of diagnostic and therapeutic products for autoimmune diseases.
[0016] The first objective of this invention is to provide the application of the TCN1 gene as a biomarker in the preparation of products for diagnosing autoimmune diseases, wherein the nucleotide sequence of the TCN1 gene is shown in SEQ ID NO.1.
[0017] Preferably, the TCN1 gene encodes a protein with the amino acid sequence shown in SEQ ID NO.2.
[0018] Preferably, the product includes reagents for detecting TCN1 gene expression levels, TCN1 gene expression product activity, or changes in methylation in the TCN1 gene promoter region.
[0019] Preferably, the product includes PCR amplification reagents and PCR primers for detecting TCN1 gene expression levels, wherein the nucleotide sequence of the upstream primer of the PCR primers is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the PCR primers is shown in SEQ ID NO.4.
[0020] The autoimmune disease mentioned is psoriasis or pemphigus.
[0021] Preferably, the sample used for product testing is skin tissue or blood.
[0022] A second objective of this invention is to provide a medicament for the prevention or treatment of autoimmune diseases, the medicament comprising an agent that inhibits the expression level of the TCN1 gene, an agent that inhibits the activity of the TCN1 gene expression product, or an agent that promotes DNA methylation of the TCN1 gene promoter; the nucleotide sequence of the TCN1 gene is shown in SEQ ID NO.1.
[0023] Preferably, the drug comprises any one of (1)-(4) formulations: (1) siRNA, shRNA or miRNA targeting TCN1; (2) Monoclonal antibodies, polyclonal antibodies, or antibody fragments that specifically bind to TCN1; (3) DNA methyltransferase activators that can restore the methylation level of the TCN1 gene promoter; (4) Small molecule compounds that can inhibit the interaction between TCN1 and HLA-DRB1 or block the activation of the TCN1-mediated IL-17 signaling pathway.
[0024] Preferably, the drug further includes a pharmaceutically acceptable carrier, which is a diluent, excipient, or stabilizer; it can be prepared into various dosage forms such as injections, ointments, and gels for the local or systemic treatment of psoriasis.
[0025] When effective doses of the above-mentioned drugs are administered to psoriasis patients, they can reduce excessive proliferation of keratinocytes by inhibiting the expression or function of TCN1, suppressing the activation of the IL-17 signaling pathway and autoimmune response, thereby alleviating psoriatic lesions and inflammatory responses.
[0026] The beneficial effects of this invention are: Innovative Target: This study reveals for the first time that TCN1 is a key autoantigen in psoriasis that is reactivated through epigenetic regulation, broadening our understanding of the pathogenesis of psoriasis. Through multi-omics integrated analysis (DNA methylome + transcriptome) combined with experimental validation, it was confirmed that TCN1 is reactivated in psoriasis due to promoter DNA hypomethylation and possesses the core characteristics of an autoantigen (co-localization with HLA-DRB1 and association with DC cell infiltration), filling a new gap in the study of psoriasis autoantigens.
[0027] Novel Mechanism: This study elucidates the multiple mechanisms by which TCN1 drives psoriasis, revealing for the first time that TCN1 can not only directly promote excessive proliferation of keratinocytes and mediate autoimmune responses as a self-antigen presenter, but also independently activate the IL-17 signaling pathway in the absence of IL-17A-F, providing a new mechanism for explaining the sustained activation of the IL-17 signaling pathway in psoriasis.
[0028] Diagnostic value: TCN1 is hardly expressed in normal skin, but is specifically highly expressed in spinous keratinocytes, granular keratinocytes and circulating keratinocytes in psoriatic lesions, making it a highly promising and specific diagnostic biomarker.
[0029] Therapeutic significance: Targeting TCN1 holds promise for simultaneously inhibiting multiple key aspects of psoriasis development (autoimmunity, cell proliferation, and inflammation), offering a novel "one-kill-many" treatment strategy. This paper proposes a multi-dimensional diagnostic and therapeutic strategy based on TCN1, using TCN1 as a diagnostic biomarker for psoriasis and designing various types of therapeutic drugs based on its expression regulation mechanisms (DNA methylation) and functional mechanisms (keratinocyte proliferation, IL-17 activation), achieving an integrated innovation of "diagnosis-target-treatment".
[0030] Methodological Innovation: The method upon which this invention is based, "screening for disease-specific autoantigens using integrated multi-omics data from DNA methylome and transcriptome," has universality and can be applied to the research of other autoimmune diseases. Furthermore, TCN1 is significantly upregulated in autoimmune diseases such as psoriasis and pemphigus, suggesting that TCN1 may be an autoantigen in various autoimmune diseases. Therefore, the diagnostic and therapeutic applications of TCN1 targeting will not be limited to psoriasis.
[0031] Animal Model Guidance: This invention points out the limitations of existing animal models of psoriasis and provides directions for improvement. It discovers that the TCN1 gene is absent in the mouse genome, suggesting that traditional mouse psoriasis models cannot accurately reflect the course of human psoriasis. Based on this invention, researchers are advised to use species containing the TCN1 gene (such as primates, dogs, and pigs) to construct psoriasis models that are closer to those in humans. This invention provides important reference for establishing models using experimental animals containing the TCN1 gene to explore the development and treatment of psoriasis. Attached Figure Description
[0032] Figure 1 This is a workflow diagram for screening psoriasis autoantigens through multi-omics data analysis. Based on the important characteristic that "DNA hypomethylation leads to gene reactivation," significantly upregulated genes (Group 1) and significantly downregulated promoter DNA methylation genes (Group 2) were identified through RNA-seq analysis and DNA methylation data analysis, respectively. The intersection of genes in Group 1 and Group 2 was used to identify genes with downregulated promoter DNA methylation and upregulated gene expression (Group 3). Human immortalized keratinocytes (HaCaT) were treated with a DNA methyltransferase inhibitor (DNMTi) and RNA-seq was performed to identify genes that could be activated by DNMTi (genes negatively regulated by DNA methylation modification, Group 4). The workflow for integrating genes from Group 3 and Group 4 and taking their intersection to identify potential psoriasis autoantigens is then described. DEG: Differentially expressed gene; DE: Differentially expressed; DNMT: DNA methyltransferase.
[0033] Figure 2The identification of aberrantly expressed genes and DNA methylation genes in psoriasis is presented. A: Differentially expressed genes (DEGs) analysis using RNA-seq data GSE117405, with log2-fold change (log2FC) and p-values for each gene displayed in a volcano plot. B: Expression patterns of the top 200 differentially expressed genes in psoriatic tissues from the GSE117405 cohort are displayed in a heatmap. C: Log2-fold change (log2FC) and p-values for each CpG are displayed in a volcano plot through differential methylation analysis. D: Methylation status of the top 200 differentially methylated CpG sites in 24 pairs of normal / psoriatic tissues from the GSE115797 cohort is displayed in a heatmap. E: Genes with decreased expression and upregulated DNA methylation levels in psoriasis. F: Genes with increased expression and downregulated DNA methylation levels in psoriasis. G: Based on normalized gene expression data (FPKM values) from GSE117405, TCN1 is almost not expressed in normal skin, but is significantly upregulated in psoriatic tissue. HK: The TCN1 gene promoter contains four CpG sites, including cg0398812, cg00187686, cg23741006, and cg20018806. DNA methylation analysis of these four TCN1 promoter DNA CpG sites showed that the TCN1 promoter DNA methylation level was significantly reduced in psoriasis. *** indicates statistical significance, P<0.001.
[0034] Figure 3 We confirmed that TCN1 hypomethylation leads to its overexpression in psoriasis. A: RNA sequencing of HaCaT cells treated with 0, 25, and 50 μM 5-aza-2'-deoxycytidine (DAC) identified genes activated by DNA methyltransferase inhibitors. B: Log2-fold change (log2FC) and p-values for each gene obtained by differentially expressed genes (DEG) analysis are shown in a volcano plot. C: The top 125 differentially expressed genes in the GSE302665 cohort are shown in a heatmap. D: Through multi-omics data analysis, we identified 57 psoriasis-associated antigens, including TCN1. E: RNA sequencing analysis confirmed that inhibition of DNA methylation by 5-aza-2'-deoxycytidine activates TCN1 expression. F: Real-time quantitative polymerase chain reaction (qRT-PCR) assays showed that 5-aza-2'-deoxycytidine activates TCN1 expression in HaCaT cells in a dose-dependent manner. G: Correlation analysis using the MEXPRESS network tool showed that in the TCGA_SKCM cohort, TCN1 expression was negatively correlated with DNA methylation of its gene promoter. H, I: In the pemphigus cohort (cohort GSE299468), TCN1 was rarely expressed in normal tissues and was significantly upregulated in pemphigus tissues.
[0035] Figure 4 The study confirmed a significant upregulation of TCN1 in psoriatic keratinocytes. A: Flowchart of the integrated analysis of five independent psoriatic single-cell datasets. B: Unified manifold approximation and projection (UMAP) plots for different cell types based on the integrated single-cell analysis, annotated using the DISCO platform for each cluster's cell type. C: Heatmap showing the expression profiles of the top 10 most abundant genes in different cell types. D: UMAP plot showing the TCN1 expression pattern in normal and psoriatic tissues. E: Dot plot showing the TCN1 expression profiles of 14 different cell types in normal and psoriatic tissues. F: Analysis of differences in TCN1 expression levels between normal and psoriatic tissues in each cell type. G: Representative images of TCN1 immunohistochemical staining in normal and psoriatic tissues; TCN1 protein expression is low in normal skin tissue. H: Statistical analysis showed a significant upregulation of TCN1 protein in psoriatic tissues.
[0036] Figure 5 TCN1 was identified as an autoantigen associated with dendritic cell infiltration in psoriasis. A. Multiplex immunohistochemistry (mIHC) was performed on a cohort of clinical samples (containing 8 pairs of normal and psoriatic tissues) using HLA-DRB1 (cyan), TCN1 (white), SPRR1B (orange), KRT10 (green), and DAPI (blue). Keratinocytes (marker gene: KRT10) were labeled green, while dendritic cells (marker gene: HLA-DRB1) were labeled cyan. B, C: Multiplex immunohistochemistry confirmed a significantly increased proportion of keratinocytes and dendritic cells in psoriasis. DG: Multiplex immunohistochemistry confirmed a significant upregulation of TCN1, KRT10, SPRR1B, and HLA-DRB1 protein expression levels in psoriasis. H: Significant colocalization of TCN1 and HLA-DRB1 proteins was observed in psoriatic tissues. I, J: Immune infiltration analysis of GSE117405 RNA-seq data was performed using deconvolution methods. The results showed that the infiltration levels of 9 immune cell types were significantly upregulated and the infiltration levels of 5 immune cell types were significantly downregulated in psoriatic tissues; TFH: follicular helper T cells, Tgd: γδ T cells, iDC: immature dendritic cells, aDC: activated dendritic cells. K: Lollipop plot based on the GSE117405 cohort shows the correlation analysis between TCN1 expression levels and different immune cell types.
[0037] Figure 6The study confirmed a positive correlation between TCN1 expression and keratinocyte proliferation. A: Based on integrated single-cell analysis, the proportion of each cell type in all samples was analyzed, and the bar chart distribution shows the proportion of each cell type in each sample in normal and psoriatic tissues. B: Single-cell analysis of the proportion of each cell type between normal and psoriatic samples in the integrated analysis. C: The expression profiles of the top 10 genes with the highest expression abundance in circulating keratinocytes are shown in the dot plot. D: Gene expression correlation analysis based on RNA-seq data from the GSE117405 cohort showed that TCN1 expression in psoriasis is highly co-expressed with circulating keratinocyte-specific genes. E: Serial sections were prepared from normal and psoriatic skin tissues from a donor in clinical samples, and then immunohistochemical staining was performed on TCN1 and the proliferation marker Ki-67, respectively. This figure shows the immunohistochemical results of TCN1 and Ki-67 proteins in normal and psoriatic skin tissues.
[0038] Figure 7 TCN1 overexpression significantly promotes keratinocyte proliferation. A, B: TCN1-overexpressing HaCaT cell lines were established via lentiviral transfection, and Western blot analysis confirmed successful TCN1 overexpression in HaCaT cells. C: CCK-8 assay showed that TCN1 overexpression significantly accelerated the growth rate of HaCaT cells. D, E: EdU staining assay showed that TCN1 overexpression significantly increased the proliferation rate of HaCaT cells. F, G: Cell colony formation assays confirmed that TCN1 overexpression significantly promoted the colony formation rate of HaCaT cells. H: Cell cycle analysis showed that TCN1 overexpression promoted the G1 / S phase transition of HaCaT cells. I: RNA-seq analysis of HaCaT cell lines with and without TCN1 overexpression showed that TCN1 overexpression increased the expression of keratinocyte-related proteins, including KRT1, KRT10, KRT13, and SPRR1B. J: Gene expression correlation analysis in the TCGA_SKCM cohort showed a positive correlation between TCN1 and the expression of keratinocyte-associated proteins (including KRT1, KRT10, KRT13, and SPRR1B). K, L: qRT-PCR and Western blot analysis confirmed that TCN1 overexpression promotes the mRNA and protein expression of KRT1, KRT10, KRT13, and SPRR1B in HaCaT cells. M, N: UAMP plots of KRT1, KRT10, KRT13, and SPRR1B in normal and psoriatic tissues obtained through single-cell analysis.
[0039] Figure 8In HaCaT cells, TCN1 overexpression activates the IL-17 signaling pathway in the absence of IL-17 molecules. A, B: Differentially expressed gene (DEG) and GO / KEGG analyses were performed based on RNA-seq data from TCN1 overexpression. C: Except for keratin, TCN1 overexpression significantly upregulated the expression of genes related to the IL-17 signaling pathway. D, E: GO / KEGG analysis confirmed that TCN1 overexpression activates the IL-17 signaling pathway in HaCaT cells. F, G: qRT-PCR and Western blot experiments confirmed that TCN1 overexpression increases the mRNA and protein expression of genes related to the IL-17 signaling pathway (including LCN2, S100A7, S100A8, and S100A9) in HaCaT cells. H: Gene expression correlation analysis based on GSE117405 RNA-seq data showed a positive correlation between TCN1 and the expression of genes related to the IL-17 signaling pathway in psoriasis. I: Integrated single-cell analysis showed a positive correlation between the expression of TCN1 and genes related to the IL-17 signaling pathway in psoriasis. J: Serial sections were prepared from normal skin tissue and psoriatic skin tissue from a donor in a clinical sample, and immunohistochemical staining was performed on TCN1 and the IL-17 signaling marker S100A8, respectively. This figure shows the immunohistochemical results of TCN1 and S100A8 proteins in normal skin tissue and psoriatic skin tissue. Figure 9 This is a summary diagram of the signaling pathway by which TCN1, as an autoantigen, participates in the regulation of psoriasis. Detailed Implementation
[0040] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0041] Example 1 I. Materials and Methods 1. Clinical Sample Acquisition: Twenty patients with psoriasis vulgaris (10 men and 10 women, aged 20-60 years) and ten healthy volunteers (5 men and 5 women, aged 20-38 years) were recruited at the People's Hospital of Hubei University of Medicine for the experiment. All samples were pathologically confirmed. Tissue samples were immediately frozen in liquid nitrogen after excision and stored at -80°C until use.
[0042] 2. Differentially Expressed Genes: Normalized gene expression data (FPKM values) in the psoriasis cohort (GSE117405) were downloaded directly from the Gene Expression Comprehensive Database (GEO) dataset. The GSE117405 psoriasis cohort included 19 psoriasis skin samples (including palms, soles, scalp, and conventional psoriasis skin) and 9 healthy control skin samples. Differentially expressed genes in psoriasis were screened using the DESeq2 R package (p<0.05).
[0043] 3. DNA Methylation Analysis: DNA methylation profiles were determined using a genome tiling array with an Illumina HumanMethylation450 BeadChip (platform GPL13534). The relative DNA methylation level at each CpG site was assessed using normalized β values. DNA methylation data from the psoriasis cohort (GSE115797) were downloaded directly from the Gene Expression Comprehensive Database (GEO) dataset. The GSE115797 psoriasis cohort contained 24 pairs of psoriasis / normal tissue. Differentially methylated CpG sites in the GSE115797 cohort were screened using the Limma R package (p<0.05). Annotation information for each CpG site was obtained from platform GPL13534. Genes with at least one differentially methylated CpG site were considered differentially methylated genes.
[0044] 4. Single-cell RNA sequencing data from datasets GSE151177, GSE162183, GSE173706, GSE230842, and GSE248121 can be obtained from the GEO database. Import the 10× data matrix into the Seurat V5.1 R package (https: / / satijalab.org / seurat) for data filtering, sample integration, gene normalization, dimensionality reduction, and data visualization. Detailed steps for sample integration are as follows. Cell types are annotated using the CellMarker2 database. Detailed information on single-cell analysis is as follows. Import the 10× data matrix into the Seurat V5.1 R package for data filtering, sample integration, gene normalization, dimensionality reduction, and data visualization. Cells with low feature counts (<200 or >8000) and high mitochondrial gene percentages (>20%) are removed. To eliminate batch effects that could impact the accuracy of single-cell analysis, batch effect correction analysis was performed using the Harmony v1.2 package with default harmony parameters, based on the top 2000 most abundant variable genes. Dimensionality reduction was performed using Seurat's "RunPCA" function. Then, single-cell clusters were visualized using Uniform Manifold Approximation and Projection for Dimension Reduction (UMAP), and cells were clustered using a graph-based clustering method, using the top 20 principal components with the largest variance (resolution = 0.2 for all pooled samples). Clusters of different cell types were identified using the DISCO platform.
[0045] 5. The human keratinocyte cell line HaCaT was purchased from the Shanghai Cell Bank. HaCaT cells were cultured for 48 hours with 0, 25, and 50 μM 5-aza-2'-deoxycytidine (5-AZA-CdR, DAC) added to cell culture medium. Cells were collected for mRNA analysis and RNA-seq studies. 5-aza-2'-deoxycytidine (product number: A1906) was purchased from APEXBIO in Houston, USA, and was dissolved in dimethyl sulfoxide (DMSO, Darmstadt, Germany) to a final concentration of 100 nM to prepare 5-AZA-CdR solutions of different concentrations. RNA-seq data have been uploaded to the GEO dataset, GEO accession number GSE302665.
[0046] 6. Total RNA was extracted using Trizol reagent (Invitrogen, USA). Reverse transcription was performed using the PrimeScript™ RT kit (Perfect Real Time, Takara, catalog number RR047) to obtain cDNA. The qPCR protocol was followed using the One Step TB Green PrimeScript™ RT-PCR Kit II (Takara, catalog number RR086) according to the manufacturer's instructions. qPCR analysis was performed on a Bio-Rad CFX Manager 3.1 real-time PCR system.
[0047] The qPCR primers used in this experiment are as follows: TCN1-F: TAGCACAGGAGAAGCCATGC (SEQ ID NO.3), TCN1-R: GCAGCGTTTGGATTGCTGAA (SEQ ID NO.4); KRT1-F: CTTACTCTACCTTGCTCCTACT (SEQ ID NO.5), KRT1-R:AAATCTCCCACCACCTCC (SEQ ID NO.6); KRT10-F: ACACCGCACAGAACCACCACTC (SEQ ID NO.7), KRT10-R: GGCAGGCACAGGTCTTGATGAAC (SEQ ID NO. 8); KRT13-F:ACCTCTGTTACCACGACTT (SEQ ID NO.9), KRT13-R: GCCTACGGACATCAGAAGT (SEQ ID NO. 10); SPRR1B-F: CCAGTTCTAAGGGACCATACAGA (SEQ ID NO.11), SPRR1B-R: CTCCTTGGTTTTGGGGATG (SEQ ID NO. 12); LCN2-F:TCACCTCCGTCCTGTTTAGG (SEQ ID NO.13), LCN2-R:CGAAGTCAGCTCCTTGGTTC (SEQ ID NO. 14); S100A7-F: AACTTCCTTAGTGCCTGTG (SEQ ID NO.15), S100A7-R: TGGTAGTCTGTGGCTATGTC (SEQ ID NO. 16); S100A8-F: GGGAATTTCCATGCCGTCT (SEQ ID NO.17), S100A8-R: CCTTTTTCCTGATATACTGAGGAC (SEQ ID NO. 18); S100A9-F: CTGTGTGGCTCCTCGGCT (SEQ ID NO.19), S100A9-R: GCGTTCCAGCTGCGACAT (SEQ ID NO. 20); MMP1-F: CTGTTCAGGGACAGAATGTGCT (SEQ ID NO.21), MMP1-R: TCGATATGCTTCACAGTTCTAGGG (SEQ ID NO. 22); β-actin-F: ATCGTCCACCGCAAATGCTTCTA (SEQ ID NO. 23), β-actin-R: AGCCATGCCAATCTCATCTTGTT (SEQ ID NO. 24).
[0048] 7. To achieve stable overexpression of TCN1, oe_TCN1 lentivirus was purchased from Jikai Gene (Shanghai, China). HaCaT cells were transfected with the lentivirus according to the manufacturer's instructions. At specified time points, mRNA (48 h post-transfection) and protein (72 h post-transfection) from HaCaT cells were collected for quantitative PCR detection, RNA Seq assays, protein analysis, CCK-8 assays, Edu staining assays, cell colony formation assays, and cell cycle assays. RNA-seq data of TCN1 overexpression in HaCaT cells have been uploaded to the GEO database; the GEO accession number is GSE302664.
[0049] 8. Skin samples from psoriasis patients and healthy controls underwent pathological evaluation. Immunohistochemical analysis was performed on paraffin sections of clinical samples. Images were acquired using a Leica laser microdissection system (Wetzlar, Germany). Image acquisition and analysis of sections were performed using ImageScope (3DHISTECH, Budapest, Hungary). For immunohistochemistry, sections were dewaxed and stained with anti-TCN1 (16078-1-AP, Proteintech), anti-S100A8 (GB11421, Servicebio), and anti-Ki67 (GB151499, Servicebio).
[0050] 9. mIHC assays were performed using an mIF kit (G1256, Servicebio, Wuhan, China) according to the manufacturer's protocol. Quadruple immunofluorescence utilizes tyrosine signal amplification (TSA) technology to simultaneously label four proteins on the same slide. Most steps of mIHC are the same as IHC. The minor difference is that in mIHC, TSA treatment and microwave elution are required after incubation with the primary and secondary antibodies. In the presence of HRP and hydrogen peroxide, TSA treatment causes the fluorescently labeled tyrosine to covalently bind to the tyrosine residues of the target protein. Since the non-covalently bound primary and secondary antibodies are decomposed and washed away by microwave treatment, the covalently bound fluorescent tyrosine remains attached to the target protein. Thus, when detecting a second target, it is equivalent to performing a new round of labeling, without considering whether the second round of antibodies will cross-react with the first round. Different targets can be labeled by repeating the immunolabeling process multiple times. Fluorescent tyrosine can be used to achieve double or multiplex fluorescent staining. The primary antibodies and corresponding TSA types used in this experiment are as follows: TCN1 (16078-1-AP, Proteintech, white), HLA-DRB1 (GB115523, cyan), SPRR1B (11959-1-AP, orange), and KRT10 (GB112105, green).
[0051] 10. The primary antibodies used were as follows: TCN1 (16078-1-AP, Proteintech, Wuhan, China), KRT1 (A9776, ABclonal, Wuhan, China), KRT4 (A0013, ABclonal, Wuhan, China), KRT10 (A7908, ABclonal, Wuhan, China), KRT13 (A0411, ABclonal, Wuhan, China), SPRR1B (11959-1-AP, Proteintech, Wuhan, China), LCN2 (A3176, ABclonal, Wuhan, China), S100A7 (A22271, ABclonal, Wuhan, China), S100A8 (A12018, ABclonal, Wuhan, China), S100A9 (A9842, ABclonal, Wuhan, China), and GAPDH (AC054, ABclonal, Wuhan, China) were purchased from Proteintech (Wuhan, China). HaCaT cells were lysed in RIPA buffer supplemented with 1 mM PMSF. Approximately 50–100 μg of total protein was transferred to a PVDF membrane after electrophoresis on a 10% SDS-PAGE polyacrylamide gel. The membrane was blocked with 5% skim milk at 4°C for 1 hour, and then incubated overnight at 4°C with primary antibody. The blot was then washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:10000, Earthox) at room temperature for 1.5 hours. Detection was performed using the SuperLumia ECL HRP substrate kit (K22030, Abbkine), and imaging was performed using a Bio-Rad imaging system (USA).
[0052] II. Results and Analysis 1. TCN1 as an autoantigen and its expression characteristics in psoriatic tissues Tumor-specific antigens (TSA) or cancer-testis (CT) antigens are a class of ectopically expressed and immunogenic proteins. Autoantigens are components or molecules of the body's own tissues that are normally tolerated by the immune system, but under pathological conditions, they are mistakenly identified as "foreign substances" by the immune system, triggering an autoimmune response. CT antigens are essentially autoantigens because CT antigen genes are naturally present in the human genome. Referring to a previously developed method for identifying TSA or CT antigens (Li D, Xia L, Zhang X, Liu Y, Wang Z, Guo Q, Huang P, Leng W, Qin S. A new high-throughput screening methodology for the discovery of cancer-testis antigen using multi-omics data. Comput MethodsPrograms Biomed. 2024 Jun;250:108193.), this experiment replaces the tumor cohort with a psoriasis cohort and utilizes this method to integrate and analyze DNA methylome and transcriptome data from psoriasis to attempt to identify psoriasis-related autoantigens. Detailed steps and instructions are as follows... Figure 1 As shown. Psoriasis-related RNA-seq datasets (GSE117405) and DNA methylation profiles (GSE115797) are available on the NCBI website. Through joint analysis of RNA-seq and DNA methylome data, the focus was on genes exhibiting reduced promoter DNA methylation modification and upregulated expression.
[0053] The GSE117405 dataset contains RNA sequencing data from 19 psoriasis samples and 9 normal skin samples. Differential gene expression analysis identified differentially expressed genes in psoriasis. A total of 6638 genes were significantly downregulated in psoriasis, and 1835 genes (Group 1, including TCN1) were significantly upregulated. Figure 2 (A in the image). The heatmap shows the top 200 differentially expressed genes in psoriasis samples selected based on p-values. Figure 2 (B in the middle).
[0054] On the other hand, the GSE115797 cohort contains DNA methylome data from 24 pairs of psoriasis / normal tissues. Through DNA methylation analysis, we found significantly reduced methylation levels at 132,767 CpG sites and significantly increased methylation levels at 113,986 CpG sites in psoriasis tissues. Figure 2(C in the text). Based on gene annotation for each CpG site, DNA methylation levels were significantly elevated in 17,290 genes and significantly decreased in 19,701 genes (Group 2, including TCN1) in psoriasis patients. The top 200 differentially methylated CpG sites in psoriasis (selected based on p-values) are shown in the heatmap (C in the text). Figure 2 (D in the middle).
[0055] DNA methylation typically negatively regulates gene expression. A growing body of research confirms that DNA hypomethylation plays a crucial role in the reactivation of gene expression during disease. According to the screening flowchart ( Figure 1 The study focuses on genes that are upregulated in psoriasis and downregulated in promoter DNA methylation (Group 3), comprising 1381 genes. Figure 2 (E, F in the original text). The results of TCN1 gene expression analysis and promoter DNA methylation analysis in psoriasis tissues are as follows: Figure 2 As shown in GK.
[0056] To further determine the causal relationship between gene overexpression and DNA hypomethylation, RNA sequencing was performed in the HaCaT cell line. The HaCaT cell line was exposed to the classic DNA methyltransferase inhibitor (DNMTi) 5-Aza-CdR before RNA sequencing. Figure 3 As shown in the volcano plot, a total of 768 genes (Group 4) were significantly upregulated by 5-Aza-CdR (A). Figure 3 (B in the image). The heatmap further shows the top 125 differentially expressed genes (DEGs) regulated by 5-Aza-CdR (B in the image). Figure 3 (C in the text). Next, as in... Figure 1 As described in the paper, by intersecting 768 upregulated genes in Group 4 with 1381 downregulated and upregulated genes in Group 3, 57 potential psoriasis-related autoantigen genes were ultimately identified. Figure 3 (D in the original text). RNA-seq and qRT-PCR analyses jointly confirmed that TCN1 expression in HaCaT cells was activated by 5-Aza-CdR treatment (…). Figure 3 E and F in the TCGA_SKCM cohort (see http: / / www.cbioportal.org / for details), the promoter DNA methylation level of TCN1 is negatively correlated with its expression level. Figure 3 TCN1 is almost not expressed in normal skin, but it is significantly activated in autoimmune skin diseases such as psoriasis and pemphigus (cohort GSE299468, from the GEO database of NCBI website). Figure 3 (H, I in the text). In summary, the overexpression of TCN1 in psoriasis is due to hypomethylation of its gene promoter DNA. TCN1 is likely an autoantigen involved in the progression of autoimmune skin diseases such as psoriasis and pemphigus. The nucleotide sequence encoded by the TCN1 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the protein is shown in SEQ ID NO.2.
[0057] like Figure 4 As shown in Figure A, five single-cell RNA sequencing datasets for psoriasis (GSE151177, GSE162183, GSE173706, GSE230842, and GSE248121) were imported into the Seurat V5.1 R package (https: / / satijalab.org / seurat) for data filtering, sample integration, gene standardization, dimensionality reduction, and data visualization. After quality control, 240,495 cells were obtained for cluster analysis. Dimensionality reduction analysis using UAMP yielded 14 cell clusters (…). Figure 4 The B group includes CD4+ T cells (CD4 T cells), venous endothelial cells (Venous ECs), lymphatic endothelial cells (Lymphatic ECs), monocytes, vascular smooth muscle cells (Vascular SMCs, VSMCs), fibroblasts, secretory cells, glial cells, melanocytes, basal keratinocytes, spinous keratinocytes, granular keratinocytes, and circulating keratinocytes. The top 10 most abundant genes expressed in each cell type are shown in the dot plot. Figure 4 (C in the text). Then, single-cell analysis was used to focus on the expression pattern of TCN1 in psoriasis. The results showed that TCN1 was mainly expressed in acanthopancreatic keratinocytes, granular keratinocytes, and circulating keratinocytes (C in the text). Figure 4 Notably, consistent with bulk RNAseq analysis, TCN1 was almost not expressed in keratinocytes of normal tissues, but was significantly upregulated in the spinous, granular, and circulating keratinocyte layers of psoriasis samples. Figure 4To further confirm these results, immunohistochemistry (IHC) was performed in a psoriasis cohort (from clinical samples), and the results showed that TCN1 was specifically expressed in keratinocytes of psoriatic tissues, while it was hardly expressed in healthy skin tissues. Figure 4 (G, H in the text).
[0058] To further determine the autoantigenic characteristics of TCN1, multiplex immunohistochemistry (mIHC) was performed on psoriasis tissue and normal tissue in the obtained clinical samples. TCN1 was labeled white; HLA-DRB1 (dendritic cell marker) was labeled cyan (red); SPRR1B was labeled orange; and KRT10 (keratinocyte marker) was labeled green (red). Figure 5 A in the text). Statistical analysis revealed that keratinocytes (A) were present in psoriatic tissue. Figure 5 B) and dendritic cells ( Figure 5 The proportion of C in psoriatic tissues increased significantly. Correspondingly, the expression levels of TCN1, KRT10, SPRR1B, and HLA-DRB1 in psoriatic tissues were also significantly upregulated. Figure 5 (DG in the text). HLA-DRB1 belongs to MHC class II molecules. Its encoded protein forms a heterodimer with HLA-DRA, responsible for presenting antigenic peptides to CD4+ T cells and activating adaptive immune responses. Notably, TCN1 and HLA-DRB1 show significant co-localization in psoriatic tissues, while this phenomenon is not observed in normal skin tissues. Figure 5 (H in the text). Consistent with the results of multiple immunohistochemistry (mIHC), deconvolution analysis using single-sample gene set enrichment analysis (ssGSEA) based on GSE117405 RNA-seq data showed that the infiltration levels of Th17 cells, CD4+ T cells, and activated dendritic cells (aDCs) were significantly upregulated in psoriasis. Figure 5 In the I and J categories). As expected, in the psoriasis cohort (GSE117405 cohort), TCN1 expression was significantly correlated with the infiltration levels of CD4+ T cells and aDC cells (I, J). Figure 5 (K in the text). In summary, TCN1 is an autoantigen in psoriasis and participates in the immune response.
[0059] 2. TCN1 overexpression enhances the excessive proliferation of keratinocytes. Because the number of available single cells varied across different samples, the proportion of each cell type in each clinical sample was analyzed, including 37 psoriasis samples and 34 normal samples. Figure 6 (A) Next, we compared the differences in the proportion of each cell type in psoriasis samples and normal samples. Figure 6As shown in B, the proportions of the seven cell types (acanthoblasts, fibroblasts, CD4+ T cells, monocytes, circulating keratinocytes, lymphoendothelial cells, and glial cells) differed significantly between psoriasis samples and normal samples. Notably, the proportion of circulating keratinocytes was significantly increased in psoriasis tissue.
[0060] Based on gene expression patterns from single-cell analysis, 10 genes were highly expressed in circulating keratinocytes of skin tissue, including TK1, MKI67, CENPW, STMN1, PTTG1, BIRC5, CENPF, TYMS, TOP2A, and UBE2C. Figure 6 (C) Because the MKI67 gene is highly expressed in circulating keratinocytes (RCCs), these cells have a strong proliferative capacity. Given that TCN1 is upregulated in RCCs, we analyzed the correlation between TCN1 expression and RCC-specific gene expression in the psoriasis cohort GSE117405. As expected, TCN1 was highly co-expressed with most RCC-specific genes (C). Figure 6 In addition, immunohistochemical (IHC) experiments further confirmed that TCN1 and the cell proliferation marker Ki-67 protein were highly colocalized in psoriasis tissues. Figure 6 (E in the text). These results indicate that TCN1 overexpression is associated with excessive proliferation of keratinocytes.
[0061] To further verify the role of TCN1 upregulation in driving keratinocyte proliferation, the human keratinocyte cell line HaCaT was selected, and a TCN1-overexpressing cell line was established through lentiviral transfection. Western blot analysis confirmed successful overexpression of TCN1 in HaCaT cells. Figure 7 (A and B in the text). The CCK-8 assay confirmed that TCN1 overexpression significantly increased the growth rate of HaCaT cells ( Figure 7 C in the text). EdU staining experiments showed that TCN1 overexpression significantly enhanced the proliferation rate of HaCaT cells (C). Figure 7 (D, E in the text). Cell colony formation experiments verified that TCN1 overexpression significantly promoted the proliferation rate of HaCaT cells (D, E). Figure 7 The F and G values in the text are consistent. Cell cycle experiments further demonstrated that TCN1 overexpression significantly accelerated the G1 / S phase transition of HaCaT cells. Figure 7In summary, TCN1 overexpression promotes excessive proliferation of keratinocytes. To elucidate the potential molecular mechanism by which TCN1 overexpression leads to excessive keratinocyte proliferation, RNA sequencing was performed in the HaCaT cell line (GSE302664). RNA-seq analysis revealed differentially expressed genes (DEGs) regulated by TCN1, as shown in the heatmap. Figure 7 (I) Clearly, several keratinocyte-associated proteins (KRT10, KRT1, KRT13, SPRR1B) are upregulated due to TCN1 overexpression. Gene expression correlation analysis showed that in the TCGA_SKCM cohort, TCN1 expression was highly co-expressed with KRT10, KRT1, KRT13, and SPRR1B. Figure 7 J in the middle). qRT-PCR and Western blot analysis jointly confirmed that TCN1 overexpression can significantly upregulate the expression of keratinocyte-related proteins (J). Figure 7 K and L in the figure). UAMP plot showed that KRT10, KRT1, KRT13 and SPRR1B are specifically expressed in keratinocytes and upregulated in psoriasis. Figure 7 (M, N in the text).
[0062] 3. Activation effect of TCN1 on the IL-17 signaling pathway Furthermore, we used RNA-seq data from TCN1 overexpression to perform GO / KEGG analysis on HaCaT cells. Figure 8 A in the figure). Differentially expressed genes (DEG) analysis based on RNA-seq data is shown in the volcano diagram (…). Figure 8 B). Notably, in addition to several keratins, TCN1 overexpression also significantly upregulated proteins related to the IL-17 signaling pathway, including S100A7, S100A8, S100A9, MMP1, MMP13, and LCN2. Figure 8 (BD in the text). Correspondingly, genes with TCN1 overexpression upregulated are enriched in the IL-17 signaling pathway, which is typically activated in psoriasis (BD). Figure 8 To validate the RNA-seq data, we further performed qRT-PCR experiments in TCN1-overexpressing cell lines. The results showed that TCN1 overexpression significantly upregulated the mRNA expression levels of S100A7, S100A8, S100A9, LCN2, and MMP1 (E in the original text). Figure 8 The F in the text). Western blot analysis also showed that in HaCaT cells, TCN1 overexpression significantly upregulated the expression of S100A7, S100A8, and S100A9 (F in the text). Figure 8In addition, gene expression correlation analysis based on batch RNA-seq data (GSE117405) and single-cell datasets jointly showed that TCN1 expression was positively correlated with the IL-17 signaling pathway in both normal and psoriasis tissues. Figure 8 The H and I in the text. Furthermore, immunohistochemical (IHC) analysis further confirmed that TCN1 and the IL-17 signaling marker S100A8 protein were highly co-localized in psoriatic tissues. Figure 8 (J in the text). These results indicate that TCN1 acts as an endogenous activator of the IL-17 signaling pathway in keratinocytes. Notably, since HaCaT cells cannot express IL-17A-F, TCN1 can still activate downstream IL-17 signaling pathways in the absence of IL-17 signaling.
[0063] In summary, we have drawn the following diagrams: Figure 9 The abstract shown illustrates that TCN1 is an autoantigen in psoriasis and an endogenous activator of the IL-17 signaling pathway. Due to unknown environmental or genetic factors, the promoter DNA methylation level of the TCN1 gene is significantly reduced, leading to its aberrant overexpression in psoriatic keratinocytes. On one hand, as an autoantigen, the aberrant reactivation of TCN1 triggers an autoimmune response through the antigen presentation system. On the other hand, in the absence of IL-17 molecules, the upregulation of TCN1 activates the IL-17 signaling pathway and promotes excessive proliferation of keratinocytes. Therefore, TCN1 plays a central role in psoriasis and can serve as a therapeutic target for psoriasis. Consequently, preparations that can inhibit TCN1 expression (siRNA, shRNA, antisense oligonucleotides), preparations that inhibit the function of TCN1 gene expression products (neutralizing antibodies, small molecule inhibitors, or soluble receptors, etc.), or preparations that promote the methylation level of the TCN1 gene promoter can be used to prepare drugs for the prevention and treatment of psoriasis and other autoimmune diseases. These drugs also include pharmaceutically acceptable carriers, which are diluents, excipients, or stabilizers. They can be prepared into various dosage forms such as injections, ointments, and gels for the local or systemic treatment of psoriasis.
Claims
1. Use of the TCN1 gene as a marker in the manufacture of a product for diagnosing an autoimmune system disease, characterized in that, The nucleotide sequence of the TCN1 gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The TCN1 gene encodes a protein with an amino acid sequence shown as SEQ ID NO.
2.
3. Use according to claim 1, characterized in that, The product comprises a reagent for detecting the expression level of the TCN1 gene, the activity of the TCN1 gene expression product or the methylation change in the promoter region of the TCN1 gene.
4. Use according to claim 1, characterized in that, The product comprises PCR amplification reagents and PCR primers for detecting the expression level of the TCN1 gene, wherein the nucleotide sequence of the upstream primer of the PCR primers is shown as SEQ ID NO. 3, and the nucleotide sequence of the downstream primer of the PCR primers is shown as SEQ ID NO.
4.
5. The use according to claim 1, characterized in that, The autoimmune system disease is psoriasis or pemphigus.
6. Use according to claim 1, characterized in that, The sample detected by the product is skin tissue or blood.
7. A medicament for preventing or treating an autoimmune system disease, characterized by, The drug comprises a preparation for inhibiting the expression level of the TCN1 gene, a preparation for inhibiting the activity of the TCN1 gene expression product or a preparation for promoting the methylation of the TCN1 gene promoter DNA, wherein the nucleotide sequence of the TCN1 gene is shown as SEQ ID NO.
1.
8. The medicament according to claim 7, characterized in that, The drug comprises any one of the preparations in (1) to (4): (1) siRNA, shRNA or miRNA targeting TCN1; (2) a monoclonal antibody, a polyclonal antibody or an antibody fragment specifically binding to TCN1; (3) a DNA methyltransferase activator capable of restoring the methylation level of the TCN1 gene promoter; (4) a small molecule compound capable of inhibiting the interaction between TCN1 and HLA-DRB1 or blocking the activation of the IL-17 signaling pathway mediated by TCN1.
9. The medicament according to claim 7, characterized in that, The drug further comprises a pharmaceutically acceptable carrier, which is a diluent, an excipient or a stabilizer.
Citation Information
Patent Citations
Improvements in Free Wheel Devices.
GB112105A
Improvements relating to Driving and Reversing Mechanism for Planing and like Machines.
GB115523A