Alkaline protease mutant aprbcpm and application thereof

Abstract

The application belongs to the technical field of enzyme engineering and feed processing, and particularly relates to a basic protease mutant AprBcpM and application thereof. The application first takes basic protease BCP as a starting template, increases a disulfide bond in a flexible region of the three-dimensional structure of BCP, and obtains the mutant AprBcpM with improved thermal stability. Compared with the starting template BCP, the residual enzyme activity of the mutant AprBcpM after heat treatment at 55 DEG C, 60 DEG C and 65 DEG C for 30 minutes is 3.58 times, 6.26 times and 8.09 times that of the starting template BCP, respectively. In addition, after enzymolysis reaction of the mutant AprBcpM at 50 DEG C for 120 minutes, the acid-soluble protein content produced by hydrolysis of cottonseed protein is 48.9%, which is 2.27 times that of the starting template BCP. Therefore, the prepared protease mutant has good thermal stability and high enzyme activity, and can be used for preparing a cottonseed protein enzymolysis product.

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering and feed processing technology, specifically relating to an alkaline protease mutant AprBcpM and its applications. Background Technology

[0002] In recent years, with the rapid development of aquaculture, the total volume of aquaculture has been increasing year by year, leading to a growing demand for fishmeal. However, affected by the gradual deterioration of the marine environment, fishmeal production has been declining, resulting in a supply shortage and high prices. Therefore, finding suitable protein sources to replace fishmeal has become a research hotspot in the industry. Cottonseed protein, a byproduct extracted from cottonseed oil, has great potential as a protein source for aquaculture feed due to its advantages such as high protein content, large yield, and low cost. However, because cottonseed protein has a relatively large average molecular weight, if used directly as a feed substitute for fishmeal without processing, it can easily lead to reduced protein utilization and growth rate.

[0003] Therefore, pre-decomposing large protein molecules into small peptides and free amino acids through cottonseed protein processing plays an important role in expanding the application range of cottonseed protein. Summary of the Invention

[0004] Based on this, the present invention provides a protease mutant AprBcpM, which breaks down cottonseed protein macromolecules into smaller molecules through enzymatic hydrolysis, enabling cottonseed protein to replace fishmeal and expanding the application range of cottonseed protein.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] An alkaline protease mutant, AprBcpM, has the amino acid sequence shown in SEQ ID NO.1.

[0007] Furthermore, the amino acid sequence is encoded by a polynucleotide sequence, as shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression vector pHY17-AprBcpM, comprising the polynucleotide sequence of the alkaline protease mutant AprBcpM.

[0009] The present invention also provides a recombinant engineered bacterium, comprising the recombinant expression vector pHY17-AprBcpM.

[0010] Preferably, the recombinant engineered bacteria uses Bacillus subtilis as the host.

[0011] More preferably, the Bacillus subtilis is Bacillus subtilis 1285.

[0012] The present invention also provides an application of the alkaline protease mutant AprBcpM in the preparation of cottonseed protease hydrolysate products.

[0013] The present invention also provides the application of the recombinant engineered bacteria described above in the preparation of the high enzyme specific activity mutant AprBcpM.

[0014] In previous studies, our research team obtained an alkaline protease BCP (Chen H, Wu J, Huang X, Feng X, Ji H, Zhao L and Wang J (2022) Overexpression of Bacillus circulansalkaline protease in Bacillus subtilis and its potential application for recovery of protein from soybean dregs. Front. Microbiol. 13:968439). This protease exhibits high hydrolysis efficiency for cottonseed protein, but its thermal stability is poor. After heat treatment at 50℃ for 30 minutes, the remaining enzyme activity is only 32.3%, which seriously affects its application in the enzymatic hydrolysis of cottonseed protein. Therefore, improving the thermal stability of alkaline protease BCP can effectively ensure its stability under high-temperature conditions, thereby improving its enzymatic hydrolysis efficiency and laying the foundation for the application of cottonseed protein as a substitute for fishmeal in aquaculture.

[0015] This invention improves the thermal stability of alkaline protease BCP by directionally adding disulfide bonds to the flexible region of the three-dimensional conformation of BCP, thereby enhancing its rigidity. In addition, the hydrolytic effects of alkaline protease and its mutant AprBcpM on cottonseed protein were compared and evaluated.

[0016] Compared with the prior art, the technical advantages of the present invention are as follows:

[0017] (1) The present invention obtains the mutant AprBcpM by rationally designing disulfide bonds. Its residual enzyme activity after heat treatment at 55℃, 60℃ and 65℃ for 30 minutes is 3.58 times, 6.26 times and 8.09 times that of the starting template BCP, respectively.

[0018] (2) By comparing the hydrolysis effects of BCP and mutant AprBcpM on cottonseed protein, this invention found that mutant AprBcpM has a better hydrolysis effect. After 120 minutes of enzymatic hydrolysis at 50°C, the acid-soluble protein content of the cottonseed protein sample hydrolyzed by mutant AprBcpM reached 48.9%, which is 2.27 times that of the starting template BCP. Attached Figure Description

[0019] Figure 1 Three-dimensional conformation diagrams of alkaline protease BCP and its mutant AprBcpM;

[0020] Figure 2 Enzyme production curve of a 7-liter fermenter containing recombinant Bacillus subtilis;

[0021] Figure 3 The optimal reaction temperature results for alkaline protease BCP and its mutant AprBcpM are shown in the figure.

[0022] Figure 4 The graph shows the thermostability results of alkaline protease BCP and its mutant AprBcpM.

[0023] Figure 5 Figure showing the content of acid-soluble protein in cottonseed protein hydrolyzed by alkaline protease BCP and its mutant AprBcpM. Detailed Implementation

[0024] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments.

[0025] Unless otherwise specified, the molecular biology experimental methods described in the following examples were performed in accordance with the specific methods listed in J. Sambrook's "Molecular Cloning: A Laboratory Manual" (3rd Edition), or according to the kit and product instructions; the reagents and biological materials mentioned are commercially available unless otherwise specified.

[0026] The experimental materials and reagents involved in this invention are as follows:

[0027] 1. Strains and vectors

[0028] The Escherichia coli strain Top10 was purchased from Tiangen Biotech (Beijing) Co., Ltd., and the Bacillus subtilis 1285 was purchased from Baori Biotechnology (Beijing) Co., Ltd.

[0029] The expression vector pHY17-bcp was constructed in previous experiments (Chen H, Wu J, Huang X, Feng X, JiH, Zhao L and Wang J (2022) Overexpression of Bacillus circulans alkalineprotease in Bacillus subtilis and its potential application for recovery of protein from soybean dregs. Front. Microbiol. 13:968439).

[0030] The construction process of the expression vector pHY17-bcp is as follows: First, the encoding gene bcp for the alkaline protease BCP was obtained from Bacillus circulans through gene cloning; second, the bcp gene was ligated into the vector pHY17 using a seamless cloning method to obtain the expression vector pHY17-bcp. The sequence of the expression vector pHY17-bcp is as follows: the wavy line region below the sequence is the promoter sequence, the straight line region is the signal peptide sequence, and the dashed line region is the alkaline protease bcp gene sequence.

[0031] CGGGAGACGGAAAAATCGTCTTAATGCACGATATTTATGCAACGTTCGCAGATGCTGCTGAAGAGATTATTAAAAAGCTGAAAGCAAAAGGCTATCAATTGGTAACTGTATCTCAGCTTGAAGAAGTG AAGAAGCAGAGAGGCTATTGAATAAATGAGTAGAAGCGCCATATCGGCGCTTTTCTTTTGGAAGAAAATATAGGGAAAATGGTACTTGTTAAAAATTCGGAATATTTATACAATATCATATGTTACACA CGTTCTTTTCTGTATGAAAATAGTTATTTCGAGTCTCTA CGGAAATAGCGAGAGATGATATACCTAAATAGAGATAAAATCATCTCAAAAAAATGGGTCTACTAAAATATTATTC CATCTATTACAATAAATTCACAGAATAGTCTTTTAAGTAAGTCTACTCTGAATTTTTTTAAAAGGAGAGGGTAAAG ATCGAAACGTAAGATGAAACCTTAGATAAAAGTGCTTTTTTTGTTGCAATTGAAGAATTATTAATGTTAAGCTTAA TTAAAGATAATATCTTTGAATTGTAACGCCCCTCAAAAGTAAGAACTACAAAAAAAGAATACGTTATATAGAAATA TGTTTGAACCTTCTTCAGATTACAAATATATTCGGACGGACTCTACCTCAAATGCTTATCTAACTATAGAATGACA TACAAGCACAACCTTGAAAATTTGAAAATATAACTACCAATGAACTTGTTCATGTGAATTATCGCTTTATTTAATT TTCTCAATTCAATATATAATATGCCAATACATTGTTACAAGTAGAAATTAAGACACCCTTGATAGCCTTACTATAC CTAACATGATGTAGTATTAAATGAATATGTAAATATATTTATGATAAGAAGCGACTTATTTATAATCATTACATAT TTTTCTATTGGAATGATTAAGATTCCAATAGAATAGTGTATAAATTATTTATCTTGAAAGGAGGGATGCCTAAAAA CGAAGAACATTAAAAACATATATTTGCACCGTCTAATGGATTTATGAAAAATCATTTTATCAGTTTGAAAATTATG TATTATGAAAAGTGAGGAGGGAACCGAATGTTGATCAACAAAAGCAAAAAGTTTTTCGTTTTTTCTTTCATTTTTG TTATGATGCTGAGCCTCTCATTTGTGAATGGGGAAGTTGCAAAAGCC GCGCAATCAGTGCCATGGGGAATTAGCC GTGTGCAAGCCCCAGCTGCCCATAACCGTGGATTGACAGGTTCTGGTGAAAAAGTTGCTGTCCTCGATACAGGTAT TTCCACTCATCCAGACTTAAATATTCGTGGTGGCGCTAGCTTTGTACCAGGGGCACCATCCACTCAAGATGGGAAT GGGCATGGCACGCATGTGGCCGGGACGATTGCTGCTTTAAACAATTCGATTGGCGTTCTTGGCGTAGCGCCGAGTG CGGAACTATACGCTGTTAATGTTTTAGGAGCCGACGGGAGAGGTGCAATCAGCTCGATTGCCCATGGGTTGGAATG GACAGGGAACAATAACATGCACGTTGCTAATTTAAGTTTAGGAAGCCCTTCGCCAAGTGCCACACTTGAGCAAGCT GTTAATAGCGCGACTTCTAGAGGCGTTCTTGTTGTAGCGGCATCTGGGAATTCAGGTGCAAGCTCAATCAGCTATC CGGCCCGTTATGCGAACGCAATGGCAGTCGGAGCTACTGACCAAAACAACAACCGCGCCAGCTTTTCACAGTATGGCGCAGGGCTTGACATTGTCGCACCAGGGGTAGGCGTGCAGAGCTCATACCCAGGTTCAACGTATGCCAGCTTAAAC GGTACATCGATGGCTACTCCTCATGTTGCAGGTGTCGCAGCCCTTGTTAAACACAAGAACCCATCTTGGTCCAATA CACAAATCCGCAACCATCTAGAGAATACGGCAACGAGCTTAGGAAGCACGAACTTGTATGTAAGCGGACTTGTCAA AGCAGAAGCGGCAACACGCTAA

[0032] 2. Enzymes and Kits

[0033] The Q5 high-fidelity Taq enzyme MIX was purchased from NEB; the plasmid extraction kit (#DP103-03) and gel purification kit (#DP209-02) were purchased from Tiangen Biotech (Beijing) Co., Ltd.; the Taq enzyme MIX (EmeraldAmp® MAXPCR Master Mix) was purchased from Baori Biotech (Beijing) Co., Ltd.; and the kanamycin and ampicillin were purchased from Maclean's Reagent Company.

[0034] 3. Culture medium

[0035] The culture medium for *E. coli* was LB medium (1% (w / v) peptone, 0.5% (w / v) yeast extract, 1% (w / v) NaCl, pH 7.0). LBK was LB medium supplemented with kanamycin at a concentration of 30 μg / mL.

[0036] The shake-flask fermentation medium for Bacillus subtilis 1285 is maltose medium, and its composition is as follows: maltose 4%, peptone 1.5%, yeast extract 2.5%, dipotassium hydrogen phosphate 1%, sodium citrate 1%, and calcium chloride 0.3%.

[0037] The high-density fermentation medium has the following components: maltose 7%, wheat bran 2%, yeast powder 1.5%, dipotassium hydrogen phosphate 1%, trisodium citrate 0.3%, and calcium chloride 0.3%.

[0038] Example 1: Rational design of disulfide bonds in alkaline protease BCP and construction of expression vector

[0039] Before performing rational design of disulfide bonds, it is necessary to obtain the three-dimensional conformation of the alkaline protease BCP protein. Homology modeling was performed using the online software SWISS-MODEL (https: / / swissmodel.expasy.org / ) to obtain the three-dimensional structure of the alkaline protease BCP. Figure 1 (A)). The obtained three-dimensional structure of the alkaline protease BCP was uploaded to the online software SAVES v6.1 (https: / / saves.mbi.ucla.edu / ) for conformational evaluation. The evaluation results showed that 95.8% of the amino acids were located in the optimal region and 4.2% of the amino acids were located in other allowed regions, indicating that the obtained model conformation was correct.

[0040] Then, the alkaline protease BCP was analyzed using the molecular dynamics simulation software Gromacs 2019.06 (https: / / www.gromacs.org / ). During the simulation, the protein was subjected to an amber_ff14SB force field, and the small molecule ligand was subjected to a GAFF force field. The GAFF force field used a RESP potential, which was fitted using Multiwfn 3.6 software in conjunction with Gaussian 16.0 software. The protein / ligand model was placed in a cubic box, with a minimum distance of 1.2 nm between the protein and the box. The box was filled with TIP3P water. The steepest descent method was used to minimize the system energy, and molecular dynamics simulations were performed at 50 ns intervals with a simulation step size of 2 fs, storing data every 10 ps.

[0041] Molecular dynamics simulations indicate that the three-dimensional conformation of BCP possesses several flexible regions: such as the region from glycine at position 20 to lysine at position 27; the region from glycine at position 34 to glycine at position 46; the region from proline at position 51 to histidine at position 62; the region from threonine at position 69 to glycine at position 81; the region from asparagine at position 92 to isoleucine at position 102; the region from asparagine at position 121 to alanine at position 131; and the region from valine at position 148 to tyrosine at position 161. Therefore, increasing the rigidity of these flexible regions in the three-dimensional conformation of BCP would be beneficial for improving its thermal stability.

[0042] This invention enhances the thermal stability of the alkaline protease BCP by directionally designing disulfide bonds in these flexible regions, thereby increasing the rigidity of these conformational regions. Potential disulfide bonds in the BCP were predicted using the online software Disulfide by Design 2.0 (http: / / cptweb.cpt.wayne.edu / DbD2 / index.php). Based on the prediction results from Disulfide by Design 2.0 and molecular dynamics simulations, 10 potential disulfide bond mutants were selected for experiments. These 10 mutants are T22C-S85C, S36C-D58C, D40C-G78C, T56C-A90C, A72C-G81C, I77C-G78C, V93C-G108C, N121C-A222C, S151C-I159C, and G152C-Q185C.

[0043] Primers were designed based on the sequence information of the ten disulfide bonds to construct the corresponding disulfide bond mutants. The construction process of the ten disulfide bond mutants is as follows:

[0044] (Taking the mutant T22C-S85C as an example, others are similar): Using the vector pHY17-bcp as a template, PCR amplification was first performed using upstream and downstream primers T22C-fw and T22C-rev. The PCR reaction system is shown in Table 1 below. The PCR amplification conditions were: 98℃ pre-denaturation for 20s; 98℃ denaturation for 10s, 56℃ annealing for 20s, 72℃ extension for 50s, 33 amplification cycles, and a final extension at 72℃ for 5min.

[0045] The PCR amplification results were detected by agarose gel electrophoresis, and the target PCR product was purified and recovered. The PCR product recovery process is roughly as follows: (1) the target product was cut into a gel and placed into a 2mL centrifuge tube; (2) the sol solution was added and reacted at 60℃ for 10min; (3) the sol solution from the second step was added to a collection tube and centrifuged at 10000rpm for 1min; (4) the product was washed twice with 75% ethanol and then air-dried; (5) 50μL of water was added and centrifuged for 3min.

[0046] The presence of the template plasmid pHY17-bcp can lead to false positives during transformation and colony PCR; therefore, the template plasmid pHY17-bcp needs to be removed. The purified PCR product is then digested with the restriction endonuclease DpnI.

[0047] The enzymatically digested product was transformed into *E. coli* Top10 using the heat shock method. The recombinant transformants were verified by culture PCR. The specific steps for culture PCR verification were as follows: a single colony was picked with an autoclaved toothpick and incubated in 500 μL of LBK medium at 37°C and 200 rpm for 4 h; 2 μL of the culture was used as the PCR template. The PCR reaction system is shown in Table 2. The primers used for culture PCR were bcp-fw (GACAGGTTCTGGTGAAAAAG) and bcp-rev (CGCTTACATACAAGTTCGTG).

[0048] ); The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 60 s, 33 cycles, and a final extension at 72℃ for 5 min.

[0049] The PCR amplification results of the bacterial culture were observed by agarose gel electrophoresis. Transformant plasmids that were correctly verified by PCR were extracted and subjected to gene sequencing. Finally, the vector pHY17-bcp-T22C corresponding to the mutant T22C was obtained.

[0050] Using the same method, the vector pHY17-bcp-t22c corresponding to the T22C mutant was used as a template. PCR amplification was performed with primers S85C-fw and S85C-rev. The amplified vector was purified and transformed into E. coli Top10. Plasmids were extracted using the plasmid extraction kit (#DP103-03) from Tiangen Biotech (Beijing) Co., Ltd., and sequenced to finally obtain the expression vector pHY17-bcp-T22C-S85C corresponding to the T22C-S85C mutant.

[0051] Using the same method, the expression vectors corresponding to the remaining 9 pairs of disulfide bonds were obtained as follows: pHY17-bcp-S36C-D58C (corresponding to the mutant S36C-D58C, with corresponding primers S36C-fw, S36C-rev, D58C-fw, and D58C-rev), pHY17-bcp-D40C-G78C (corresponding to the mutant D40C-G78C, with corresponding primers D40C-fw, D40C-rev, G78C-fw, and G78C-rev), p... HY17-bcp-T56C-A90C (corresponding to the mutant T56C-A90C, with corresponding primers T56C-fw, T56C-rev, A90C-fw, A90C-rev), pHY17-bcp-A72C-G81C (corresponding to the mutant A72C-G81C, with corresponding primers A72C-fw, A72C-rev, G81C-fw, G81C-rev), pHY17-bcp-I77C-G78C (corresponding to the mutant I77C-G78) C, corresponding primers are I77C-G78C-fw, I77C-G78C-rev); pHY17-bcp-V93C-G108C (corresponding to the mutant V93C-G108C, corresponding primers are V93C-fw, V93C-rev, G108C-fw, G108C-rev); pHY17-bcp-N121C-A222C (corresponding to the mutant N121C-A222C, corresponding primers are N121C-fw, N121C-rev, A222). C-fw, A222C-rev), pHY17-bcp-S151C-I159C (corresponding to the mutant S151C-I159C, with corresponding primers S151C-fw, S151C-rev, I159C-fw, I159C-rev) and pHY17-bcp-G152C-Q185C (corresponding to the mutant G152C-Q185C, with corresponding primers G152C-fw, G152C-rev, Q185C-fw, Q185C-rev).

[0052] Table 1 PCR reaction system

[0053]

[0054] Table 2. Bacterial PCR Reaction System

[0055]

[0056] Example 2 Construction of recombinant Bacillus subtilis with disulfide bond mutant

[0057] The expression vectors corresponding to the 10 disulfide mutants obtained in Example 1 were transformed into Bacillus subtilis 1285 ZHO. The construction process of recombinant Bacillus subtilis mainly included two experimental steps: preparation of competent Bacillus subtilis 1285 cells and electroporation.

[0058] The preparation process of Bacillus subtilis 1285 competent cells is roughly as follows: (1) Pick a single colony (2~3 mm in diameter) from a plate cultured at 37℃ for 18 hours, transfer it to a 50 mL centrifuge tube containing 5 mL LB medium, and shake it vigorously overnight at 37℃; (2) Inoculate it into 50 mL GM (LB + 0.5 M sorbitol) medium with an inoculation amount of 1%, measure the OD value in the shaking tube, and control the inoculation amount so that the OD of the medium after inoculation is between 0.19 and 0.2. (2) Incubate at 37℃ and 200rpm until OD600 = 0.8~1.0 (about 3-4 hours); (3) Take all the bacterial culture and incubate in an ice water bath for 10 min, then centrifuge at 5000rpm, 8 min, and 4℃ to collect the bacterial cells; (4) Wash the bacterial cells with 30mL of pre-cooled electroporation buffer ETM (0.5M sorbitol, 0.5M mannitol, 10% glycerol, 0.5M trehalose can be added to improve efficiency), centrifuge at 5000rpm, 8 min, and 4℃ to remove the supernatant, and repeat this washing process 3 times; (5) Resuspend the washed bacterial cells in 500μL of ETM, and dispense 100μL into each tube;

[0059] The transformation process is roughly as follows: (1) Add 5 μL of different disulfide mutant expression vectors to 100 μL of competent cells (i.e., the bacterial suspension collected above), incubate on ice for 10 min, add to a pre-cooled electroporation cuvette (1 mm), and electroporate once. Electroporator settings: 1.8 kV, 25 μF, 200 Ω, 1 mm, electroporation once (duration between 4.5 ms and 5 ms); (2) After electroporation, immediately add 0.5 mL of recovery medium RM (LB + 0.5 M sorbitol + 0.38 M mannitol), 37℃, 120 rpm, after recovery for 3 h, spread the transformant on LBK solid plates, and culture overnight at 37℃ to obtain Bacillus subtilis recombinant transformants.

[0060] Example 3 Screening of disulfide bond mutants

[0061] Using toothpicks, each recombinant Bacillus subtilis transformant corresponding to a disulfide mutant was individually transferred to a 24-well plate containing 1.6 mL of maltose medium per well. After incubation at 37°C and 200 rpm for 24 hours, the supernatant was collected by centrifugation for enzyme activity determination. For each disulfide mutant, the recombinant engineered strain with the highest enzyme activity was selected for shake-flask culture. Shake-flask culture was conducted in 250 mL Erlenmeyer flasks. First, the corresponding recombinant engineered strain was inoculated into a 50 mL centrifuge tube containing 5 mL of maltose medium and incubated at 30°C and 220 rpm for approximately 24 hours. Then, the cultured recombinant Bacillus subtilis engineered strain was inoculated at a rate of 1% (v / v) into a 250 mL Erlenmeyer flask containing 50 mL of maltose medium. Shake-flask culture conditions were 37°C and 200 rpm for 48 hours. Samples were then collected for activity determination and thermostability testing.

[0062] The alkaline protease activity was determined according to the national standard GB / T 23527-2009. One unit of enzyme activity, denoted as U, is defined as 1 μg of tyrosine produced per minute from the hydrolysis of casein.

[0063] The thermal stability test method is as follows: the culture supernatant enzyme solution was diluted 5 times, and the diluted enzyme solution was incubated in a water bath at 50℃, 55℃ and 60℃ for 30 min respectively before the residual enzyme activity was measured. The sample without heat treatment was used as a control. The enzyme activity and preliminary thermal stability of the original BCP and disulfide bond mutant recombinant bacteria after 24 h of shake-flask culture are shown in Table 3.

[0064] As shown in Table 3, among the 10 disulfide bond mutants, only the mutants T22C-S85C and D40C-G78C can improve the thermal stability of BCP.

[0065] After incubation in a 50℃ water bath for 30 minutes, the remaining enzyme activities of mutants T22C-S85C and D40C-G78C were 65.2% and 51.8%, respectively, which were 2.02 times and 1.61 times that of the starting template BCP (32.3%).

[0066] After incubation in a 55℃ water bath for 30 minutes, the remaining enzyme activities of mutants T22C-S85C and D40C-G78C were 29.9% and 24.1%, respectively, while the starting template BCP was only 11.5%.

[0067] After incubation in a 60℃ water bath for 30 minutes, the remaining enzyme activities of mutants T22C-S85C and D40C-G78C were 12.2% and 10.6%, respectively, which were 3.2 times and 2.7 times that of the starting template BCP (3.8%).

[0068] Table 3. Enzyme activity and thermal stability in shake flasks with different disulfide bonds

[0069]

[0070] Example 4 Construction and screening of disulfide bond combination mutants

[0071] Example 4 revealed that both the disulfide bond mutants T22C-S85C and D40C-G78C can enhance the thermal stability of the alkaline protease BCP. To obtain mutants with better thermal stability, we combined T22C-S85C and D40C-G78C to construct the disulfide bond combined mutant T22C-S85C-D40C-G78C.

[0072] The construction process of the combined disulfide bond mutant expression vector is the same as in Example 2, and is roughly as follows: (1) Using the expression vector pHY17-bcp-T22C-S85C as a template, PCR amplification was performed with primers D40C-fw and D40C-rev, and the PCR product was purified and recovered; (2) After purifying the PCR product by treating it with restriction endonuclease DpnI, it was transformed into Escherichia coli Top10; (3) Positive transformants were obtained by bacterial PCR verification, and the vector pHY17-bcp-T22C-S85C-D40 was obtained by sequencing verification. C; (4) Using the vector pHY17-bcp-T22C-S85C-D40C as a template, PCR amplification was performed with primers G78C-fw and G78C-rev. The product was purified and recovered. After purifying the PCR product with DpnI, it was transformed into Escherichia coli Top10. Positive transformants were obtained by bacterial PCR verification. Finally, the expression vector pHY17-bcp-T22C-S85C-D40C-G78C corresponding to the disulfide bond combination mutant T22C-S85C-D40C-G78C was obtained by sequencing.

[0073] The construction process of the disulfide bond combination mutant T22C-S85C-D40C-G78C recombinant Bacillus subtilis was the same as in Example 3. The expression vector pHY17-bcp-T22C-S85C-D40C-G78C was transformed into Bacillus subtilis 1285 by electroporation. The screening of recombinant transformants was the same as in Example 4. The screening of recombinant transformants and the determination of thermal stability were both carried out in accordance with Example 4, and finally, the recombinant engineered bacteria were obtained.

[0074] Experimental results showed that the disulfide bond combination mutant T22C-S85C-D40C-G78C could further improve thermal stability. After heat treatment at 50℃, 55℃ and 60℃ for 30 minutes, the remaining enzyme activities were 89.3%, 41.2% and 23.8%, respectively, which were 2.76 times, 3.58 times and 6.26 times that of the starting template BCP.

[0075] For ease of writing, T22C-S85C-D40C-G78C is abbreviated as AprBcpM, and its corresponding expression vector pHY17-bcp-T22C-S85C-D40C-G78C is abbreviated as pHY17-aprbcpm. Its three-dimensional conformation is as follows: Figure 1 As shown in (B) in the diagram.

[0076] Example 5: Efficient preparation of the mutant AprBcpM

[0077] The mutant AprBcpM was efficiently prepared using a 7L fermenter. The specific experimental procedure is as follows: A single colony of the recombinant engineered bacteria from Example 4 was picked and inoculated into a 250mL Erlenmeyer flask containing 50mL of maltose medium, and cultured overnight at 30°C with shaking at 200rpm. The recombinant engineered bacteria cultured overnight was then inoculated into a 500mL Erlenmeyer flask containing 100mL of maltose medium at a 1% (v / v) inoculation rate, and cultured overnight at 37°C with shaking at 200rpm. The recombinant engineered bacteria cultured overnight for the second time was then inoculated into a 7L fermenter containing 3L of high-density fermentation medium at a 10% (v / v) inoculation rate.

[0078] The culture conditions of the recombinant engineered bacteria in a 7L fermenter were optimized. First, the fermentation temperature was optimized, set at 33℃, 35℃, 37℃, and 39℃, with the pH controlled at 6.0 and the stirring speed at 500 rpm. Figure 2 As shown in (A), the best results are achieved when the fermentation temperature is 37℃, with the fermentation enzyme activity reaching 21230 U / mL.

[0079] The culture pH was optimized based on the optimal culture temperature. During the culture process, the fermentation temperature was 37℃, the stirring speed was 400 rpm, and the pH was set to 6, 6.5, 7, and 7.5, respectively. Figure 2 As shown in (B), the fermentation effect is best when the fermentation pH is 6.5, and the fermentation enzyme activity reaches 28795 U / mL.

[0080] Example 6: Temperature Characteristics Measurement of Mutant AprBcpM

[0081] The temperature characteristics of the disulfide bond combination mutant AprBcpM were determined, with the starting template BCP serving as a control throughout the experiment.

[0082] The method for determining the optimal reaction temperature is roughly as follows: The enzyme activities of BCP and the mutant AprBcpM were measured at 45℃, 50℃, 55℃, 60℃, 65℃, and 70℃, respectively. The enzyme activity at the highest temperature was taken as 100%, and the relative enzyme activities at other temperatures were calculated. The experimental results are as follows: Figure 3 As shown.

[0083] Depend on Figure 3It can be seen that the starting template BCP and the mutant AprBcpM exhibit different optimal reaction temperatures. The optimal reaction temperature for the starting template BCP is 60℃, while that for the mutant AprBcpM is 65℃. Furthermore, the mutant AprBcpM exhibits better activity at higher temperatures, with a relative enzyme activity of 42.5% at 70℃, while the relative enzyme activity of the starting template AprBcpM at 70℃ is only 15.3%.

[0084] The method for determining thermal stability is roughly as follows: After incubating in a water bath at 45℃, 50℃, 55℃, 60℃, and 65℃ for 30 minutes, the residual enzyme activity is measured. The enzyme activity of the untreated sample is taken as 100%, and the relative residual enzyme activity at other temperatures is calculated. The experimental results are as follows: Figure 4 As shown.

[0085] Depend on Figure 4 It can be seen that when the heat treatment temperature is increased to 50℃, the thermal stability of BCP decreases sharply, and the remaining enzyme activity is 32.3%. Under the same treatment conditions, the remaining enzyme activity of the mutant AprBcpM is 89.3%. The residual enzyme activities of the mutant AprBcpM after heat treatment at 55℃, 60℃ and 65℃ for 30 minutes are 41.2%, 23.8% and 8.9%, respectively, which are 3.58 times, 6.26 times and 8.09 times that of the starting template BCP.

[0086] Example 7: Hydrolysis of cottonseed protein by alkaline protease BCP and mutant AprBcpM.

[0087] Enzymatic hydrolysis experiments were conducted using cottonseed protein as a substrate. The reaction system was as follows: 2g substrate, 100mL water, and 1mL enzyme solution (alkaline protease BCP or mutant AprBcpM). The mixture was combined in a 500mL shake flask and incubated at 50℃ and 180 rpm. Samples were taken every 30 minutes, with a total reaction time of 120 minutes. After the reaction was complete, the mixture was centrifuged, and the supernatant was used to determine the acid-soluble protein content. The acid-soluble protein determination method followed GB / T 22492-2008, and the experimental procedure is roughly as follows:

[0088] (1) Sample preparation: Accurately measure 1 mL of the supernatant after hydrolysis, dissolve it in 15% trichloroacetic acid solution and make up to 50 mL, mix well and let stand for 5 min, filter, remove the initial filtrate, and keep the filtrate for later use.

[0089] (2) Digestion in digestion tubes: Two parallel experiments were performed. Take 15.00 mL of filtrate and transfer it into a dry digestion tube. Add 6.4 g of mixed catalyst (composed of 6 g sodium sulfate and 0.4 g copper sulfate), then add 10 mL of sulfuric acid (or add 1 Kjeldahl nitrogen determination catalyst tablet and 8 mL of sulfuric acid). Digest in a digestion oven at 420 °C for 1 h. After digestion, remove the tube and cool it to room temperature.

[0090] (3) Distillation of ammonia: After the sample digestion solution has cooled, ensure that the amounts of distilled water, boric acid solution, sodium hydroxide solution and hydrochloric acid standard titration solution are sufficient for the distillation operation, and then turn on the fully automatic Kjeldahl nitrogen analyzer to conduct the experiment.

[0091] (4) Blank determination: Take 15 mL of 15% trichloroacetic acid solution (the specific volume of trichloroacetic acid taken is the same as the volume of filtrate taken) to replace the sample and perform blank determination according to experimental methods (2) and (3).

[0092] (5) Calculation: Calculate according to the following formula:

[0093]

[0094] In the formula:

[0095] m—sample mass (g);

[0096] c—Concentration of the hydrochloric acid standard titration solution (mol / L);

[0097] V1—The volume (mL) of hydrochloric acid standard titration solution consumed in titrating the sample;

[0098] V2—The volume (mL) of standard hydrochloric acid solution consumed in the titration of the blank;

[0099] V3 - Volume of filtrate taken (mL);

[0100] 14—Molar mass of nitrogen (g / mol);

[0101] 6.25 — Average coefficient for converting nitrogen to crude protein;

[0102] 50 - Fixed volume (mL).

[0103] In a fully automated nitrogen analyzer, the results of acid-soluble proteins can be directly measured without calculation, and the calculation results are retained to three significant figures.

[0104] The experimental results of alkaline protease BCP and mutant AprBcpM hydrolyzing cottonseed protein are as follows: Figure 5 As shown. By Figure 5It was found that in the first 30 minutes of enzymatic hydrolysis, the acid-soluble protein content of alkaline protease BCP and mutant AprBcpM was 15.3% and 25.6%, respectively. When the hydrolysis time increased to 60 minutes, the acid-soluble protein content of the sample corresponding to alkaline protease BCP increased to 20.1%, while that of the sample corresponding to mutant AprBcpM increased to 36.1%. As the reaction time increased to 90 minutes, the acid-soluble protein content of the sample corresponding to alkaline protease BCP hardly increased, while that of the sample corresponding to mutant AprBcpM increased to 42.1%. When the reaction time reached 120 minutes, the acid-soluble protein content of the sample corresponding to alkaline protease BCP was still only 20.5%, while that of the sample corresponding to mutant AprBcpM reached 48.9%, which is 2.27 times that of the starting template BCP.

Claims

1. An alkaline protease mutant, AprBcpM, characterized in that, The amino acid sequence of the alkaline protease mutant AprBcpM is shown in SEQ ID NO.

1.

2. A polynucleotide encoding the alkaline protease mutant AprBcpM of claim 1, characterized in that, The polynucleotide sequence is shown in SEQ ID NO.

2.

3. A recombinant expression vector pHY17-AprBcpM, characterized in that, Includes the polynucleotide described in claim 2.

4. A recombinant engineered bacterium, characterized in that, Includes the recombinant expression vector pHY17-AprBcpM as described in claim 3.

5. The recombinant engineered bacteria as described in claim 4, characterized in that, Using Bacillus subtilis as the host.

6. The recombinant engineered bacteria as described in claim 5, characterized in that, The Bacillus subtilis strain is Bacillus subtilis 1285.

7. The application of the alkaline protease mutant AprBcpM as described in claim 1 in the preparation of cottonseed protease hydrolysate products.

8. The use of the recombinant engineered bacteria as described in any one of claims 4 to 6 in the preparation of the alkaline protease mutant AprBcpM.

Images