Male sterility gene Zmuce4 and application thereof in creating maize male sterile line

Abstract

The application discloses a male sterility gene Zmuce4 and application thereof in creating a maize male sterile line, and belongs to the field of plant biotechnological breeding. The application proves that the gene has a regulating function on maize male reproductive development by causing abnormal pollen development and abortion and leading to complete male sterility through site-directed mutation of the gene in wild-type maize by CRISPR / Cas9 gene editing technology. Zmuce4 Through offspring screening, a sterile line without a transgenic component can be obtained, and a stable maize male sterile line is created, which has important significance for maize male fertility control and hybrid seed production. uce4 The application also designs a functional molecular marker for the obtained male sterility mutant gene, which has important application value in maize male sterile line breeding, sterile hybrid seed production and molecular marker assisted selection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant biotechnology breeding, and particularly relates to a male sterility gene ZmUCE4 and application thereof in creating a maize male sterile line. BACKGROUND

[0002] Maize is the first largest grain crop in China in terms of planting area and total yield, with an annual planting area of more than 600 million mu. Maize has multiple uses such as food, feed and industrial raw materials, and the healthy development of maize seed industry has a great strategic significance for ensuring national food security [1] . Maize is the earliest and most complete crop in which hybrid vigor is utilized, but the maize seed production industry is still in the labor-intensive stage mainly relying on manual detasseling, with high cost, huge resource consumption and difficult seed quality guarantee. Male sterile materials are used for hybrid seed production, which can save the cost of manual or mechanical detasseling, improve seed purity and yield, and have great industrial application value [2] .

[0003] Plant male sterility can be divided into genic male sterility (GMS) controlled by nuclear genes and cytoplasmic male sterility (CMS) regulated by nuclear and cytoplasmic genes. CMS lines have problems such as poor genetic diversity, single cytoplasm of sterile lines and susceptibility to diseases. GMS is controlled by nuclear genes alone, which can overcome these shortcomings. Therefore, it is particularly important to create more GMS lines and clone the corresponding GMS genes in production and application [3] [4] . Compared with model plants Arabidopsis and model crops rice, there are relatively few GMS genes cloned and identified and male sterile materials created in maize. CRISPR / Cas9 (Clustered, Regularly Interspaced, Short PalindromicRepeats-associated Endonuclease 9) gene editing technology has the characteristics of low cost, simple operation and high mutation induction rate, and is more and more widely used in plant gene function research, crop genetic improvement and breeding, and other aspects, and has a very broad application prospect. Using CRISPR / Cas9 technology to identify maize male sterility candidate genes and create male sterile materials can quickly enrich maize GMS gene and sterile material resources, and promote the popularization and application of maize sterile breeding and seed production. SUMMARY

[0004] In view of the deficiencies in the prior art, the purpose of the present application is to provide a male sterility gene ZmUCE4Its application in creating male-sterile maize lines can be used to create male-sterile maize lines, which can then be applied to maize hybridization breeding and seed production.

[0005] To achieve the above objectives, the present invention provides ZmUCE4 The application of a gene in controlling male reproductive development in maize is characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO.1 and the amino acid sequence of the gene is shown in SEQ ID NO.2.

[0006] On the other hand, the present invention also provides a method for creating male-sterile maize lines, characterized by inhibiting the growth of male-sterile maize in maize. ZmUCE4 Gene expression and / or activity were selected from male-sterile maize plants.

[0007] In some implementations, the methods for inhibiting gene expression and / or activity include any one of gene editing, RNA interference, and T-DNA insertion.

[0008] In some implementations, the gene editing described above uses the CRISPR / Cas9 method.

[0009] In some embodiments, the CRISPR / Cas9 method includes: designing a CRISPR / Cas9 vector target (MT) at the fourth exon of the ZmUCE4 gene, the DNA sequence of which is shown in SEQ ID NO.3.

[0010] On the other hand, the present invention also provides a way to obtain uce4 The method for obtaining male-sterile lines will be achieved through the methods described above. uce4 Male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. uce4 Male infertility traits and gene mutations.

[0011] The present invention also includes those obtained by any of the above methods. uce4 The application of sterile lines in hybridization breeding and seed production. The application in hybridization breeding and seed production refers to... uce4 The sterile line is used as the maternal parent in crosses with other paternal parents, or the resulting sterile line is used as the paternal parent in crosses. uce4 Male-sterile lines are hybridized and backcrossed with other target materials to obtain the desired results. uce4 Male infertility traits and gene mutations.

[0012] Furthermore, this invention also provides two male-sterile maize lines. uce4The molecular marker primers, the sequences of primers ZmUCE4-F1 and ZmUCE4-R1 are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively; the sequences of primers ZmUCE4-F2 and ZmUCE4-R2 are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0013] The advantages and beneficial effects of this invention are as follows: ZmUCE4 ( Zm00001eb066940 The regulation of male reproductive development in maize by the gene and its encoded protein is previously unreported. This invention utilizes the CRISPR / Cas9 method to mutate the maize gene. ZmUCE4 ( Zm00001eb066940 ), discovered ZmUCE4 ( Zm00001eb066940 The gene's regulatory function on maize tassel development. Using CRISPR / Cas9 gene editing and the resulting male-sterile mutants, male-sterile lines in maize can be created, which can then be applied to maize hybrid breeding and seed production. (Targeting...) uce4 Cosegregating molecular markers developed for male-sterile lines can be used for identifying fertility alleles in plants, screening target plants in marker-assisted breeding, and identifying seed purity. Attached Figure Description

[0014] Figure 1 for ZmUCE4 Analysis of gene expression patterns in anthers at different developmental stages of maize

[0015] S5, sporogenous cell stage; S6, microsporocyte stage; S7, meiosis initiation stage; S8a, meiosis I, didic stage; S8b, meiosis II, tetrad stage; S8b-9, tetrad-monuclear microsporus stage; S9, mononuclear microsporus stage; S9-10, mononuclear microsporus-microsporus vacuolization stage; S10, microsporus vacuolization stage; S11, first unequal mitosis of microsporus, binuclear microsporus stage; S12, second mitosis of microsporus, trinuclear microsporus stage.

[0016] Figure 2 for pCas9-ZmUCE4 Physical map of site-directed mutagenesis expression vector

[0017] pCas9-ZmUCE4 From the left to the right boundary of the T-DNA are herbicide resistance genes. Bar Expression cassette; nuclease-encoding gene Cas9 The expression box; ZmUCE4 Expression cassettes of gene targets (MT).

[0018] Figure 3 Wild type ZmUCE4Gene structure and DNA sequence analysis of its sterile mutant

[0019] wild type ZmUCE4 (WT) - ZmUCE4 The gene is 2561 bp in length, consisting of 5 exons and 4 introns. uce4 mutant ZmUCE4-Cas9-1 Two bases are deleted between 1877 bp and 1878 bp in the fourth exon; uce4 mutant ZmUCE4 -Cas9-2 exist ZmUCE4 There is a deletion of 32 bases (AACAGTGGAGTCCTGCTTTAACTATCTCAAAG) in the fourth exon from 1877 bp to 1908 bp and a deletion of 1 base (G) in the fourth intron at 1909 bp.

[0020] Figure 4 Wild type and uce4 Phenotypic analysis of tassels, anthers, and pollen grains of homozygous mutants

[0021] The top row shows wild-type corn (WT) and ZmUCE4-Cas9-1 and Zm UCE4-Cas9-2 Phenotypic comparison of mutant male ears; second row shows WT and... ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 Phenotypic comparison of mutant anthers; bottom row: WT and... ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 Comparison of I2-KI staining of mutant pollen grains.

[0022] Figure 5 Wild type and uce4 Scanning electron microscopy (SEM) analysis of anthers of homozygous mutants

[0023] From left to right: Wild-type (WT) anthers as a whole; uce4 The anthers as a whole; the WT (top) after peeling and uce4 (Bottom) Anthers; mature pollen grains of WT (top) and uce4 Shriveled pollen grains (bottom); WT (top) and uce4 (Bottom) Cuticle of the anther's outer epidermis; WT (top) and uce4 (Below) Ustite of the inner epidermis of the anther.

[0024] Figure 6 To utilize co-separation markers ZmUCE4-Cas9-1 Genotyping of F2 generation plants from sterile lines

[0025] Six strains were isolated using the marker ZmUCE4-F1 / R1. ZmUCE4-Cas9-1 PCR and agarose gel electrophoresis results of F2 generation plants from the sterile line: a 73 bp band was amplified in homozygous wild-type (AA) plants;UCE4 / uce4 Two bands, 73 bp and 71 bp, were amplified in heterozygous (Aa) plants; uce4 / uce4 A 71 bp band was amplified in the homozygous mutant (aa) plant.

[0026] Figure 7 To utilize co-separation markers ZmUCE4-Cas9-2 Genotyping of F2 generation plants from sterile lines

[0027] Six strains were isolated using the marker ZmUCE4-F2 / R2. ZmUCE4-Cas9-2 PCR and agarose gel electrophoresis results of F2 generation plants from the sterile line: a 158 bp band was amplified in homozygous wild-type (AA) plants; UCE4 / uce4 Two bands, 158 bp and 125 bp, were amplified in heterozygous (Aa) plants; uce4 / uce4 A 125 bp band was amplified in the homozygous mutant (aa) plant. Detailed Implementation

[0028] The following embodiments are used to illustrate the present invention, but do not limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. Unless otherwise specified, the synthesis and sequencing of primers and genes used in the embodiments were performed by Beijing Ruiboxingke Biotechnology Co., Ltd. Other biochemical reagents, unless otherwise specified, are conventional commercially available reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0029] Example 1: Corn ZmUCE4 (Zm00001eb066940) Gene sequence and expression pattern analysis

[0030] The query for corn in the maizeGDB database (https: / / www.maizegdb.org / ) yielded results. ZmUCE4 ( Zm00001eb066940, Zm00001d001913 The gene, in B73, has the nucleic acid sequence shown in SEQ ID NO.1, and its function is labeled as ubiquitin conjugating enzyme 4. UCE4 The protein it encodes contains 148 amino acids, and its sequence is shown in SEQ ID NO.2.

[0031] Ubiquitin-binding enzymes play a crucial role in protein ubiquitination and are involved in the regulation of numerous physiological processes in plants. ZmUCE4There is no published research on the actual function of the gene in corn. In order to study the relationship between the gene and the development of male reproduction in corn, the present application first analyzes the expression pattern of the gene in different stages of anther development in corn by qRT-PCR. The specific steps are as follows:

[0032] 1. Sampling of corn anthers and identification of development stages

[0033] From the tassels of corn inbred line B73 at different development stages, different length anther samples were collected according to the length of the anthers; 20 fresh anthers of similar length were collected for each sample, 3 of which were fixed in FAA solution (Coolaber, China) to determine the specific development stage by resin semi-thin sectioning experiment, and the remaining 17 anthers were immediately frozen in liquid nitrogen for RNA extraction.

[0034] The fixed anthers for resin sectioning were dehydrated using gradient ethanol (50%, 70%, 90%, 100%) for 15-30 minutes each time. The anthers can be stored in 70% ethanol during dehydration; to facilitate embedding later, 0.1% eosin can be added to the 90% ethanol to stain the material; to ensure complete dehydration, the material must be dehydrated in anhydrous ethanol for 2-3 times. Then resin replacement is performed, the anthers are placed in ethanol and Spurr resin with a volume ratio of 3:1, 1:1, 1:3 for 2-4 hours, and finally placed in pure resin overnight. After the completion of resin replacement, the anthers are placed in the mold, 200 µL of Spurr resin is added, and the mold is placed in an oven at 70°C for polymerization overnight. Then trimming is performed, and then the German Leica microtome can be used for sectioning with a thickness of 2 µm; the cut sections are picked up with tweezers and placed in sterile water in the center of the slide, and then the sections are spread at 42°C overnight. The slide with the sample fixed on it is immersed in 0.1% toluidine blue staining solution for 1 minute, then rinsed with deionized water, and then placed on the spreading table and dried before being used for microscopic observation; it can also be mounted for long-term storage. The results of the resin sections are analyzed, and the specific development stage of each sample is determined according to the cytological characteristics of the 14 different development stages of corn (Stage 1-Stage 14: S1-S14).

[0035] 2. qRT-PCR analysis

[0036] The total RNA of the corn anthers identified at different development stages (S5-S12) is extracted using Trizol reagent (Invitrogen, USA); then 5X All-in-One RT Master Mix (ABM, Canada) is used to synthesize cDNA;

[0037] Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using TB Green™ PreMix Ex Taq™ (TaKaRa, Japan) on a QuantStudio5 Real-Time PCR System (ABI, USA). The amplification primers were:

[0038] qUCE4-F (SEQ ID NO.8): 5'-CACTGCTCACGGACCCAAAC-3';

[0039] qUCE4-R (SEQ ID NO.9): 5'-GCGGTGGACTCATACTTGGC-3';

[0040] ZmUBI2 As a reference gene, its amplification primers are:

[0041] UBI2-F (SEQ ID NO. 10): 5'-CGACAACGTGAAGGCGAAGA-3';

[0042] UBI2-R (SEQ ID NO. 11): 5'- ACGCAGATACCCAGGTACAGC -3';

[0043] Each developmental stage includes three biological replicates, and each sample has three technical replicates;

[0044] Data uses 2 -ΔΔCt The methods were analyzed, and the quantitative results are presented in the form of mean ± standard deviation (Means ± SD).

[0045] ZmUCE4 The gene exhibits a pattern of anther development-specific expression: higher expression in the early stage of maize anther development (S5), and moderate expression maintained in the middle and late stages of anther development. Figure 1 ).

[0046] Example 2: Corn ZmUCE4 ( Zm00001eb066940 The function of genes and the creation of male-sterile maize lines using CRISPR / Cas9.

[0047] To clarify corn ZmUCE4 (Zm00001eb066940) Regarding its function in maize, this invention employs CRISPR / Cas9 gene editing to mutate [the maize sample]. Zm00001eb066940 The gene sequence was determined to knock out the function of the gene in maize. In this invention, the maize inbred line B104 was selected as the recipient material for gene editing. The sequence shown in SEQ ID NO.3, representing a conserved region of the gene, was selected as the target region for CRISPR / Cas9 gene editing.

[0048] 1、ZmUCE4 Construction of CRISPR / Cas9 gene editing vector

[0049] The gene editing vector of the present application is pBUE411-MT1T2-Cas9 , the basic vector of the vector is pBUE411- Cas9 , the intermediate vector is pCBCmT1T2 , and the gRNA is provided. The present application designs the target on the primer, then obtains the MT-sgRNA through PCR, and then connects it to the basic vector through enzyme digestion, and the specific construction process is as follows:

[0050] (1) Design of target gRNA. The gene sequence of ZmUCE4 (Zm00001eb066940) is input into http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR for target design. The DNA sequence of the target region selected by the present application is shown as SEQ ID NO. 3. The sgRNA skeleton sequence of the present application is directly amplified from the intermediate vector pCBCmT1T2 .

[0051] (2) Obtain MT-sgRNA by designing target on primer and then PCR amplification. Primer ZmUCE4-MT-F and primer ZmUCE4-MT-R amplify the intermediate vector pCBCmT1T2 , which is used to obtain a fragment containing the target sgRNA, and the product length is 891bp. The PCR system and conditions are as follows: template DNA (intermediate vector pCBCmT1T2 ≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; Sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HM-200): 15 μL. The temperature program of PCR is as follows: ① 98 ℃ for 2 minutes; ② 98 ℃ for 10 seconds; ③ 58 ℃ for 30 seconds; ④ 72 ℃ for 30 seconds; ⑤ cycle 34 times from ②-④; ⑥ 72 ℃ for 5 minutes; ⑦ 25 ℃ for 10 minutes. Finally, the PCR product is recovered. The primer sequences required for vector construction are as follows:

[0052] ZmUCE4-MT-F (SEQ ID NO. 12): 5'-ATATATGGTCTCTGGCGaTGACATTCTTAAGGAACAGGTTTTAGAGCTAGAAATAGCAA-3'

[0053] ZmUCE4-MT-R (SEQ ID NO. 13): 5'-ATTATTGGTCTCTAAACCTGTTCCTTAAGAATGTCATGCTTCTTGGTGCCGC-3'

[0054] (3) Construct the backbone vector by enzyme digestion and ligation. pBUE411-Cas9 Vectors and recovered target-carrying sgRNA fragments are used BsaI Digestion was performed, and T4 ligase was added to ligate the vector and sgRNA fragment. The 15 μL restriction enzyme ligation system was as follows: sgRNA fragment: 2 μL, pBUE411-Cas9 vector (≥60 ng / μL): 2 μL, 10 x NEB Buffer: 1.5 μL. BsaI Endonuclease (product number: #R3733S): 1 μL, T4 ligase (product number: #M0202M): 1 μL, sterile ddH2O: 6 μL.

[0055] Figure 2 The target gene is shown. ZmUCE4 (Zm00001eb066940) Target, marker gene Cas9 and bar With skeleton carrier pBUE411-Cas9 Constructed expression carrier pCas9-ZmUCE4 .

[0056] 2. Agrobacterium-mediated genetic transformation of maize

[0057] The above-constructed pCas9-ZmUCE4The vector is transformed into Agrobacterium EHA105 by heat shock method, and PCR is used for identification; then the Agrobacterium containing the knockout vector is stored at -80 ℃ with glycerol. Freshly peeled 1.5 mm or so of maize inbred line B104 embryo as the recipient material, the peeled corn embryo is placed in a 2 mL plastic centrifuge tube containing 1.8 mL of suspension, the placement time is not more than 1 hour, about 100 embryos are placed in each centrifuge tube; the suspension is sucked off, and the embryos are washed with new suspension for 2 times, a small amount of suspension is reserved at the bottom of the tube which can cover the embryos, then heat shock at 43 ℃ for 2 minutes, followed by ice bath for 1 minute, use a pipette gun to suck the remaining wash, and add 1.0 mL of Agrobacterium infection solution, shake gently for 30 seconds, then stand in the dark for 8 minutes. Next, the embryos and infection solution in the centrifuge tube are poured onto the co-culture medium, shake well and use a pipette gun to suck out the excess infection solution, all the scutes of the embryos are upwards, and the co-culture is carried out at 23 ℃ in the dark for 3 days. After co-culture, the embryos are transferred to the recovery medium with sterile forceps, cultured at 28 ℃ for 7-14 days, and the young shoots growing on the embryos are removed in time during the process. After recovery culture, the embryos are placed on the screening medium containing 1.5 mg / L Bialaphos for 3 rounds of screening, 2 weeks for each round, and then transferred to the screening medium containing 2 mg / L Bialaphos for 2 rounds of screening, 2 weeks for each round. The resistant callus is transferred to the expansion medium and cultured at 28 ℃ in the dark for 2 weeks. Then the expanded resistant callus is transferred to the induction medium and cultured at 28 ℃ in the dark for 2 weeks. Then transfer to the differentiation medium, 25 ℃, 5000 lx, light culture for 2 weeks. After culture, the differentiated seedlings are separated into single seedlings and placed in the rooting medium, 25 ℃, 5000 lx, light culture until rooting; the seedlings are transferred to small pots for growth, and after growth and survival, they are transplanted to the greenhouse, and the offspring seeds are harvested after 3-4 months.

[0058] 3. T0 generation plant CRISPR / Cas9 mutation result detection

[0059] To determine the T0 generation plant CRISPR / Cas9 mutation results, the following steps are taken:

[0060] The application firstly extracts corn leaf DNA by CTAB method, and the specific method is as follows: cutting 2 cm long seedling leaves, putting into a 2 mL centrifuge tube containing steel balls; putting the centrifuge tube containing the leaves into liquid nitrogen for 5 minutes, and then crushing the leaf sample by using a grinder; adding 700 μL of CTAB extraction buffer (containing 1% β-mercaptoethanol) into the centrifuge tube, and mixing uniformly by shaking, preheating in a 65 ℃ constant temperature water bath for 20-30 min (during which, inverting 1-2 times is taken out, and attention is paid to the correspondence of the experimental sample number); after the centrifuge tube is cooled to room temperature, 700 μL of chloroform: isoamyl alcohol (24:1) extraction liquid is added, and after shaking for 30 s, standing for a moment at room temperature; centrifuging at 12000 rpm for 5 min at 4 ℃, and taking 500 μl of supernatant after centrifugation into a new 1.5 mL centrifuge tube; adding an equal volume of isopropyl alcohol into the centrifuge tube containing the supernatant, mixing uniformly by shaking, and standing for about 10 min at room temperature; then, the centrifuge tube containing the sample is placed into a 4 ℃ centrifuge, and centrifuged at 12000 rpm for 10 min, and then the supernatant is gently sucked and discarded, and the precipitate is reserved; adding 800 μL of 75% ethanol, washing the precipitate twice, centrifuging at 10000 rpm for 5 min, and discarding the supernatant; placing the sample at room temperature for natural drying for 2-4 hours, obtaining DNA precipitate, adding appropriate amount of sterile water to dissolve, and slightly shaking to dissolve the DNA. The DNA sample is stored at -20 ℃. The DNA concentration is detected by Nanodrop, and diluted to 10 ng / L for use as a PCR template.

[0061] Then according to ZmUCE4 (Zm00001eb066940) The PCR primers are designed according to the gene sequence.

[0062] The target to be detected is MT, the product size is 383 bp, and the primer sequences are as follows:

[0063] ZmUCE4-T-F (SEQ ID NO. 14): 5'-CGGATTACCCTTTCAAGCCAC-3';

[0064] Zm UCE4-T-R (SEQ ID NO. 15): 5'-TCCATCTCAATCCACCTTTGTTG-3'.

[0065] The genomic DNA is extracted, and amplified according to the following PCR parameters:

[0066] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x Taq mix (product number: 10103ES).

[0067] Reaction procedure: Conventional PCR: annealing at 58 ℃, extension for 1 minute, 32 cycles.

[0068] Next, the PCR products were recovered and ligated into a T vector for sequencing. By sequencing the DNA sequences of the target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing had occurred in the target regions. Ultimately, it was found that the target region sequences of two T0 transformation events had changed, and both were homozygous mutations. The sequences before and after editing are shown below. Figure 3 As shown, there are 2 corresponding ones. uce4 homozygous mutant: ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 Sequence alignment with wild type showed... ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 A deletion mutation occurred at the target site, and... ZmUCE4 Compared to the nucleotide sequence of the gene in SEQ ID NO.1, ZmUCE4-Cas9-1 exist ZmUCE4 Two bases are deleted at the 1877 bp-1878 bp site of the fourth exon; ZmUCE4 -Cas9-2 There is a deletion of 32 bases in the fourth exon from 1877 bp to 1908 bp, and a deletion of 1 G base in the fourth intron at 1909 bp.

[0069] For 2 uce4 Comparative analysis of amino acid sequences in homologous mutants revealed that, compared with the unedited WT, the mutant strains... ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 The deletion of nucleotides at the target site caused frameshift mutations in all amino acids, and subsequent amino acids all underwent premature termination. Therefore, the ZmUCE4 protein was functionally lost in these transformants.

[0070] 4. Genotyping of F1 generation plants

[0071] Because greenhouse-grown T0 generation maize plants often exhibit uncoordinated development of female and male ears, and because fertility is also affected when the edited gene is associated with male development, this invention uses wild-type pollen from the maize inbred line B104 as the genetic material for propagating T0 generation plants and ensuring the inheritance of the obtained gene-edited type. ZmUCE4-Cas9-1 and ZmUCE4- Cas9-2 The T0 generation plants are pollinated to obtain F1 generation seeds, and the resulting plants are F1 generation plants.

[0072] F1 generation plants include two types of separation, one is Cas9 - positive plants (transgenic plants), and the other is Cas9 - negative plants (non-transgenic plants), in order to avoid sgRNA and Cas9 to continuously edit the B104 wild type alleles introduced by hybrid pollination, thereby causing complexity of mutation types, we need to select plants without Cas9 gene but containing T0 generation mutation types from F1 generation plants by genotyping, and such plants can obtain non-transgenic F2 generation after selfing. The genotyping steps of F1 generation plants are as follows:

[0073] After extracting leaf DNA according to the above CTAB method, first, the specific primers Cas9-F and Cas9-R of Cas9 gene are used for PCR amplification.

[0074] Cas9-F (SEQ ID NO. 16): 5'- CCCGGACAATAGCGATGT-3';

[0075] Cas9-R (SEQ ID NO. 17): 5'- GAGTGGGCCGACGTAGTA-3';

[0076] The PCR reaction system is the same as above; the reaction program: conventional PCR: 58°C annealing, extension for 1 minute, 32 cycles. After agarose gel electrophoresis of the PCR product, the results are used to distinguish Cas9 - positive plants and Cas9 - negative plants.

[0077] Further, for Cas9 - negative plants, the primers ZmUCE4-T-F and ZmUCE4-T-R for detecting MT target are used for PCR amplification; after purification of the PCR product, it is connected to a T vector and sequenced; the genetic situation of T0 generation mutation types is analyzed and determined according to the sequencing results.

[0078] Example Three uce4 Phenotypic analysis of sterile lines

[0079] The F1 generation plants identified in the above example two without Cas9 gene are selfed to obtain F2 generation seeds, and two uce4 mutation types ( ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 ) are each taken for single ear selfing and ear row sowing, and the phenotype is investigated at the mature stage. The ratio of fertile plants to sterile plants in the three F2 lines all conforms to 3:1 separation, further indicating that uce4The sterility trait in the sterile line is controlled by a single recessive gene, and then stable non-transgenic lines are obtained by targeting the F2 generation. uce4 A detailed phenotypic comparison was conducted between the sterile line and the wild type.

[0080] 1. Observation of the viability of male spikes, anthers, and pollen.

[0081] In terms of vegetative growth and female ear development, uce4 Sterile line ( ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2 The plants of the wild type are basically no different from those of the wild type; in terms of male inflorescence development, the wild type can produce males normally, the anthers can dehisce and release pollen normally, and it can produce seeds normally after self-pollination, while... uce4 Although the sterile line can produce males normally, it cannot flower normally. The anthers and glumes are almost unable to dehisce, and the anthers are smaller and almost not exposed compared to the wild type. Figure 4 Further I2-KI staining of wild-type and mutant pollen revealed that wild-type pollen developed normally and turned black after staining, but mutant pollen could not fill with starch. Figure 4 This indicates that... ZmUCE4 (Zm00001eb066940) Genes control male development in maize, created through gene editing methods. uce4 The sterile line is characterized by pollen grain abortion and complete sterility.

[0082] 2. Scanning electron microscopy (SEM) observation of anthers

[0083] To analyze in depth uce4 The cytological characteristics of wild-type and mutant anthers were analyzed by scanning electron microscopy (SEM). Mature (S13) wild-type and mutant anthers were harvested and immediately fixed in FAA (Coolaber, China) solution, with the volume of the fixative not less than 20 times the volume of the studied material. For mutant anthers, perforations in the anther wall were made using a dissecting needle to improve fixative penetration, or repeated vacuuming was performed until the anthers sank to the bottom of the fixative. After fixation at room temperature for 2 hours, the material was stored at 4°C, or sequentially dehydrated in 50%, 60%, 70%, 80%, 90%, and 100% ethanol, maintaining each gradient for 15 minutes. The material could also be stored overnight in 70% ethanol. After dehydration, the samples were subjected to critical point carbon dioxide drying and then gold plating for observation. Findings... uce4 The cuticle of the anther epidermis and the Ubstein bodies of the inner epidermis of the mutant were not significantly different from those of the wild type. However, uce4 The mutant pollen grains are shriveled and lack starch filling. Figure 5 The above results indicate that... ZmUCE4 (Zm00001eb066940) Gene mutations can affect pollen starch filling, ultimately leading to pollen sterility.

[0084] Example 4uce4 Development and application of cosegregating molecular markers for the identification of sterile lines

[0085] 1. Development of co-separated molecular markers

[0086] In this invention, for the two obtained uce4 The mutation sites of the sterile lines were identified by primer design using Primer 5.0 software, and two pairs of co-segregating molecular markers, ZmUCE4-F1 / R1 and ZmUCE4-F2 / R2, were developed. The genotypes of the mutants were then isolated based on the obtained bands and their size by combining PCR with polyacrylamide gel electrophoresis (PAGE) and agarose gel electrophoresis.

[0087] The co-separating molecular marker ZmUCE4-F1 / R1 comprises a first primer ZmUCE4-F1 and a second primer ZmUCE4-R1; this marker can specifically detect maize. ZmUCE4-Cas9-1 Mutants and mutant genes in maize male-sterile materials derived from them uce4 And can distinguish between wild type at the same time. UCE4 Genes and mutants uce4 Genes; targeting mutated genes uce4 A 71 bp band was amplified in the middle, while in the wild type... UCE4 The gene amplified into a 73 bp band. The primer sequences are as follows:

[0088] ZmUCE4-F1 (SEQ ID NO.4): 5'-GCATTTGCCTTGACATTCTT-3';

[0089] ZmUCE4-R1 (SEQ ID NO. 5): 5'-CAATGTAGACAATTTACCTTTGAG-3'.

[0090] The co-separating molecular marker ZmUCE4-F2 / R2 comprises a first primer ZmUCE4-F2 and a second primer ZmUCE4-R2; this marker can specifically detect maize. ZmUCE4-Cas9-2 Mutants and mutant genes in maize male-sterile materials derived from them uce4 And can distinguish between wild type at the same time. UCE4 Genes and mutants uce4 Genes; targeting mutated genes uce4 A 125bp band was amplified in the middle, while in the wild type... UCE4 The gene was amplified into a 158 bp band. The primer sequences are as follows:

[0091] ZmUCE4-F2 (SEQ ID NO.6): 5'-GATATGCTTATCTGCAGGTGT-3';

[0092] ZmUCE4-R2 (SEQ ID NO. 7): 5'-CCAGAACTCACAATATAAACAATG-3'.

[0093] 2. Application of co-separated molecular markers

[0094] To verify the effectiveness of the above-mentioned markers, the F2 strain obtained in Example 3 was used as material for testing. uce4 Allele detection. The DNA extraction method, PCR amplification system and conditions were the same as in Example 2. The PCR products were separated by agarose gel electrophoresis.

[0095] Theoretically, ZmUCE4-F1 / R1 and ZmUCE4-F2 / R2 in UCE4 / UCE4 In homozygous wild-type (AA) DNA, bands of 73 bp and 158 bp can be amplified. uce4 / uce4 In the homozygous mutant material (aa), bands of 71 bp and 125 bp were amplified, respectively, while... UCE4 / uce4 In hybrid (Aa) materials, the corresponding two bands can be amplified simultaneously. The validation results of the ZmUCE4-F1 / R1 and ZmUCE4-F2 / R2 molecular markers are as follows: Figure 6 , Figure 7 As shown, the results indicate that the designed functional molecular markers completely met expectations in detecting F2 plants. UCE4 / UCE4 Homozygous wild type (AA) UCE4 / uce4 Heterozygous (Aa) and uce4 / uce4 The homozygous mutant material (aa) amplified bands of corresponding sizes, which can be used as... UCE4 , uce4 An ideal marker for allele detection.

[0096] These molecular markers help identify mutant genotypes before flowering and pollination, enabling hybridization and backcrossing to breed male-sterile lines under different genetic backgrounds, and have important application value.

[0097] References

[0098] [1] Liu HJ, Liu J, Zhai Z, Dai M, Tian F, Wu Y, Tang J, Lu Y, Wang H, Jackson D, Yang X, Qin F, Xu M, Fernie AR, Zhang Z, Yan J. Maize2035: A decadal vision for intelligent maize breeding Mol Plant. 2025 Feb 3;18 (2):313-332. doi:10.1016 / j.molp.2025.01.012. PMID:39827366

[0099] [2] Wan X, Wu S, Li X. Breeding with dominant genic male-sterility genes to boost crop grain yield in the post-heterosis utilization era Mol Plant. 2021 Apr 5;14 (4):531-534. doi:10.1016 / j.molp.2021.02.004. PMID:33582376

[0100] [3] An X, Dong Z, Tian Y, Xie K, Wu S, Zhu T, Zhang D, Zhou Y, Niu C, Ma B, Hou Q, Bao J, Zhang S, Li Z, Wang Y, Yan T, Sun X, Zhang Y, Li J, Wan X. ZmMs30 Encoding a Novel GDSL Lipase Is Essential for Male Fertility and Valuable for Hybrid Breeding in Maize Mol Plant. 2019 Mar 4;12 (3):343-359. doi:10.1016 / j.molp.2019.01.011. PMID:30684599

[0101] [4] Wu Y, Fox TW, Trimnell MR, Wang L, Xu RJ, Cigan AM, Huffman GA, Garnaat CW, Hershey H, Albertsen MC. Development of a novel recessive genetic male sterility system for hybrid seed production in maize and other cross-pollinating crops Plant Biotechnol J. 2016; 14 (3): 1046-54. doi: 10.1111 / pbi.12477. PMID: 26442654

[0102] [5] Qi X, Zhang C, Zhu J, Liu C, Huang C, Li X, Xie C. Genome Editing Enables Next-Generation Hybrid Seed Production Technology Mol Plant. 2020 Spt 7; 13 (9): 1262-1269. doi: 10.1016 / j.molp.2020.06.003. PMID: 32645290.

Claims

1. A method of creating a maize male sterile line, characterized by, Knocking out a corn ZmUCE4 gene to obtain a corn male sterile plant; the nucleotide sequence of the ZmUCE4 gene is SEQ ID NO. 1, and the amino acid sequence encoded by the ZmUCE4 gene is SEQ ID NO.

2.

2. The method of creating a male sterile line of maize according to claim 1, wherein, The methods of knocking out the corn ZmUCE4 gene include gene editing, and also include other technical means capable of knocking out the corn ZmUCE4 gene.

3. The method of creating a male sterile line of maize according to claim 2, wherein, The gene editing adopts a CRISPR / Cas9 method.

4. The method of creating a male sterile line of maize according to claim 3, wherein, The CRISPR / Cas9 method comprises designing a CRISPR / Cas9 carrier target site at the fourth exon of the gene, and the DNA sequence of the target site is as shown in SEQ ID NO.

3.

5. A maize male sterile line obtained by the method according to claim 4. uce4 mutant genes ZmUCE4-Cas9-1 and ZmUCE4-Cas9-2; characterized in that, and the method of claim 1 ZmUCE4 ZmUCE4-Cas9-1 has a deletion of 2 bases at the site of 1877 bp-1878 bp of the 4th exon compared with the nucleotide sequence of the gene SEQ ID NO. 1 ZmUCE4 ZmUCE4-Cas9-2 has a deletion of 32 bases at the site of 1877 bp-1908 bp of the 4th exon and a deletion of 1 base G at the site of 1909 bp of the 4th intron.

6. A method of obtaining corn plants of different genetic backgrounds uce4 a male sterile line, characterized in that, Obtained by any of the methods described in claims 1, 2, 3 and 4 uce4 Male-sterile lines are hybridized and backcrossed with target maize materials to obtain the desired male-sterile line. uce4 Male sterility genes and male sterility traits.

7. A plant obtained by the method of any one of claims 1, 2, 3, 4, and 6 uce4 Use of the sterile line in corn hybrid breeding and seed production.

8. Use according to claim 7, wherein the cross-breeding and seed production means that uce4 the sterile line is crossed as a female parent with other male parents.

9. The use according to claim 7, comprising obtaining uce4 male sterile lines are crossed and backcrossed with other target materials, so that the target materials acquire uce4 the male sterile gene and the trait of male sterility.

Images