Detection primer of atractylodes macrocephala koidz fungus pathogen Colletotrichum gloeosporioides composite species RPA (recombinase polymerase amplification) and application
By combining RPA technology with species-specific genes and universal fungal internal controls, a portable detection system was constructed, which solved the problem of rapid and accurate detection of the anthrax pathogen in Atractylodes macrocephala, and achieved high specificity and high sensitivity in early disease diagnosis.
Patent Information
- Application Number
- CN202511640397.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-11
- Publication Date
- 2026-01-02
AI Technical Summary
Existing technologies make it difficult to quickly and accurately detect the anthracnose pathogen of Atractylodes macrocephala in the field. Traditional morphological identification is difficult to distinguish it, and conventional PCR or qPCR techniques are complex to operate and have long detection cycles, which cannot meet the needs of early disease diagnosis.
By combining species-specific genes (ApMat, TEF1-α) with fungal universal internal control systems (ITS) using RPA technology, specific primers and probes were designed to construct a portable detection system. Multi-channel lateral flow test strips were used to achieve parallel detection of multiple targets, which is suitable for rapid identification under normal temperature conditions.
It significantly improves the specificity and sensitivity of detection, reduces false positives and false negatives, shortens the detection time to within 20 minutes, can be stored at room temperature for a long time, facilitates on-site application, and is suitable for early disease detection.
Smart Images

Figure CN121249950A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of rapid detection of plant pathogenic fungi, specifically to the fungal pathogen of Atractylodes macrocephala. Colletotrichum gloeosporioides Primers for detecting complex RPA and their applications. Background Technology
[0002] Atractylodes macrocephala ( Atractylodes macrocephala Koidz. Atractylodes macrocephala is one of my country's important traditional Chinese medicinal herbs, mainly produced in Zhejiang, Anhui, Hubei, and Jiangxi provinces. Its rhizome is a commonly used medicinal material, possessing properties such as strengthening the spleen and replenishing qi, and drying dampness and promoting diuresis. However, in recent years, with the expansion of Atractylodes macrocephala cultivation and the prevalence of continuous cropping, fungal diseases have become increasingly serious, becoming one of the important factors restricting the improvement of its yield and quality. Among them, anthracnose is one of the most widespread and serious fungal diseases, mainly caused by… Colletotrichum gloeosporioides Caused by a complex pathogen, or by C. fructicola、 C. siamense It can be caused by infection with closely related species. This disease can lead to leaf spots, leaf blight, and even root and stem rot, and in severe cases, it can cause a yield loss of 30%–60%.
[0003] Due to the complexity of anthracnose pathogen populations, close interspecies phylogenetic relationships, and similar morphological characteristics, traditional morphological identification is difficult to accurately distinguish them. Conventional ITS region molecular detection has limited resolution within complex populations and is prone to cross-reactivity and misdiagnosis. In addition, although conventional PCR or qPCR techniques have high sensitivity, they have high requirements for experimental conditions, are complex to operate, and have long detection cycles, making it difficult to meet the needs of rapid field detection.
[0004] Therefore, developing a rapid molecular detection technology for the anthrax pathogen in Atractylodes macrocephala with high specificity, high sensitivity, and on-site application is of great significance for achieving early diagnosis of the disease, guiding scientific prevention and control, and ensuring the quality and safety of Atractylodes macrocephala medicinal materials.
[0005] Due to the complexity of anthracnose pathogen populations, close interspecies phylogenetic relationships, and similar morphological characteristics, traditional morphological identification is difficult to accurately distinguish them. Conventional ITS region molecular detection has limited resolution within complex populations and is prone to cross-reactivity and misdiagnosis. In addition, although conventional PCR or qPCR techniques have high sensitivity, they have high requirements for experimental conditions, are complex to operate, and have long detection cycles, making it difficult to meet the needs of rapid field detection.
[0006] Therefore, developing a rapid molecular detection technology for the anthrax pathogen in Atractylodes macrocephala with high specificity, high sensitivity, and on-site application is of great significance for achieving early diagnosis of the disease, guiding scientific prevention and control, and ensuring the quality and safety of Atractylodes macrocephala medicinal materials. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention proposes a fungal pathogen of Atractylodes macrocephala. Colletotrichum gloeosporioides The detection primers and applications of RPA in mixed species were developed. By combining species-specific genes (ApMat, TEF1-α) and fungal universal internal control (ITS), a portable detection system was constructed that can rapidly identify the anthracnose pathogen of Atractylodes macrocephala under normal temperature conditions, which can significantly improve the timeliness and accuracy of field disease diagnosis.
[0008] The objective of this invention can be achieved through the following technical solutions: A first aspect of the present invention relates to a detection kit, comprising: Used for detection ITS The reagents include primer 1, with nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2, respectively; Used for detection TEF1-α The reagents include primer 2, with nucleotide sequences SEQ ID NO.4 and SEQ ID NO.5, respectively; And RPA reaction components.
[0009] Optionally, the RPA reaction components include: recombinase, single-strand binding protein, strand displacement DNA polymerase, and buffer.
[0010] Optionally, the method for detection ITS The reagents also include a specific probe, with the nucleotide sequence SEQ ID NO. 3; the reagents used for detection TEF1-α The reagents also include a specific probe II, with the nucleotide sequence SEQ ID NO.6.
[0011] Optionally, the 5′ end of primer SEQ ID NO.1 and / or primer SEQ ID NO.4 is labeled with biotin.
[0012] Optionally, the 5′ end of the first and / or second specific probes is marked with FAM.
[0013] Optionally, the middle segment of the first and / or second specific probes contains a dSpacer cleavage site, and the 3' end has a C3 Spacer blocking extension.
[0014] Optionally, it also includes reagents for detecting the ApMat region, including primer three, which includes a forward primer and a reverse primer with sequences SEQ ID NO.7 and SEQ ID NO.8, respectively.
[0015] Optionally, the reagents used to detect the ApMat region also include a specific probe three with the sequence SEQ ID NO.9.
[0016] A second aspect of the present invention relates to the application of the above-described reagent kit in the detection of diseases of Atractylodes macrocephala.
[0017] Optionally, the diseases of Atractylodes macrocephala include Atractylodes macrocephala fungal pathogens. Colletotrichum gloeosporioides Diseases caused by mixed species.
[0018] The beneficial effects of this invention are: 1. Significantly improved detection specificity pass ApMat Gene, ITS Gene+ TEF1-α Gene dual-target combination detection effectively distinguishes Colletotrichum Avoid closely related species. ITS Cross-reactivity issues that are prone to occur in area testing.
[0019] 2. The dual targets mutually verify each other, reducing false positives and false negatives and improving the reliability of test results.
[0020] 3. High detection sensitivity and short reaction time Using optimized RPA-specific primers and probes, amplification can be completed in 20 minutes at low temperature (37–42℃). Detection sensitivity reaches the picomolar (pM) level, enabling the detection of low-copy-level pathogen DNA, making it suitable for early disease detection.
[0021] 4. Multi-channel visual inspection The designed multi-channel lateral flow test strip can simultaneously detect multiple gene loci and includes a control line (C line), enabling parallel detection of multiple targets in a single reaction. Detection results can be directly interpreted via colorimetric analysis, eliminating the need for expensive laboratory testing equipment.
[0022] 5. Strong on-site portable testing capability The test reagents are in the form of lyophilized RPA reaction components, which can be stored for a long time at room temperature (≥6 months), and are convenient to transport and store. Attached Figure Description
[0023] The invention will now be further described with reference to the accompanying drawings.
[0024] Figure 1 This is a schematic diagram of the sensitivity test results of the detection kit of this application; Figure 2 This is a schematic diagram showing the test results of the detection kit of this application at different DNA template concentrations; Figure 3 The results of other fungal tests for the test kit in this application are shown from left to right: Phytophthora infestans, Alternaria, Fusarium graminearum, Blastomyces orientalis, Botrytis cinerea, and Smut. Detailed Implementation
[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0026] In some embodiments of the present invention, a fungal pathogen of Atractylodes macrocephala is disclosed. Colletotrichum gloeosporioides The preparation and experimental testing of the detection kit for complex RPA species include the following steps: 1. Multi-target gene strategy ("species-specific + secondary barcoding + universal internal control") Apn2-Mat1-2 Interval ( ApMat As a high-resolution target for species / complexes, it can effectively distinguish... C. gloeosporioides Groups in the complex that are similar to the main pathogenic group of Atractylodes macrocephala (e.g.) C. fructicola (etc.) and closely related Colletotrichum Species. TEF1-α (Extension Factor 1-α): Serves as a secondary barcode, improving robustness in identifying closely related species; it also provides cross-validation with the ApMat dual-target. ITS region: Serves as a universal fungal detection target / positive internal control, used to determine the effectiveness of the DNA extraction and amplification system.
[0027] In some examples, if further targeting of a specific prevalent species (such as a local mainstream isolate) is required, GAPDH / TUB2 / CAL can be set as a replaceable secondary barcode site.
[0028] 2. RPA primer and probe design (LFD kit) Each target has one pair of primers and one probe; the amplified fragment is 100–300 bp. Labeling method (for lateral flow colorimetric development): Forward primer 5′ end: Biotin (to be bound to one end of the test strip); Probe 5′ end: FAM (visual detection label); Probe mid-section: dSpacer (THF) cleavage site; Probe 3′ end: C3 Spacer (blocking extension); Primer length 30–35 nt; Probe length 46–52 nt; The probe is located in the middle of the amplification fragment, does not overlap with the primer, and ensures RPA chemical cleavage / displacement kinetics.
[0029] The specific sequences of the primers / probes are shown in the "Sequence Listing (SEQ ID NO:1–9)", which correspond to ApMat-F / R / Probe, TEF1-α-F / R / Probe, and ITS-F / R / Probe, respectively.
[0030] The specific information regarding the primer nucleotide sequence is as follows: SEQ ID NO:1:ITS-F(Biotin): / 5BiosG / GTTTCTAGAGGAAGTAAAAGTCGTAACA (30nt, GC≈40%) SEQ ID NO:2 ITS-R: GTTTCTTTTCCTCCGCTTATTGATATGC (30 nt, GC≈40%) SEQ ID NO:3 ITS-Probe(FAM-THF-C3): / 56-FAM / TCGATGAAGAACGCAGC[dSpacer] GCGTTCTTCATCGATGC / 3SpC3 / (46 nt in length, located in the middle of the fragment) SEQ ID NO:4TEF-F(Biotin): / 5BiosG / CATCGAGAAGTTCGAGAAGGTTGGAGTTGAT (32nt, based on upstream extension and optimization of EF1-728F; GC≈47%) SEQ ID NO:5 TEF-R:GCTTGTCGATACCACGCTCCTTCTTGAACT (31 nt, GC≈52%) SEQ ID NO:6 TEF-Probe(FAM-THF-C3): / 56-FAM / CGAGATGACCGTCGAGAAG[dSpacer] TCGACGACGTTGATGACG / 3SpC3 / (48 nt, placed in the middle of the fragment, avoiding the primer binding region) SEQ ID NO:7 ApMat-F(Biotin): / 5BiosG / TGGTTGACGATCGTCTTCGTTGACGATGTT (31 nt, GC≈45%) SEQ ID NO:8 ApMat-R: CGGATGAGCAGGTTGATGTTGATGAGGTTG (31 nt, GC≈45%) SEQ ID NO:9 ApMat-Probe(FAM-THF-C3): / 56-FAM / CGTCGAGATGTTGAGGACG[dSpacer]TTGATGACGATGACGACG / 3SpC3 / (47 nt) Design considerations: GC content 40–60%; avoid >4 consecutive identical bases; minimize secondary structures and cross-species conserved regions to ensure species / complex specificity. ApMat , TEF1-α ) and broad-spectrum fungal activity ITS ).
[0031] 3. Kit Components Lyophilized RPA reaction beads (containing recombinase, SSB, strand displacement polymerase, buffer system, and protectant); three sets of primers / probes: ApMat , TEF1-α , ITS (Individually packaged in tubes, or provided as premixed multiplex systems); Mg²⁺ starter solution and reaction buffer; positive control DNA (sequencing confirmed as the target Colletotrichum genome / fragment) and negative control (template-free, NTC); multichannel lateral flow test strip (LFD): one strip can display... T1 ( ApMat ) / T2 ( TEF1-α ) / C (Quality Control) Three lines; disposable consumables (dropper bottle, pipette tip / capillary tube), simple thermostat or handheld thermostat bag (optional).
[0032] 4. Testing Process Sample preparation: Take Atractylodes macrocephala leaf / petiole / lesion tissue (or seedlings) and process it according to the rapid lysis / DNA extraction protocol provided in the kit (3–5 min).
[0033] Reaction preparation: Add template (1–2 μL), target primers and probes, and buffer to the reaction tube containing lyophilized RPA, and finally add Mg²⁺ starter solution, mix well and briefly spin.
[0034] Isothermal amplification: 37–42℃, 20 min; gently tap to mix once every 5–8 min.
[0035] Lateral flow detection: Add 5–10 μL of amplification product to the sample well of the test strip, add detection buffer, and read the result after 3–5 minutes.
[0036] Result interpretation rules (corresponding to Appendix 2 "Test Strip Diagram"): C line color development: process valid; T1 ( ApMat)Staining test: Target complex positive; T2 ( TEF1-α Color development: Secondary barcode positive; ApMat + TEF1-α Simultaneous positive result: Diagnosed with Atractylodes macrocephala anthrax ( Colletotrichum order Positive for the target group; positive for ITS (shown in a single strip or parallel channel) indicates that the fungal DNA / amplification system is effective; positive for ITS only: suggests that the sample contains fungi but the target group is negative or the target is low copy / mutated.
[0037] Supports single-tube multi-channel ( ApMat + TEF1-α It can operate in two modes: single tube multiple + parallel dual tube; for mass production, the "single tube multiple + three-line test strip" mode is preferred to simplify operation.
[0038] like Figure 1 As shown, the horizontal axis represents the concentration gradient of the target nucleic acid template, from 10... 2 Dilute to 10 −4 This refers to dilution sequences ranging from high to extremely low concentrations. At higher template concentrations (e.g., 10⁻⁶), the dilution sequence is used. 2 10 1 10 0 At this concentration, the fluorescence intensity remained at a high and stable level (approximately 1400–1600). With increasing dilution (10...), the fluorescence intensity decreased. −1 Up to 10 −3 The fluorescence intensity began to gradually decrease. Even at the highest dilution of 10... −4 At that location, the fluorescence intensity remained above 800. These results demonstrate that the kit provided by this invention has high sensitivity.
[0039] Further experimental testing reveals that the kit provided by this invention has at least the following improvements; 1. Significantly improved detection specificity pass ApMat Gene, ITS Gene+ TEF1-α Gene dual-target combination detection effectively distinguishes C. fructicola Closely related to it Colletotrichum species, avoid ITS Cross-reactivity issues that are prone to occur in area testing.
[0040] 2. The dual targets mutually verify each other, reducing false positives and false negatives and improving the reliability of test results.
[0041] 3. High detection sensitivity and short reaction time Using optimized RPA-specific primers and probes, amplification can be completed in 20 minutes at low temperature (37–42℃). Detection sensitivity reaches the picomolar (pM) level, enabling the detection of low-copy-level pathogen DNA, making it suitable for early disease detection.
[0042] 4. Multi-channel visual inspection The designed multi-channel lateral flow test strip can simultaneously detect multiple gene loci and includes a control line (C line), enabling parallel detection of multiple targets in a single reaction. Detection results can be directly interpreted via colorimetric analysis, eliminating the need for expensive laboratory testing equipment.
[0043] 5. Strong on-site portable testing capability The test reagents are in the form of lyophilized RPA reaction components, which can be stored for a long time at room temperature (≥6 months), and are convenient to transport and store.
[0044] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0045] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.
Claims
1. A detection kit, comprising: Used for detection ITS The reagents include primer 1, with nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2, respectively; Used for detection TEF1-α The reagents include primer 2, with nucleotide sequences SEQ ID NO.4 and SEQ ID NO.5, respectively; And RPA reaction components.
2. The detection kit according to claim 1, characterized in that, The RPA reaction components include: recombinase, single-strand binding protein, strand displacement DNA polymerase, and buffer.
3. The detection kit according to claim 1, characterized in that, The detection ITS The reagents also include a specific probe, with the nucleotide sequence SEQ ID NO.3; the reagents used for detection TEF1-α The reagents also include a specific probe II, with the nucleotide sequence SEQ ID NO.
6.
4. The detection kit according to claim 1, characterized in that, The 5′ end of primer SEQ ID NO.1 and / or primer SEQ ID NO.4 is labeled with biotin.
5. The detection kit according to claim 3, characterized in that, The 5′ end of the specific probe one and / or specific probe two is marked with FAM.
6. The detection kit according to claim 3, characterized in that, The mid-segment of the specific probe one and / or specific probe two contains a dSpacer cleavage site, and the 3′ end has a C3 Spacer to block extension.
7. The detection kit according to claim 1, characterized in that, It also includes reagents for detecting the ApMat region, including primer three, which includes a forward primer and a reverse primer with sequences SEQ ID NO.7 and SEQ ID NO.8, respectively.
8. The detection kit according to claim 7, characterized in that, The reagents used to detect the ApMat region also include a specific probe three with the sequence SEQ ID NO.
9.
9. The use of the kit according to any one of claims 1 to 8 in the detection of diseases of Atractylodes macrocephala.
10. The application of the kit according to any one of claims 1 to 8 in the detection of diseases of Atractylodes macrocephala, as described in claim 9, is characterized in that... The diseases of Atractylodes macrocephala include Atractylodes macrocephala fungal pathogens. Colletotrichum gloeosporioides Diseases caused by mixed species.