KASP molecular marker linked with major site related to tobacco brown spot resistance and primer group of KASP molecular marker
By developing major-effect linked KASP molecular markers and their primer sets related to tobacco red spot disease resistance, and utilizing high-density SNP chip analysis and PCR amplification technology, the problem of lack of resistance sites in tobacco breeding was solved, enabling efficient screening and identification of resistant varieties and promoting the progress of tobacco breeding.
Patent Information
- Application Number
- CN202511732417.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-01-02
AI Technical Summary
The lack of resistance sites for tobacco red spot disease in existing technologies hinders the tobacco breeding process and makes it difficult to efficiently screen and identify resistant varieties.
We developed a major-effect KASP molecular marker and its primer set associated with tobacco red spot disease resistance. We used high-density SNP chip analysis to determine the major-effect site, designed specific primer combinations, and detected the genotype by PCR amplification and fluorescence signal scanning.
This has enabled efficient screening and identification of varieties resistant to red spot disease, improved the efficiency of tobacco breeding, and promoted the development of the tobacco industry.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biomolecule detection, and particularly relates to a KASP molecular marker linked to a major effective site related to tobacco brown spot resistance and a primer set thereof. BACKGROUND
[0002] Tobacco brown spot is a kind of fungal disease, which can spread in a large area in a short time under suitable temperature and humidity conditions, causing serious economic losses and restricting the production of tobacco leaves and the development of the tobacco industry. The main pathogen of tobacco brown spot is Alternaria alternata, which belongs to fungi and mainly harms mature tobacco leaves. Young leaves show strong resistance to brown spot. Tobacco brown spot is also known as "red spot", "blotch" or "hate tiger". The disease spot shows concentric ring-shaped yellow-brown disease spots, and the symptoms are obvious. As one of the main diseases of tobacco, brown spot has the characteristics of rapid outbreak and short incubation period, and can spread in a large area in a short time, infecting surrounding tobacco plants and causing unpredictable effects. In recent years, the planting mode of tobacco has changed, and large-scale and standardized concentrated planting has gradually formed. Due to the abnormal weather, the connection of tobacco planting area into a piece and other environmental factors, the incidence of brown spot has increased year by year, which has seriously hindered the development of the tobacco industry. Therefore, from the perspectives of economy, effect and environment, breeding high-resistance brown spot varieties is an effective measure to solve the harm of brown spot. Therefore, breeding scientists need to study the genetic mechanism of tobacco brown spot resistance source, clarify the incidence rule of brown spot and screen and breed brown spot-resistant varieties, so as to promote the rapid development of the tobacco industry. SUMMARY
[0003] Therefore, in order to at least partially solve the above-mentioned technical problems, the present application provides a KASP molecular marker linked to a major effective site related to tobacco brown spot resistance and a primer set thereof.
[0004] According to an aspect of the present application, a KASP molecular marker linked to a major effective site related to tobacco brown spot resistance is provided, wherein the major effective site is located at 74838959bp of chromosome 18, and the genotype of the major effective site is A or C.
[0005] According to an embodiment of the present application, the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 1.
[0006] According to another aspect of the present application, a primer set for detecting the above-mentioned KASP molecular marker is provided, which comprises a first reverse primer, a second reverse primer and a forward universal primer. The nucleotide sequence of the first reverse primer is shown in SEQ ID NO. 2; the nucleotide sequence of the second reverse primer is shown in SEQ ID NO. 3; and the nucleotide sequence of the forward universal primer is shown in SEQ ID NO. 4.
[0007] According to the embodiment of the present application, the first reverse primer and the second reverse primer are labeled with different specific fluorescent tag sequences selected from FAM and HEX.
[0008] According to the embodiment of the present application, the sequence of FAM is shown in SEQ ID NO. 5, and the sequence of HEX is shown in SEQ ID NO. 6.
[0009] According to another aspect of the present application, a detection product for detecting the genotype of the major effective site related to tobacco brown spot resistance is provided, which comprises the primer set described above.
[0010] According to the embodiment of the present application, the detection product is a detection reagent, a detection kit or a detection chip.
[0011] According to another aspect of the present application, the detection product for detecting the genotype of the major effective site related to tobacco brown spot resistance described above is applied to assisting in improving tobacco brown spot resistance, cultivating new tobacco lines resistant to tobacco brown spot, detecting the strength of tobacco brown spot resistance, predicting the strength of tobacco brown spot resistance, effectively selecting the strength of tobacco brown spot resistance or molecular-assisted breeding of tobacco brown spot resistance.
[0012] According to the embodiment of the present application, the application described above comprises the following steps:
[0013] (1) Taking the genomic DNA of the tobacco to be detected as a template, performing PCR amplification by using the primer set, and performing fluorescent signal scanning on the obtained amplification product; and
[0014] (2) Judging the genotype of the tobacco to be detected according to the result of the fluorescent signal scanning, if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the first reverse primer, the genotype of the tobacco to be detected is AA, which is a tobacco with strong brown spot resistance; if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the second reverse primer, the genotype of the tobacco to be detected is CC, which is a tobacco with weak brown spot resistance or a tobacco susceptible to brown spot.
[0015] The present application obtains the major effective site related to brown spot resistance and the specific position and genotype of the major effective site in the chromosome by high-density single nucleotide polymorphism (SNP) chip analysis, and designs a primer set for the KASP molecular marker linked to the major effective site, thereby realizing the detection of the strength of tobacco brown spot resistance. The present application can effectively improve the screening and identification of brown spot resistance varieties, make up for the lack of brown spot resistance sites, and promote the progress of tobacco breeding resistant to brown spot. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 It is a statistical chart of disease investigation of field parents in the RIL population in the embodiments of the present application.
[0017] Figure 2 Fig. 1 is a field disease investigation statistical chart of RIL population in an embodiment of the present application, wherein a is a field disease investigation statistical chart of RIL population in 2017, and b is a field disease investigation statistical chart of RIL population in 2019;
[0018] Figure 3 Fig. 3 is a result chart of SKF18-7483 marker separation parents in an embodiment of the present application;
[0019] Figure 4 Fig. 4 is a result chart of SKF18-7483 marker detection of RIL population in 2019 in an embodiment of the present application. DETAILED DESCRIPTION
[0020] Hereinafter, embodiments of the present application will be described with reference to the accompanying drawings. It should be understood, however, that the description which follows is merely exemplary and is not intended to limit the scope of the application. In the following detailed description of embodiments of the present application, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that one or more embodiments of the present application can be practiced without these specific details. In other instances, well-known structures and functions have not been described in detail in order to avoid obscuring aspects of the present application.
[0021] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used herein, the term "includes" indicates the presence of the features, steps, operations, but does not preclude the presence or addition of one or more other features.
[0022] It is found in the process of implementing the present concept that SNP markers, as a new genetic molecular marker means, are widely used in various biological research fields, especially in the improvement of crop disease resistance, high yield and the like. Nicotiana tabacum is an allopolyploid plant, and its genomic information is complex and diverse, so the development of SNP markers is relatively slow. In recent years, research on tobacco relying on SNP markers has also made progress, providing strong support for disease resistance breeding, gene positioning, variety selection and the like. Related technologies obtain a large number of single sequence genes (unigenes) based on tobacco transcriptome sequencing, identify a large number of SNPs by using bioinformatics methods, develop AS-PCR and KASP molecular markers according to SNP site information, and apply them to tobacco germplasm genetic diversity analysis and construction of a fingerprint map of germplasm. Another related technology uses a SNP marker method to analyze the F2, F 2:3The genotype of the population is analyzed, and the QTL of tobacco bacterial wilt resistance is located in the whole genome. However, at present, the tobacco bacterial wilt resistance source is less, and the most commonly used source in production is Beinhart1000-1 and tobacco net leaf yellow. So far, the resistance mechanism of the resistance source Beinhart1000-1 is unknown, and the number, position and size of the resistance site are unknown. In the present application, the recombinant inbred line (RIL population) with Beinhart1000-1 and susceptible material Xiaohuang1025 as parents is used as the material, the genotype of the population is analyzed by high-density SNP chip analysis, the resistance performance of the population material to bacterial wilt is systematically evaluated under different environmental conditions, the main QTL related to bacterial wilt resistance is explored in the whole genome, and the genetic mechanism of the bacterial wilt resistance of the resistance source Beinhart1000-1 is determined. The SNP markers obtained have high reliability.
[0023] According to the high-density SNP chip analysis results, it is found that there are three main QTLs related to bacterial wilt resistance, and qBS-18 is a new main site derived from Beinhart1000-1. The development of the closely linked molecular marker for the main site qBS-18 can effectively improve the screening and identification of bacterial wilt resistant varieties, and make up for the lack of bacterial wilt resistance sites. Therefore, the development of the closely linked molecular marker for different resistance sites can be applied to the improvement of the bacterial wilt resistance of tobacco varieties, and new varieties can be bred, so as to improve the yield and quality of tobacco and promote the progress of bacterial wilt tobacco breeding.
[0024] The application will be further described in detail in combination with specific embodiments. The examples given are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.
[0025] In the following examples, the experimental methods are conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0026] Example 1 Determination of main site
[0027] Test materials:
[0028] Parents and recombinant inbred line (RIL) population: the parents are tobacco variety Xiaohuang1025 (susceptible variety) and Beinhart1000-1 (resistance source), and a cross combination is configured, and then an F8 generation recombinant inbred line population based on the parents is constructed, and the population size is 203 lines.
[0029] Tobacco germplasm core germplasm: the material is from 130 parts of the germplasm resource library of the Tobacco Research Institute of Chinese Academy of Agricultural Sciences, and has different SNP genotypes on the qBS-18 resistance site.
[0030] Test method:
[0031] 1) Tobacco brown spot tobacco field disease investigation
[0032] RIL and multiple parent high generation intercross (MAGIC) population were planted in Xinxing test base of Zicheng, Shandong Province, brown spot nursery, which is used for tobacco brown spot field investigation all the year round, and has good natural disease conditions. In 2017 and 2019, 203 strains of RIL population were investigated in the field of brown spot disease, and in 2019, the MAGIC population was investigated. The investigation standard is based on national tobacco industry tobacco disease and pest classification and investigation method GB / T23222-2008, and the specific standard is shown in table 1:
[0033] Table 1 Tobacco brown spot field disease investigation classification standard
[0034]
[0035] Disease index = 100 x ∑ (representative value x leaf number) / (total leaf x final disease level representative value).
[0036] 2) DNA extraction
[0037] The DNA extraction of the application adopts the commonly used sodium dodecyl sulfate (SLS) method in the laboratory. The specific method is as follows:
[0038] (1) Put the ground leaves into 2 ml EP tube, add 800 μL of prepared SLS extraction solution, shake for 5 min, and shake evenly.
[0039] (2) Add 800 μL of balanced phenol: chloroform: isopropyl alcohol (25:54:1), shake for 5 min, shake evenly, and centrifuge at 12000 rpm for 10 min at 4℃.
[0040] (3) 600 μL of supernatant is taken into a new centrifuge tube (1.5 ml), and an equal volume of pre-cooled isopropyl alcohol (-20℃) is added to precipitate DNA.
[0041] (4) 12000 rpm centrifugation for 10 min, discard the supernatant, wash twice with 75% ethanol, and rinse once with pure alcohol and dry.
[0042] (5) Add sterilized water to dissolve.
[0043] The SLS extraction solution formula is shown in Table 2:
[0044] Table 2 SLS extraction solution formula
[0045]
[0046] Experimental results:
[0047] 1) The occurrence of brown spot disease in Beinhart1000-1 and XHJ1025 parent and RIL population
[0048] The occurrence of tobacco brown spot disease is manifested as concentric ring brown spots, and there is obvious yellow halo around it. According to the national tobacco industry tobacco disease and pest classification and investigation method, the occurrence of RIL population field brown spot disease was investigated in 2017 and 2019 in Xinxing test base of Zucheng City, Shandong Province, and the investigation results are shown in Table 2. Figure 1
[0049] According to Figure 1 , the parent resistant variety Beinhart1000-1 and the susceptible variety XHJ1025 have obvious resistance and susceptibility difference. The average disease index of XHJ1025 is 94.21, which shows high susceptibility; the average disease index of Beinhart1000-1 is 27.45, which shows high resistance. It can be found from the results that the occurrence of field brown spot disease is good, and the parent material has obvious resistance and susceptibility difference, which meets the expectation.
[0050] The RIL population offspring occurs trait separation, and each strain has genetic difference. The population contains 203 strain materials, and the specific investigation data are shown in Table 2. Figure 2
[0051] Figure 2 It is the field occurrence investigation statistical chart of RIL population in the embodiment of the application, wherein a is the field occurrence investigation statistical chart of RIL population in 2017, and b is the field occurrence investigation statistical chart of RIL population in 2019.
[0052] According to Figure 2 , there is significant difference in resistance to brown spot disease among RIL population strains.
[0053] 2) SNP associated with major resistance locus qBS18
[0054] Using the 430K high-density SNP chip platform developed by Zhengzhou Tobacco Research Institute, a total of 432362 SNP sites were included, and the genotypes of the tobacco RIL population were analyzed, with a population size of 203, so that accurate genotype data results can be applied to the positioning of the resistance gene locus of brown spot. After positioning, qBS18 was found to be a major effective locus, and the significant SNP site associated with qBS-18 was determined to be A or C at the 74838959 bp base on chromosome 18 (SNP ID AX-117801339, marker name bin18-121, genetic distance 164.6).
[0055] Example 2 Development and verification of molecular markers
[0056] 1) KASP molecular marker development
[0057] The brown spot resistance locus is a typical quantitative trait. Through tobacco brown spot resistance QTL analysis, a major effective locus qBS18 was located, and the KASP molecular marker was located at the significant associated site on chromosome 18, at the 74838959 bp base, which was A or C (AX-117801339 (SNP ID, marker name bin18-121, genetic distance 164.6). There is a difference in resistance to brown spot between different genotypes of this site. According to the disease index, the site shows A, and the disease index of brown spot is lower than 44.25 ± 8.18, while the site shows C, and the disease index of brown spot is 78.54 ± 7.78. Through this site, a KASP molecular marker primer set (denoted as SKF18-7483) was developed, including three primers.
[0058] The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 1:
[0059] SEQ ID NO. 1:
[0060] CACTCGTAGGAAAGCCTTTGGGCACGTTTAAAATA[A / C]AGTTGTGATTGTGTACATGTTCGTGTGACATAATT.
[0061] The nucleotide sequence of the first reverse primer SKF18-7483Rt1 is shown in SEQ ID NO: 2:
[0062] SEQ ID NO: 2: 5'-ACGAACATGTACACAATCACAACTT-3'.
[0063] The nucleotide sequence of the second reverse primer SKF18-7483Rc1 is shown as SEQ ID NO: 3:
[0064] SEQ ID NO: 3: 5'-CGAACATGTACACAATCACAACTG-3'.
[0065] The nucleotide sequence of the forward universal primer SKF18-7483F is shown as SEQ ID NO: 4:
[0066] SEQ ID NO: 4: 5'-AACACTCGTAGGAAAGCCTTTG-3'.
[0067] SKF18-7483Rt1 and SKF18-7483Rc1 are specific reverse primers for two alleles of the major locus, A (strong resistance to brown spot) and C (weak resistance to brown spot), respectively, SKF18-7483Rt1 is a specific primer for tobacco resistant to brown spot, and SKF18-7483Rc1 is a specific primer for tobacco susceptible to brown spot. The 5' end of SKF18-7483Rt1 and SKF18-7483Rc1 is added with FAM and HEX fluorescent sequence tag sequences to obtain SKF18-7483Rt2 and SKF18-7483Rc2, respectively.
[0068] The nucleotide sequence of FAM is shown as SEQ ID NO. 5:
[0069] SEQ ID NO. 5: 5'-GAAGGTGACCAAGTTCATGCT-3'.
[0070] The nucleotide sequence of HEX is shown as SEQ ID NO. 6:
[0071] SEQ ID NO. 6: 5'-GAAGGTCGGAGTCAACGGATTCG-3'.
[0072] The nucleotide sequence of SKF18-7483Rt2 is shown as SEQ ID NO: 7:
[0073] SEQ ID NO. 7:
[0074] 5'-ACGAACATGTACACAATCACAACTT-3'. GAAGGTGACCAAGTTCATGCT
[0075] The nucleotide sequence of SKF18-7483Rc2 is shown as SEQ ID NO: 8:
[0076] SEQ ID NO. 8:
[0077] 5'-GAAGGTCGGAGTCAACGGATTCG AACATGTACACAATCACAACTG-3'.
[0078] KASP-PCR reaction was performed on a 384-well PCR instrument (Eppendorf Mastercycler pro), with a reaction system of 5 μL: 1 μL DNA (50 ng / μL) dried, 2.5 μL KASP Master mix (2x), 0.07 μL primer mixture (mixed by SKF18-7483Rt2, SKF18-7483Rc2, SKF18-7483F with a concentration of 100 μmol / L at a volume ratio of 2:2:5), and the rest was filled with ddH2O.
[0079] The KASP-PCR amplification program was as follows: the first stage was denaturation at 94°C for 15 min; the second stage was denaturation at 94°C for 20 s, annealing at 61°C for 60 s, for a total of 10 cycles (the annealing temperature decreased by 0.6°C for each cycle starting from the second cycle); the third stage was denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for a total of 26 cycles.
[0080] The KASP-PCR amplification product was subjected to fluorescence signal reading by a scanner (BMG POLARstar Omega). The SNP genotyping results were analyzed by genotyping data analysis software (KlusterCaller 3.4.1, KBioscience): the genotype aggregated near the X axis was the allele genotype linked to the FAM fluorescence tag sequence, and the genotype aggregated near the Y axis was the allele genotype linked to the HEX fluorescence tag sequence.
[0081] 2) Verification of the SKF18-7483 molecular marker
[0082] (1) Verification method
[0083] ① Extract the DNA of the tobacco to be tested and dilute it to a concentration of 50 ng / μL.
[0084] ② PCR amplification was performed using SKF18-7483Rt2, SKF18-7483Rc2, and SKF18-7483F as primers and the DNA of the tobacco to be tested as a template, and the reagent preparation and PCR amplification conditions were the same as those in the KASP marker development method.
[0085] ③The amplified product in step 2 is detected by end-point fluorescence signal detection using a scanner, and analyzed by genotyping data analysis software. Only the genotype corresponding to the fluorescence probe color of SKF18-7483Rt2 (showing blue color, gathered near the X axis) is AA genotype, which is the resistant tobacco strain to brown spot; only the genotype corresponding to the fluorescence probe color of SKF18-7483Rc2 (showing green color, gathered near the Y axis) is CC genotype, which is the susceptible tobacco strain to brown spot.
[0086] (2) Verification results
[0087] The tobacco DNA is labeled and verified by the marker SKF18-7483. Eight known AA homozygous genotype tobacco Beinhart1000-1 DNAs, four CC homozygous genotype small yellow gold 1025 DNAs, and ten negative controls are detected, and the genotyping results are as shown in Figure 3 .
[0088] According to Figure 3 , the signal point of the AA homozygous genotype variety is blue, far away from the coordinate axis origin and gathered near the X axis; the signal point of the CC homozygous genotype is green, far away from the coordinate axis origin and gathered near the Y axis; the gray point is the negative control, gathered near the coordinate axis origin.
[0089] The detection effect of the primer on brown spot resistance is verified by the RIL population material using the SKF18-7483 marker, and the average value of the phenotypic data is used for years of trait investigation, and the genotyping results are as shown in Figure 4 .
[0090] According to Figure 4 , the marker SKF18-7483 can significantly divide the test materials into three groups, wherein the signal point of the AA homozygous genotype variety is blue, carrying FAM fluorescence signal, which is the brown spot resistance material. The signal point of the CC homozygous genotype variety is green, carrying HEX fluorescence signal, which is the brown spot susceptible material. The signal point of the AC heterozygous genotype variety is red, carrying FAM fluorescence signal and HEX fluorescence signal. The difference in brown spot resistance of the two groups of homozygous genotype varieties is statistically analyzed, and it is found that the brown spot resistance of different genotypes is significantly separated (P<0.001), indicating that the marker can detect the brown spot resistance. The research results prove that the SKF18-7483 marker can significantly distinguish two homozygous genotypes, and the marker development is successful.
[0091] Example 3 Application of molecular marker
[0092] 1) Application of SKF18-7483 molecular marker
[0093] From tobacco germplasm core germplasm library, 130 genotypes with homozygous AA or homozygous CC at SNPID AX-117801339 SNP position are screened, and the disease index of field infection is analyzed, and a genotype and tobacco brown spot disease index list is obtained (as shown in Table 3), and it is determined that the AA homozygous type tobacco planting brown spot disease index is between 48.19±14.62, and the CC homozygous type disease index is between 82.42±11.05, and the disease index of CC type tobacco is significantly higher than that of AA type tobacco.
[0094] Table 3 Genotype and tobacco brown spot disease index list of 130 tobacco varieties
[0095]
[0096]
[0097]
[0098]
[0099]
[0100] The whole detection process of the present application only needs to perform PCR once, and then the genotype of each sample can be clearly distinguished by means of software, and the efficiency is much higher than that of gel electrophoresis-based molecular markers. In addition, the marker does not need to rely on gel electrophoresis, and will not produce secondary pollution, and is friendly to the environment. The marker can detect the genotype of the SNP site in high throughput, and can be applied to flue-cured tobacco molecular marker assisted breeding with high efficiency and low cost, and has important application value.
[0101] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application, and it should be understood that the above description is only for specific embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A KASP molecular marker linked to a major locus associated with resistance to Alternaria alternata, characterized in that, The major effective site is located at 74838959 bp of chromosome 18, and the genotype of the major effective site is A or C.
2. The KASP molecular marker according to claim 1, wherein, The nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.
1.
3. A primer set for detecting the KASP molecular marker of claim 1 or 2, characterized in that, The primer set comprises a first reverse primer, a second reverse primer and a forward universal primer. The nucleotide sequence of the first reverse primer is shown as SEQ ID NO. 2, the nucleotide sequence of the second reverse primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the forward universal primer is shown as SEQ ID NO.
4.
4. The primer set of claim 3, wherein, The first reverse primer and the second reverse primer label different specific fluorescent tag sequences selected from FAM and HEX.
5. The primer set of claim 4, wherein, The sequence of FAM is shown as SEQ ID NO. 5, and the sequence of HEX is shown as SEQ ID NO.
6.
6. A detection product for detecting the genotype of a major locus associated with resistance to Alternaria macrospora, characterized in that, The detection product comprises the primer set of any one of claims 3 to 5.
7. The test product of claim 6, wherein, The detection product is a detection reagent, a detection kit or a detection chip.
8. A use of a detection product for detecting the genotype of a major effective site related to tobacco brown spot resistance according to claim 6 or 7 in assisting in improving tobacco brown spot resistance, cultivating new tobacco lines resistant to tobacco brown spot, detecting the strength of tobacco brown spot resistance, predicting the strength of tobacco brown spot resistance, effectively selecting the strength of tobacco brown spot resistance or molecular-assisted breeding of tobacco brown spot resistance.
9. Use according to claim 8, characterized in that, The use comprises the following steps: (1) using the genomic DNA of the tobacco to be tested as a template, performing PCR amplification by using the primer set, and performing fluorescent signal scanning on the obtained amplification product; and (2) judging the genotype of the tobacco to be tested according to the result of the fluorescent signal scanning, if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the first reverse primer, the genotype of the tobacco to be tested is AA, which is a tobacco with strong resistance to tobacco brown spot; if the color of the fluorescent signal of the PCR amplification result is consistent with the color of the fluorescent linker of the second reverse primer, the genotype of the tobacco to be tested is CC, which is a tobacco with weak resistance to tobacco brown spot or a tobacco susceptible to tobacco brown spot.