Chimeric recombinant vector containing SCW10 signal peptide, recombinant pichia pastoris engineering bacteria and application of recombinant pichia pastoris engineering bacteria in expression of glycoprotein S.rug.-PGK

Abstract

The invention provides a chimeric recombinant vector containing SCW10 signal peptide, recombinant pichia pastoris engineering bacteria and application of the recombinant pichia pastoris engineering bacteria in expression of glycoprotein S.rug.-PGK, and belongs to the technical field of phosphoglycerate kinase production. According to the chimeric recombinant vector containing the SCW10 signal peptide, the chimeric recombinant vector is obtained by chimerizing the N end of the SCW10 signal peptide and the C end sequence of alpha-factor signal peptide in the recombinant vector, and the nucleotide sequence of the SCW10 signal peptide is as shown in SEQ ID NO.1; the recombinant vector is a recombinant vector containing phosphoglycerate kinase S.rug.-PGK from Stropharia rugoso-annulata, and the amino acid sequence of the S.rug.-PGK is as shown in SEQ ID NO. 2. The chimeric recombinant vector containing the SCW10 signal peptide constructed by the invention can be successfully transformed into pichia pastoris, so that the purpose of efficiently secreting and producing a large amount of PGK by the pichia pastoris is achieved.

Description

Technical Field

[0001] This invention belongs to the field of phosphoglycerate kinase production technology, specifically relating to a chimeric recombinant vector containing the SCW10 signal peptide, a recombinant Pichia pastoris engineered strain and its application of the expressed glycoprotein S.rug.-PGK. Background Technology

[0002] Phosphoglycerate kinase (PGK) is a key metabolic enzyme that plays an indispensable role in glycolysis and gluconeogenesis. PGK has a relative molecular mass of approximately 44.6 kDa and is composed of about 400 amino acid residues. Two main isoforms (PGK1 and PGK2) exist in eukaryotes, with the widely expressed PGK1 possessing core glycolytic functions. PGK is ubiquitous in almost all organisms, from yeast to mammals, and is one of the core executors of energy metabolism. Currently, large-scale production of PGK mainly relies on recombinant protein expression technology, which can be divided into traditional extraction methods and recombinant biosynthesis methods. Traditional extraction methods primarily rely on animal tissues (such as mammalian erythrocytes) or wild-type microorganisms (such as *E. coli*) as PGK sources. This process involves cell disruption, multi-step chromatography (such as ion exchange and gel filtration), and affinity purification, which is cumbersome and results in extremely low product yields (<1%). For example, when isolating PGK from hemolyzed erythrocytes, interference from high-abundance proteins such as hemoglobin must be addressed, often resulting in a final product purity of less than 80%. Enzyme activity is easily lost during extraction due to protease hydrolysis or oxidative stress. For instance, human PGK requires ATP to protect its conformation during mammalian cell extraction, but still faces the problem of a short half-life. Furthermore, traditional methods are difficult to scale up; a 7.5L fermentation yields only about 400 mg / L of PGK, and the cost is high. In contrast, recombinant expression using genetically engineered microbial hosts offers advantages such as high yield, easy purification, and precise control of enzyme activity, and is poised to become the mainstream technology for industrial PGK production.

[0003] Pichia pastoris (Komagataella phaffii, K. phaffii) is a eukaryotic expression host capable of correct protein folding and post-translational modifications (such as glycosylation). Pichia pastoris can utilize methanol to induce strong promoters (such as AOX1) to achieve efficient secretory expression of exogenous proteins. However, there are currently no reports in the literature of direct expression of PGK in Pichia pastoris. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a chimeric recombinant vector containing the SCW10 signal peptide, which, when introduced into Pichia pastoris, can achieve efficient expression of PGK.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a chimeric recombinant vector containing the SCW10 signal peptide, obtained by intercalating the N-terminus of the SCW10 signal peptide with the C-terminal sequence of the α-factor signal peptide in the recombinant vector. The nucleotide sequence of the SCW10 signal peptide is shown in SEQ ID NO. 1. The recombinant vector is a recombinant vector containing phosphoglycerate kinase S.rug.-PGK derived from Agaricus blazei, and the amino acid sequence of S.rug.-PGK is shown in SEQ ID NO. 2.

[0007] Preferably, the recombinant vector comprises pPICZαA-PGK.

[0008] Preferably, the nucleotide sequence encoding the S.rug.-PGK is shown in SEQ ID NO.3.

[0009] Preferably, the nucleotide sequence SEQ ID NO.4 in the α-factor signal peptide of the recombinant vector is replaced with the nucleotide sequence of the SCW10 signal peptide.

[0010] The present invention also provides a recombinant Pichia pastoris engineered strain containing the above-mentioned chimeric recombinant vector.

[0011] Preferably, the Pichia pastoris includes Pichia pastoris X33 or Pichia pastoris GS115.

[0012] The present invention also provides the application of the above-mentioned chimeric recombinant vector or the above-mentioned recombinant Pichia pastoris engineered strain in the production of phosphoglycerate kinase.

[0013] This invention also provides a method for producing phosphoglycerate kinase, comprising the following steps: placing the above-mentioned recombinant Pichia pastoris engineered strain in BMMY medium and culturing until OD... 600 When the concentration is 2, methanol is added to induce production.

[0014] Preferably, methanol is added until the final methanol concentration is 1%.

[0015] The beneficial effects of this invention are:

[0016] The chimeric recombinant vector containing the SCW10 signal peptide constructed in this invention can be successfully transformed into Pichia pastoris, achieving the goal of efficient and large-scale secretion of PGK by Pichia pastoris.

[0017] This invention achieves, for the first time, efficient secretory expression of S.rug.-PGK in Pichia pastoris, clearly demonstrating the use of Pichia pastoris strain X33 in OD... 600The optimal production system is defined as 2% methanol and 1% methanol as the inducing agent, laying the foundation for large-scale preparation. Attached Figure Description

[0018] Figure 1 The results are for the validation of plasmids pPICZαA and pPICZαA-PGK, where M is a 15000bp DNA Marker; 1 is the validation result of plasmid pPICZαA; 2 is the validation result of plasmid pPICZαA-PGK.

[0019] Figure 2 The results of Sac I restriction enzyme digestion comparison for plasmids pPICZαA and pPICZαA-PGK are shown below, with M representing a 15000bp DNA marker; 1 and 2 are the Sac I restriction enzyme digestion verification results for plasmids pPICZαA and pPICZαA, respectively; 3 and 4 are the Sac I restriction enzyme digestion verification results for plasmids pPICZαA-PGK and pPICZαA-PGK, respectively.

[0020] Figure 3 The results are for single-colony PCR validation, where M: 5000bp DNA Marker; 1 and 2: single-colony PCR validation results of K. phaffii X33-pPICZαA-PGK and K. phaffii GS115-pPICZαA-PGK; 3 and 4: single-colony PCR validation results of K. phaffii X33-pPICZαA and K. phaffii GS115-pPICZαA; 5 and 6: negative controls;

[0021] Figure 4 The images are optical microscope images of Pichia pastoris, from left to right: K. phaffii X33-pPICZαA, K. phaffii X33-pPICZαA-PGK, K. phaffii GS115-pPICZαA, and K. phaffii GS115-pPICZαA-PGK.

[0022] Figure 5 The results were validated by SDS-PAGE protein electrophoresis of enzyme solutions, where M: Protain Marker; 1 and 2: SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZαA enzyme solution; 3 and 4: SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZαA-PGK enzyme solution; 5 and 6: SDS-PAGE protein electrophoresis of K. phaffii GS115-pPICZαA enzyme solution; 7 and 8: SDS-PAGE protein electrophoresis of K. phaffii GS115-pPICZαA-PGK enzyme solution.

[0023] Figure 6 Results of SDS-PAGE protein electrophoresis of standard samples and K. phaffii GS115-pPICZαA-PGK enzyme solution; M: Protain Marker; 1-6: BSA protein samples with concentrations of 1, 0.5, 0.3, 0.2, 0.1, and 0 mg / mL, respectively; 7 and 8: SDS-PAGE protein electrophoresis of K. phaffii GS115-pPICZαA-PGK enzyme solution.

[0024] Figure 7 A screenshot processed using ImageJ and whose data is read.

[0025] Figure 8 Standard protein curves for protein concentration and mean gray value;

[0026] Figure 9 This is the Bradford standard protein curve;

[0027] Figure 10 The following are the SDS-PAGE protein electrophoresis results for standard samples and K. phaffii X33-pPICZαA-PGK enzyme solution: M: Protain Marker; 1-6: BSA protein samples with concentrations of 1, 0.5, 0.3, 0.2, 0.1, and 0 mg / mL, respectively; 7 and 8: SDS-PAGE protein electrophoresis results for K. phaffii X33-pPICZαA-PGK enzyme solution.

[0028] Figure 11 Standard protein curves for protein concentration and grayscale values;

[0029] Figure 12 This is the Bradford standard protein curve;

[0030] Figure 13 For standard samples and enzyme solutions, SDS-PAGE protein electrophoresis results are shown. M: Protain Marker; 1-6: BSA protein samples with concentrations of 1, 0.5, 0.3, 0.2, 0.1, and 0 mg / mL, respectively; 7, 8, and 9: OD at the start of induction. 600 =2 K. phaffii X33-pPICZαA-PGK enzyme solutions with methanol concentrations of 0.5%, 1%, and 1.5% as inducers were subjected to SDS-PAGE protein electrophoresis.

[0031] Figure 14For standard samples and enzyme solutions, SDS-PAGE protein electrophoresis results are shown. M: Protain Marker; 1-6: BSA protein samples with concentrations of 1, 0.5, 0.3, 0.2, 0.1, and 0 mg / mL, respectively; 7, 8, and 9: OD at the start of induction. 600 =SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZαA-PGK enzyme solution with methanol concentrations of 0.5%, 1%, and 1.5% as inducer at 4 ppm.

[0032] Figure 15 Standard protein curves for protein concentration and grayscale values ​​(corresponding to) Figure 13 );

[0033] Figure 16 Standard protein curves for protein concentration and grayscale values ​​(corresponding to) Figure 14 );

[0034] Figure 17 This is the Bradford standard protein curve;

[0035] Figure 18 This is a diagram of PCR products, where M: 15000bp DNA Marker; 1: Original plasmid pPICZαA-PGK; 2: PCR product of linear cloning vector; 3: Negative control;

[0036] Figure 19 The image shows the PCR products, where M is a 15000bp DNA Marker; 1-5 are the PCR products of the signal peptides PROSCW10, ExpLKR, INU1, OST1, and SCW10, respectively; and 6 is the negative control.

[0037] Figure 20 This is a diagram of PCR products, where M represents a 15000bp DNA Marker; 1-5 represent the PCR products of the chimeric signal peptide recombinant expression plasmids pPICZ A-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK, and pPICZ A-SCW10-α-PGK, respectively; 6 represents the negative control.

[0038] Figure 21 The DNA of five recombinant expression plasmids for signal peptides was validated, where M is a 15000bp DNA Marker; 1-5: validation results of plasmids pPICZ A-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK, and pPICZ A-SCW10-α-PGK.

[0039] Figure 22 The results of Pem I restriction enzyme digestion were compared for five recombinant expression plasmids of signal peptides, where M is a 15000bp DNA marker; 1, 3, 5, 7, and 9 are plasmids pPICZ A-PROSCW10-α-PGK, pPICZ A-ExpL KR-α-PGK, pPICZ A-INU1-α-PGK, pPICZ A-OST1-α-PGK, and pPICZA-SCW10-α-PGK; and 2, 4, 6, 8, and 10 are plasmids pPICZA-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZ A-OST1-α-PGK, and pPICZA-SCW10-α-PGK.

[0040] Figure 23 For yeast single colony PCR validation, M: 5000bp DNA Marker; 1-5: single colony PCR validation results of K. phaffii X33-pPICZ A-PROSCW10-α-PGK, K. phaffii X33-pPICZ A-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZ A-OST1-α-PGK and K. phaffii X33-pPICZ A-SCW10-α-PGK.

[0041] Figure 24 The results of SDS-PAGE protein electrophoresis of recombinant engineered bacterial enzyme solutions with different signal peptides were verified. M: Protain Marker; 1: 0.25 mg / mL BSA protein; 2: SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZαA-PGK enzyme solution, control group; 3, 4, 5, 6, and 7: SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpLKR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK enzyme solutions, respectively; 8: SDS-PAGE protein electrophoresis of K. phaffii X33-pPICZαA enzyme solution, control group.

[0042] Figure 25 This is the Bradford standard protein curve. Detailed Implementation

[0043] This invention provides a chimeric recombinant vector containing the SCW10 signal peptide, obtained by intercalating the N-terminus of the SCW10 signal peptide with the C-terminal sequence of the α-factor signal peptide in the recombinant vector. The nucleotide sequence of the SCW10 signal peptide is shown in SEQ ID NO. 1. The recombinant vector is a recombinant vector containing phosphoglycerate kinase S.rug.-PGK derived from Agaricus blazei, and the amino acid sequence of S.rug.-PGK is shown in SEQ ID NO. 2.

[0044] Phosphoglycerate kinase (PGK) from *Stropharia rugosoannulata* Farl, ex Murrill, *S.rug.* is a novel enzyme resource not yet indexed in databases, and its potential properties (such as thermostability and substrate affinity) may be significantly superior to those of traditional sources (human or yeast). Achieving efficient secretory expression of this enzyme through the *Pichia pastoris* system not only fills the gap in structural and functional research on this enzyme but also provides high-performance enzyme components for biomanufacturing (such as ATP regeneration systems) and diagnostic reagent development (sugar metabolism detection).

[0045] This invention successfully constructed a recombinant expression plasmid pPICZαA-PGK(S.rug.) (4772bp) containing the phosphoglycerate kinase gene of *S.rug.*. *globosum*. After linearization by Sac I digestion (electrophoresis showed that the linear plasmid had a lower migration rate than the circular configuration), it was precisely integrated into the AOX1 site on the chromosome of engineered *Pichia pastoris* strains *K. phaffii* X33 and *K. phaffii* GS115 via homologous recombination (dependent on the 5' and 3' AOX1 homologous arms to ensure strict methanol regulation of the exogenous gene). Colony PCR verification showed the amplification of a 1248bp target band in the transformants, confirming successful integration of the *S.rug.*-PGK gene.

[0046] After induction of expression, SDS-PAGE and Bradford assays showed that both hosts achieved extracellular secretion of the 58 kDa target protein. The expression level of K. phaffii X33 (0.291-0.299 g / L) was significantly higher than that of K. phaffii GS115 (0.263-0.276 g / L), establishing K. phaffii X33 as the superior expression host.

[0047] Further optimization of shake-flask induction conditions revealed that the initial bacterial cell density (OD) was [value missing]. 600=2 When combined with an inducer at a 1% methanol concentration, protein yield reached a maximum of 0.292-0.308 g / L; while delayed-induced OD 600 =4 or deviations in the concentration of the inducer methanol (0.5% or 1.5%) both led to a decrease in expression levels, down to a minimum of 0.158 g / L.

[0048] This invention achieves, for the first time, efficient secretory expression of S.rug.-PGK in Pichia pastoris, clearly demonstrating the use of Pichia pastoris strain X33 in OD... 600 The optimal production system is defined as 2% methanol and 1% methanol as the inducing agent, laying the foundation for large-scale preparation.

[0049] This invention also successfully constructed chimeric recombinant plasmids containing five chimeric signal peptides. The N-terminal functional domains of cell wall protein signal peptide PROSCW10, bacterial secretion peptide ExPL KR, inulinase signal peptide INU1, oligosaccharide transferase signal peptide OST1, and SCW10 were chimeric with the C-terminus of the α-factor signal peptide in the pPICZαA-PGK recombinant vector, forming novel hybrid signal peptide-driven secretion. After linearization by Pme I digestion, the five plasmids were transformed into Pichia pastoris K. phaffiiX33, and colony PCR confirmed successful integration of the target gene: 1518-1572 bp.

[0050] The results of induced expression showed that, in the signal peptide modification, the extracellular production of S.rug.-PGK by PROSCW10, ExplKR, OST1 and SCW10 chimeric signal peptides was increased compared with that of the original α-factor signal peptide. The SCW10-α chimeric signal peptide showed the best effect (0.437–0.445 g / L), which was 49% higher than that of the original α-factor signal peptide (0.291–0.299 g / L), while the INU1-α chimeric signal peptide had no protein secretion.

[0051] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0052] Unless otherwise specified, the following embodiments are all conventional methods.

[0053] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0054] Example 1

[0055] 1. Obtain 5 μg each of pPICZαA-PGK and pPICZαA plasmids (pPICZαA plasmid was provided by Genscript Biotech).

[0056] 1.1 Design of inserted fragments:

[0057] Based on the amino acid sequence of phosphoglycerate kinase (S.rug.-PGK) from *S. rhubarb* (as shown in SEQ ID NO. 2), the strain to be expressed is *Pichia pastoris*, and codon optimization was performed accordingly. During optimization, the restriction endonuclease Sac I (208 bp) site was avoided as the linearization site; additionally, the restriction endonucleases EcoRI and SalI sites were also avoided, as these are the selected restriction sites for inserting the target gene.

[0058]

[0059] 1.2 Preparation of Escherichia coli DH5α competent cells:

[0060] (1) Remove E. coli DH5a from the -80℃ freezer, thaw, and inoculate into LB liquid medium at a concentration of 2% (v / v). Set the shaker temperature to 37℃ and the rotation speed to 180 rpm, and incubate for 12 hours to activate. (2) Inoculate into LB liquid medium at a concentration of 2% (v / v). Set the shaker temperature to 37℃ and the rotation speed to 200 rpm, and incubate for about 3 hours. (3) Add 1 mL of E. coli bacterial culture to a sterile EP tube, centrifuge at 4℃ and 4000 rpm for 5 minutes, and discard the supernatant. (4) Add 1 mL of 4℃ sterile 0.1M CaCl2 solution, carefully resuspend, incubate on ice for 30 minutes, centrifuge at 4℃ and 4000 rpm for 5 minutes, and discard the supernatant. (5) Add 1 mL of 4℃ cryopreservation solution, carefully resuspend, aliquot 0.1 mL into each new sterile EP tube, and store at -80℃.

[0061] 1.3 Transform the plasmid from step 1.1 into competent DH5α cells:

[0062] (1) Place E. coli DH5α competent cells for cloning on ice. (2) Take 1 μL of plasmids pPICZαA-PGK and pPICZαA (40 ng / μL concentration) and add them to 0.1 mL of competent cells in two tubes respectively. Gently tap the tube wall to mix and incubate on ice for 30 min. (3) Heat shock in a 42℃ water bath for 30 seconds, then immediately place on ice to cool for 2-3 min. (4) Add 900 μL of antibiotic-free LB medium and incubate at 37℃ and 200-250 rpm for 1 hour. (5) Preheat two LB solid media containing 100 μg / mL bleomycin in a 37℃ incubator. (6) Centrifuge at 2500×g for 5 min and discard 800 μL of supernatant. Resuspend and plate. (7) Incubate at 37℃ upright for 30 minutes to allow complete absorption of the bacterial solution, then invert and incubate for 12-16 hours. (8) Pick normally growing colonies from the two solid culture media and add them to two 5 mL liquid LB medium containing 5 μL of Zeocin. Incubate at 37℃ with shaking at 220 rpm for 12-16 h. (9) Take 500 μL of the two different cultured bacteria E. coli DH5a-pPICZαA-PGK and E. coli DH5a-pPICZαA liquid into 1.5 mL EP tubes, add 50% glycerol and mix, and store at -80℃.

[0063] 1.4 Plasmid extraction:

[0064] (1) Take 2 mL of overnight cultured E. coli DH5α-pPICZαA-PGK and E. coli DH5α-pPICZαA bacterial suspensions and place them in two different EP tubes. Centrifuge at 10000×g for 1 min at room temperature, discard the supernatant, and collect the bacteria. Repeat the operation twice. (2) Add 250 μL of Solution I and RNase A mixture and vortex to completely disperse the bacteria. (3) Add 250 μL of Solution II to the resuspension and gently invert several times to mix. If necessary, let the lysis buffer stand at room temperature for 2-3 min. (4) Add 350 μL of Solution III and gently invert several times until a white flocculent precipitate forms. Centrifuge at 13000g or higher for 10 min at room temperature. (5) Place the HiBindDNAMini Column into a 2 mL capless centrifuge tube. (6) Transfer no more than 700 μL of supernatant to the HiBindDNA Mini Column, centrifuge at maximum speed for 1 min at room temperature, and discard the filtrate. (7) Reassemble the HiBindDNA Mini Column into the collection tube, add 500 μL of HBC Buffer (correctly diluted with isopropanol), centrifuge at maximum speed for 1 min at room temperature, and discard the filtrate. (8) Reassemble the HiBindDNA Mini Column into the collection tube, add 700 μL of DNA Washing Buffer (correctly diluted with anhydrous ethanol), centrifuge at maximum speed for 1 min at room temperature, and discard the filtrate. Repeat the operation twice. (9) Reassemble the HiBindDNA Mini Column into the collection tube, centrifuge the empty column at maximum speed for 2 min at room temperature to remove the binding column matrix. (10) Transfer the HiBindDNA Mini Column to a clean 1.5 mL EP tube, add 30-100 μL of Elution Buffer to the binding column matrix, let stand for 5 min, and centrifuge at 13000×g for 1 min to elute the DNA. (11) The elution buffer in the EP tube after centrifugation contains plasmids pPICZαA-PGK and pPICZαA. Take 1 μL and use NanoDrop to determine the concentration of the two plasmids. The results show that the concentration of pPICZαA is 87.3 ng / μL and the concentration of pPICZαA-PGK is 81.7 ng / μL. (In order to better integrate the plasmids into the Pichia pastoris genome after subsequent transformation, it is necessary to determine the concentration of the extracted plasmids to ensure that 5 μg of linearized plasmids can be used for subsequent transformation.)

[0065] 1.5 Agarose gel electrophoresis was used to verify the size of the extracted plasmid:

[0066] (1) Preparation of agarose gel: For the conventional preparation of 25 mL of agarose gel, 0.25 g of UltraPure is required. Tm Mix agarose with 25 mL of 1×TAE in an Erlenmeyer flask and microwave for 4 min until clear. Cool the agarose solution to 50-60℃ and add 2.5 μL of GoldView nucleic acid dye (0.01%). Insert the comb and allow it to cool and solidify. (2) Prepare samples: Take 5 μL each of plasmids pPICZαA-PGK and pPICZαA, and add 1 μL of 6× loading buffer to each. (3) Run electrophoresis and check the results: Place the solidified agarose gel into the electrophoresis tank, ensuring that the wells of the gel are located at the negative electrode end of the electrophoresis tank (usually black); add an appropriate amount of 1×TAE electrophoresis buffer, ensuring that the buffer completely covers the surface of the gel; gently pull the comb while it is in the buffer; spot 5 μL of 15000 marker and load 6 μL of sample; turn on the power and start electrophoresis at 120V for 30 min; observe under UV light and take pictures.

[0067] The results are as follows Figure 1 As shown, the bands of plasmids pPICZαA and pPICZαA-PGK, as displayed by agarose gel electrophoresis, are located around 3596bp and 4772bp, respectively, which are basically consistent with the theoretical values ​​of the two plasmids.

[0068] 2. Construction of Pichia pastoris expression vector

[0069] 2.1 Preparation of Pichia pastoris electrocompetent cells:

[0070] (1) Streak two types of Pichia pastoris, K. phaffii X33 and K. phaffii GS115 glycerol culture, onto YPD solid plates. Incubate upside down for 2-5 days until white transformants appear. (2) Inoculation culture: Pick a single colony from the plate and inoculate it into a 5 mL test tube of antibiotic-free YPD liquid medium. Incubate overnight at 30°C and 220 rpm. (3) Re-inoculation culture: Take about 2 mL of bacterial culture and inoculate it into a new 50 mL flask of antibiotic-free YPD liquid medium (flask should be at least 250 mL). Incubate at 30°C and 220 rpm for about 12 h to allow the bacterial cells to reach OD500. 600(4) Pour the cultured bacterial solution into a 50mL sterile centrifuge tube (pre-cooled), centrifuge at 4℃, 5000rpm for 5min. (5) After centrifugation, quickly discard the supernatant, add 50mL ddH2O (pre-cooled), gently resuspend the bacterial cells, and centrifuge at 4℃, 5000rpm for 5min. (6) Repeat step 5, and wash the bacterial cells twice more. (7) Discard the supernatant completely, add 10mL 1M sorbitol (pre-cooled), gently resuspend the bacterial cells by pipetting, and centrifuge at 4℃, 5000rpm for 5min. (8) Discard the supernatant completely, add 1mL 1M sorbitol (pre-cooled), gently resuspend the bacterial cells by pipetting, aliquot into pre-cooled sterile 1.5mL EP tubes, aliquot 100μL / tube, do not add glycerol, and store at -80℃ for later use.

[0071] 2.2 Linearization of the initial plasmid and expression plasmid using the restriction endonuclease Sac I

[0072] The Sac I site is located downstream of the AOX1 promoter. This location was chosen for several reasons: after linearization, the foreign gene remains tightly connected to the AOX1 promoter, ensuring efficient transcription under methanol induction. If the restriction site were located in other non-regulated regions, it could lead to promoter failure; the AOX1 region is a high-frequency recombination site in the genome. After Sac I linearization, the AOX1 homologous arms (5'AOX1 and 3'AOX1) at both ends of the plasmid recombine efficiently with the chromosomal AOX1 region, significantly improving integration success. In the pPICZαA vector, Sac I is a single restriction site in the AOX1 promoter region, avoiding fragment complexity caused by multiple digestions. Therefore, plasmids pPICZαA and pPICZαA-PGK use the Sac I site on the AOX1 promoter for single digestion (linearization).

[0073] Prepare the reaction solution to ensure that the linearized plasmid for subsequent transfection into Pichia pastoris is 5 μg. Therefore, the specific volume of plasmid used needs to be calculated based on the concentration measured in step (11) of section 1.4 above. 1 μg of plasmid corresponds to 1 μL of Sac I enzyme, and the amount of enzyme can be directly selected as 5 μL. The amount of 10× Buffer added varies depending on the reaction system, ensuring that the final concentration is 1×. After gently mixing, centrifuge briefly and incubate at 37℃ for 15 min.

[0074] 2.3 Verify whether the plasmid has been cut

[0075] The agarose gel method is the same as in 1.5 of this example.

[0076] The results are as follows Figure 2 As shown, the products of plasmid pPICZαA and pPICZαA-PGK Sac I single enzyme digestion were analyzed by electrophoresis. Figure 2The presence of a single band, positioned higher than the undigested circular plasmid, indicates successful linearization.

[0077] 2.4 Transformation of two linearized plasmids into Pichia pastoris

[0078] (1) Take 5 μg of each of the two linear plasmids pPICZαA-PGK and pPICZαA, and add them to 100 μL of Pichia pastoris electroporation competent cells (competent cells thawed on ice). Add the mixture to a 0.1 cm electroporation cuvette (pre-cooled). Place the mixture in the cuvette on ice for 5 min. (2) Place the electroporation cuvette (make sure it is completely dry) into the electroporator. Set the electroporator to 1.5 kV, 25 μF, 200 Ω, and 5 ms. (3) After electroporation, quickly add 1 mL of 1 M sorbitol solution to the cuvette, gently aspirate and mix, transfer to a sterile centrifuge tube, and then incubate at 30 °C on a shaker for 2 h. (4) Centrifuge at 3000 × g for 5 min, discard the supernatant (900 μL), and keep less than 200 μL of supernatant for resuspension. (5) Spread YPD plates containing 100 μg / mL bleomycin (Zeocin) in a clean bench and incubate upside down at 30°C for 2-5 days until single colonies (milky white Pichia pastoris transformants) are formed. The four transformants are K. phaffii X33-pPICZαA-PGK, K. phaffii X33-pPICZαA, K. phaffii GS115-pPICZαA-PGK, and K. phaffii GS115-pPICZαA.

[0079] 2.5 Yeast colony PCR verification of transformation results

[0080] (1) PCR amplification and verification primers were designed using SnapGene software based on the gene sequence of phosphoglycerate kinase (S.rug.-PGK) and the MCS segment gene sequence unique to plasmid pPICZαA. The difference in TM value between the upstream and downstream primers should be less than 5℃. The primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd., as shown in Table 1.

[0081] Table 1 PCR amplification primers

[0082]

[0083]

[0084] (2) Pick a single colony and put it into 40 μL of 20 mM NaOH solution. In the PCR instrument, first heat it to 98℃ for 5 min, then cool it down to 12℃ for 1 min. Run five sets of temperature cycles. Then, aspirate 2 μL of the cell wall-broken bacterial solution for PCR amplification.

[0085] (3) The preparation of PCR reaction solution is shown in Table 2.

[0086] Table 2 Preparation of PCR reaction solution

[0087] reagents Usage Actual usage Final concentration PrimeSTAR MaxPremix (2×) 5μL 5μL 1× PrimerF 3pmol 0.3μL 0.3μM PrimerR 3pmol 0.3μL 0.3μM Template 2μL Sterilized water Up to 10 μL 2.4μL

[0088] (4) The PCR procedure is shown in Table 3.

[0089] Table 3 PCR Procedure

[0090]

[0091] 2.6 Agarose gel electrophoresis was used to verify whether the plasmid had recombined into the Pichia pastoris genome.

[0092] The agarose gel electrophoresis method is the same as in section 1.5 above, except that 5 μL of 5000 marker is spotted and 6 μL of sample is loaded. All other aspects are the same as in section 1.5 above.

[0093] The results are as follows Figure 3 As shown, single colonies of *K. phaffii* X33-pPICZαA-PGK and *K. phaffii* GS115-pPICZαA-PGK, validated by agarose gel electrophoresis, showed bands around 1248 bp. Single colonies of *K. phaffii* X33-pPICZαA and *K. phaffii* GS115-pPICZαA, validated by agarose gel electrophoresis, showed bands around 106 bp. This largely matches the theoretical value of 1248 bp for the *S. rug.-PGK* gene and the theoretical length of 106 bp for the MCS segment designed to be p-down using MCS-F / R primers. Furthermore, no contaminating bands were observed in the negative control, indicating that the PCR system was not contaminated.

[0094] Induced expression of 3 strains

[0095] 3.1 Single clone culture

[0096] Four single colonies of *Pichia pastoris*, *K. phaffii* X33-pPICZαA-PGK, *K. phaffii* X33-pPICZαA, *K. phaffii* GS115-pPICZαA-PGK, and *K. phaffii* GS115-pPICZαA, were selected and placed in four different 15ml test tubes. Each test tube contained 2ml of YPD medium with 2μL of Zeocin as seed culture. The test tubes were incubated at 30℃ and 220rpm for 16 hours. The results were observed under an optical microscope as follows: Figure 4 As shown, this indicates that the recombinant Pichia pastoris was not contaminated.

[0097] 3.2 Scale up cell culture with glycerol and collect cells

[0098] Four seed cultures were added to four 250 mL shake flasks containing 25 mL of BMGY medium, and cultured under the same conditions at 30 °C and 220 rpm for approximately 24 h until OD was reached. 600 Centrifuge at 2.4℃, 3400×g for 5 min, and wash twice with sterile water.

[0099] 3.3 Methanol-induced expression

[0100] Cells were centrifuged at 3400×g for 5 min at 4℃ and resuspended in 25 ml of BMMY medium. Cells were cultured at 30℃ and 220 rpm for 120 h (5 days), with methanol added daily to maintain a final concentration of 1% (250 μL of methanol added every 24 hours per bottle).

[0101] 3.4 Measure the final OD of the bacteria at the end of induction. 600

[0102] Dilute the induced bacterial culture 10-fold with BMMY medium, measure the absorbance at 600 using a microplate reader, add 200 μL to each well, and prepare three replicates for each bacterial strain. Use BMMY medium as a blank control. Record the values.

[0103] 4SDS-PAGE protein electrophoresis verification

[0104] 4.1 Estimating protein size

[0105] Estimated molecular weight of Myc Tag: 10 × 110 Da = 1100 Da.

[0106] The molecular weight of a single histidine is approximately 137 Da, therefore the estimated molecular weight of 6×His Tag is: 6×137=822 Da.

[0107] Theoretically, mature proteins ultimately secreted extracellularly should not contain the complete α-factor signal peptide. The protein fragment that can be expressed on the pPICZαA-PGK plasmid is 1311 bp in size. This fragment consists of a linker, the target gene fragment, the Myc tag, the linker, a 6×His tag, and a stop codon (which does not encode the protein). Therefore, the size of the protein that can be expressed is (1311 - 3 × 10 - 3 × 6) ÷ 3 × 110 Da + 1100 Da + 822 Da = 48232 Da = 48.232 KD.

[0108] Although the signal peptide is designed to be removed, incomplete processing can sometimes occur, resulting in parts of the protein still containing portions of the signal peptide sequence. This may be related to the characteristics of the target protein itself.

[0109] The final molecular weight of the expressed protein is around 49 kDa, which also depends on the levels of phosphorylation and glycosylation.

[0110] 4.2 Preparation of enzyme solution and standard protein samples

[0111] Four strains were induced in shake flasks for 120 h, then transferred to centrifuge tubes and centrifuged at 3000×g for 10 min at 4 °C. The BMMY culture supernatant was used for SDS-PAGE.

[0112] Prepare BSA concentrations of 1.5, 1, 0.5, 0.3, 0.2, 0.1, and 0 mg / mL. Since the protein samples are in BMMY medium, the standards should also be diluted with BMMY medium.

[0113] 4.3 SDS-PAGE protein electrophoresis

[0114] Recombinant Pichia pastoris engineered strains K. phaffii X33-pPICZαA, K. phaffii X33-pPICZαA-PGK, K. phaffii GS115-pPICZαA, and K. phaffii GS115-pPICZαA-PGK were induced to express proteins. After centrifugation, the supernatant from the BMMY sample was used for SDS-PAGE protein electrophoresis. The results after staining and destaining are as follows: Figure 5 As shown. Figure 5 Lanes 1, 2, 5, and 6 served as the control group, showing no protein expression. Lanes 3, 4, 7, and 8 contained bands between 50 kDa and 70 kDa, representing the target gene S.rug.-PGK protein. These bands were relatively thick and clear, largely consistent with the theoretical target protein size of approximately 58 kDa, indicating that S.rug.-PGK protein could be successfully expressed in the clones.

[0115] 4.4 Estimation of protein concentration using SDS-PAGE protein bands

[0116] Open ImageJ software to process protein electrophoresis images. Image processing requires background removal. For each band, record its mean gray value. Generally, optical density is inversely proportional to band concentration; the stronger the band, the lower the mean gray value.

[0117] 5. Bradford assay for PGK protein expression

[0118] 5.1 Prepare protein standards

[0119] Prepare protein standards at concentrations of 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / mL. Since the protein samples are in BMMY medium, the standards should also be diluted with BMMY medium.

[0120] 5.2 Determination of protein concentration

[0121] Add 10 μL of protein standards of different concentrations to the protein standard wells of a 96-well plate. Add 10 μL of sample to the protein standard wells of a 96-well plate. Add 300 μL of G250 staining solution to each well, and measure A595 using a microplate reader within 30 minutes, recording the result. Calculate the protein concentration in the sample based on the standard curve and the sample volume used.

[0122] The results of the above expression assays are as follows:

[0123] Expression results of plasmid pPICZαA-PGK in Pichia pastoris GS115:

[0124] (1) Cell concentration after induction

[0125] The induced K. phaffii GS115-pPICZαA-PGK and K. phaffii GS115-pPICZαA bacterial cultures were diluted 10-fold with BMMY medium, and the absorbance was measured at 600 using a microplate reader. 200 μL was added to each well, with three replicates for each bacterial strain. BMMY medium was used as a blank control. Recorded values ​​are shown in Table 4.

[0126] Table 4. Concentration of bacterial solution after fermentation of GS115 engineered bacteria.

[0127]

[0128] Therefore, the OD of the engineered K. phaffii GS115-pPICZαA bacteria can be calculated. 600 The OD value of the engineered K. phaffiiGS115-pPICZαA-PGK strain was 9.36. 600 It is 10.02.

[0129] (2) SDS-PAGE estimation of protein concentration

[0130] Open ImageJ software to process SDS-PAGE adhesive. Figure 6 Type was set to 8-bit and background removed; the results are shown below. Figure 7 Record the gray value (Mean Gray Value) of each band in Table 5, and use the standard protein curves to plot protein concentration and gray value (Mean Gray Value). Figure 8 The concentration of the extracellular expressed protein PGK of K. phaffii GS115-pPICZαA-PGK was read.

[0131] The average value of the measured grayscale value of S.rug.-PGK was calculated to be 236.611. Substituting this value into the standard equation, the concentration of PGK protein produced by the engineered bacteria K.phaffii GS115-pPICZαA-PGK was calculated to be 0.276 g / L.

[0132] Table 5. Gray values ​​of BSA standard protein samples and GS115-produced S.rug.-PGK protein bands.

[0133]

[0134] (3) Bradford method for determining protein concentration

[0135] The absorbance (A595) of the standard protein after reaction with G250 staining solution was measured using an ELISA reader and recorded in Table 6. A standard protein curve was then plotted based on protein concentration and A595. Figure 9 The concentration of the extracellular expressed protein S.rug.-PGK of K. phaffii GS115-pPICZαA-PGK was read.

[0136] The average absorbance (A595) of S.rug.-PGK after reaction with G250 staining solution, measured by an ELISA reader, was 1.275. Substituting this into the standard equation, the concentration of the extracellular expressed protein S.rug.-PGK of K.phaffii GS115-pPICZαA-PGK was calculated to be 0.263 g / L.

[0137] Table 6. A595 after BSA standard protein sample reacted with G250

[0138]

[0139] Expression results of plasmid pPICZαA-PGK in Pichia pastoris X33:

[0140] (1) Cell concentration after induction

[0141] The induced K. phaffii X33-pPICZαA-PGK and K. phaffii X33-pPICZαA bacterial cultures were diluted 10-fold with BMMY medium, and the absorbance was measured at 600 using a microplate reader. 200 μL was added to each well, with three replicates for each bacterial strain. BMMY medium was used as a blank control. Recorded values ​​are shown in Table 7.

[0142] Table 7. Concentration of bacterial solution after fermentation of X33 engineered bacteria.

[0143]

[0144] Therefore, the OD of the engineered K. phaffii X33-pPICZαA bacteria can be calculated. 600The OD value of the engineered strain K. phaffii X33-pPICZαA-PGK (S.rug.) was 9.75. 600 It is 10.05.

[0145] (2) SDS-PAGE estimation of protein concentration

[0146] Open ImageJ software to process SDS-PAGE adhesive. Figure 10 Select 8-bit for Type and remove background. Record the Mean Gray Value of each band in Table 8, and use a standard protein curve to plot protein concentration and Mean Gray Value. Figure 11 The concentration of the extracellular expressed protein S.rug.-PGK of K.phaffii X33-pPICZαA-PGK was read.

[0147] The average value of the measured grayscale value of PGK(S.rug.) was calculated to be 243.44. Substituting this value into the standard equation, the concentration of S.rug.-PGK protein produced by the engineered bacteria K.phaffii X33-pPICZαA-PGK(S.rug.) was calculated to be 0.291 g / L.

[0148] Table 8. Gray values ​​of BSA standard protein samples and X33-produced S.rug.-PGK protein bands.

[0149]

[0150] (3) Bradford method for determining protein concentration

[0151] The absorbance (A595) of the standard protein after reaction with G250 staining solution was measured using an ELISA reader and recorded in Table 9. A standard protein curve was then plotted based on protein concentration and A595. Figure 12 The concentration of the extracellular expressed protein S.rug.-PGK of K.phaffii X33-pPICZαA-PGK was read.

[0152] The average absorbance (A595) of S.rug.-PGK after reaction with G250 staining solution, measured by an ELISA reader, was 1.341. Substituting this into the standard equation, the concentration of the extracellular expressed protein S.rug.-PGK of K.phaffii GS115-pPICZαA-PGK can be calculated to be 0.299 g / L.

[0153] Table 9. A595 after BSA standard protein sample reacted with G250

[0154]

[0155] Expression results of protein S.rug.-PGK in Pichia pastoris

[0156] Comparing the data on S.rug.-PGK protein produced by each bacterium in Table 10, it can be seen that K. phaffii X33 is the most suitable host for extracellular expression of S.rug.-PGK.

[0157] Table 10. Expression results of protein S.rug.-PGK in different Pichia pastoris.

[0158]

[0159] 6. Optimization of cultivation conditions

[0160] 6.1 Effects of different species of Pichia pastoris on protein expression levels

[0161] Compare the extracellular expression results of K. phaffii X33-pPICZαA-PGK, K. phaffii X33-pPICZαA, K. phaffii GS115-pPICZαA-PGK, and K. phaffii GS115-pPICZαA.

[0162] 6.2 Optimization of Induction Timing

[0163] According to the yeast culture manual, yeast is usually inoculated into BMGY medium and cultured to OD. 600 Induction was performed when the OD value reached approximately 1-4, therefore this experiment was designed with OD... 600 The culture medium was changed to BMMY at 2 and 4 times respectively for induction, and the effect on the final extracellular expression level of the protein was compared.

[0164] 6.3 Optimization of inducer dosage

[0165] According to the yeast culture manual, when inducing yeast in BMMY medium, the methanol concentration is generally controlled at 1%. After determining the optimal induction time, we will set up three gradients of methanol concentrations of 0.5%, 1%, and 1.5% to study their effects on the final extracellular protein expression level.

[0166] The above induction results are as follows:

[0167] The bacterial concentrations of K. phaffii X33-pPICZαA-PGK under different conditions at the end of induction:

[0168] Set OD at the start of induction 600The induction gradients were set at 2 and 4, as well as at methanol concentrations of 0.5%, 1%, and 1.5% during induction. After induction, K. phaffii X33-pPICZαA-PGK bacterial suspensions under different conditions were diluted tenfold with BMMY medium. The absorbance was measured at 600 nm using a microplate reader. 200 μL was added to each well, with three replicates for each bacterial strain. A blank control was prepared using BMMY medium. Recorded values ​​are shown in Table 11. Therefore, the OD values ​​of K. phaffii X33-pPICZαA-PGK bacterial suspensions under different conditions could be calculated. 600 .

[0169] Table 11 Concentrations of the bacterial culture after fermentation of X33 engineered bacteria under different conditions

[0170]

[0171]

[0172] SDS-PAGE estimation of protein concentration:

[0173] Open ImageJ software to process SDS-PAGE adhesive. Figure 13 Includes OD at the start of induction 600 =2. The concentrations of the inducing agent methanol were 0.5%, 1%, and 1.5%, and the SDS-PAGE gel was used. Figure 14 Includes OD at the start of induction 600 =4. The methanol concentration of the inducer was 0.5%, 1%, and 1.5%, and the Type was selected as 8-bit with background removal. The gray value of each band was recorded in Table 12, and a standard protein curve was generated using protein concentration and gray value. Figure 15 and Figure 16 The concentration of the extracellular expressed protein S.rug.-PGK of K. phaffii X33-pPICZαA-PGK was read under different fermentation conditions.

[0174] Table 12 Gray values ​​of BSA standard protein samples and X33-produced S.rug.-PGK protein bands under different conditions

[0175]

[0176] The concentrations of S.rug.-PGK produced by the K. phaffii X33-pPICZαA-PGK engineered bacteria under different conditions were calculated by substituting into the standard equation, as shown in Table 13.

[0177] Table 13 Concentration of S.rug.-PGK protein produced by X33 under different conditions.

[0178]

[0179] Bradford method for determining protein concentration:

[0180] The absorbance (A595) of the standard protein after reaction with G250 staining solution was measured using an ELISA reader and recorded in Table 14. A standard protein curve was then plotted based on protein concentration and A595. Figure 17 The concentration of the extracellular expressed protein S.rug.-PGK of K. phaffii X33-pPICZαA-PGK was read under different conditions.

[0181] Table 14. A595 after BSA standard protein sample reacted with G250

[0182]

[0183] The average absorbance (A595) of S.rug.-PGK(X33) after reacting with G250 staining solution under different conditions, as measured by an ELISA reader, is shown in Table 15. The concentration of the extracellular expressed protein S.rug.-PGK of K.phaffii GS115-pPICZαA-PGK under different conditions can be calculated by substituting it into the standard equation.

[0184] Table 15 Concentration of S.rug.-PGK protein produced by X33 under different conditions.

[0185]

[0186] Expression results of protein S.rug.-PGK in Pichia pastoris X33 under different conditions:

[0187] Comparing the data on S.rug.-PGK protein production in Pichia pastoris X33 under different conditions in Table 16, it can be seen that selecting the OD of the induction starter culture... 600 The optimal concentration of methanol as the inducer during induction is 1%, with a value of 2.

[0188] Table 16 Concentration of S.rug.-PGK protein produced by X33 under different conditions.

[0189]

[0190] The above results indicate that this invention achieves efficient secretory expression of S.rug.-PGK in Pichia pastoris, clearly demonstrating the effectiveness of Pichia pastoris strain X33 in OD... 600 The optimal production system is defined as 2% methanol and 1% methanol as the inducing agent, laying the foundation for large-scale preparation.

[0191] Example 2

[0192] 1. Construction and chimeric signal peptide recombinant expression plasmid

[0193] 1.1 Preparation of linearized cloning vectors by reverse PCR:

[0194] (1) PCR linearization primers were designed using SnapGene software based on the gene sequence of plasmid pPICZαA-PGK (prepared in Example 1). The primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd., as shown in Table 17.

[0195] Table 17 PCR Amplification Primers

[0196] Primer name Primer sequence (5' to 3') ZaA-promoter-F ATGAGATTTCCTTCAATTTTTACTGC(SEQ ID NO.10) ZaA-promoter-R TGATCTCATGACCAAAATCCCTT(SEQ ID NO.11) ZaA-signal-F gctccagtcaacactacaacagaag(SEQ ID NO.12) ZaA-signal-R cgtttcgaataattagttgttttttga(SEQ ID NO.13)

[0197] (2) The concentration of plasmid pPICZαA-PGK is 81.7 ng / μL. A large amount of it has been extracted in the previous chapter and stored in a -20℃ freezer. It can be used directly after thawing.

[0198] (3) The preparation of PCR reaction solution is shown in Table 18.

[0199] Table 18 Preparation of PCR Reaction Solution

[0200]

[0201]

[0202] (4) The PCR reaction procedure is shown in Table 19.

[0203] Table 19 PCR Reaction Procedure

[0204]

[0205] (5) Purification: Add 1 μL of DPN 1 to each of the two systems that have been PCR completed, and let stand at 37℃ for 2 h to consume the template plasmid.

[0206] (6) Agarose gel electrophoresis

[0207] The agarose gel electrophoresis experiment is the same as section 1.5 of Example 1, except that: ② Sample preparation: Take 50 μL of PCR product and add 10 μL of 6× loading buffer. Spot 5 μL of 5000 marker and load 60 μL of sample. The rest is the same as section 1.5 of Example 1.

[0208] The results are as follows Figure 18 As shown, the PCR product band observed by agarose gel electrophoresis was located around 4715 bp, which is basically consistent with the theoretical length. The original plasmid pPICZαA-PGK, at 4772 bp, is longer than the reverse PCR product, which is as expected. Meanwhile, no impurity bands were observed in the negative control, indicating that the PCR system was not contaminated.

[0209] (7) Glue recycling

[0210] ① Add Buffer GM to three times the volume (mL) of the gel (mg). ② Thaw by shaking at 37℃. ③ Then, attach the gel purification column to an open EP tube, add 700 μL of the thawed liquid, centrifuge at 12000 rpm for 1 min, and discard the filtrate. ④ Add 700 μL of Buffer WB, centrifuge at 12000 rpm for 30 sec, discard the filtrate, and repeat the operation twice. ⑤ Centrifuge the empty column at 12000 rpm for 1 min, and discard the filtrate. ⑥ Replace with the lower layer tube and allow the alcohol to evaporate for 5 min. ⑦ Add ddH2O, centrifuge at 12000 rpm for 1 min, and collect the liquid in the bottom tube, which is the DNA solution. ⑧ Measure the concentration of the recovered DNA using Nanodrop; the concentration is only reliable when the A260 / A280 ratio is between 1.8 and 2.0.

[0211] 1.2 Preparation of Insert Fragments Using Homologous Recombination Primers

[0212] (1) PCR linearization primers were designed using SnapGene software based on the gene sequences of signal peptides PROSCW10, ExpLKR, INU1, OST1 and SCW10. The primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd., as shown in Table 20.

[0213] Table 20 PCR Amplification Primers

[0214]

[0215]

[0216] (2) The nucleotide sequences of the following peptides were sequentially linked to synthesize a long fragment signal (nucleotide sequence as shown in SEQ ID NO.1): SCW10 signal peptide (nucleotide sequence as shown in SEQ ID NO.14), cell wall protein signal peptide PROSCW10, bacterial high-efficiency secretion peptide ExPLKR (nucleotide sequence as shown in SEQ ID NO.15), inulinase signal peptide INU1 (nucleotide sequence as shown in SEQ ID NO.16), and oligosaccharide transferase signal peptide OST1 (nucleotide sequence as shown in SEQ ID NO.17). The sequence of lines (tttgattctagctattgcagcagcttccgccgttgtctcagctgctccagttgctccagccgaagaggcagcaaaccacttgcacaagcgtatgaagttagcatactccct cttgcttccattggcaggagtcagtgcttcagttatcaattacaagagaatgaggcaggtttggttctcttggattgtgggattgttcctatgttttttcaacgtgtcttctgct) was then inserted into plasmid pPIC 9k using SnaBI and NotI restriction enzymes to form plasmid pPIC 9k-signal. This process was performed by GenScript. Using plasmid pPIC 9k-signal as a template, the five required signal peptides were obtained by PCR. The plasmid was then diluted to 40 ng / μL before use.

[0217] (3) The PCR reaction solution is prepared as shown in Table 18. (4) The PCR reaction procedure is shown in Table 19. (5) Purification: Add 1 μL of DPN 1 to the PCR-completed system, incubate at 37℃ for 2 h to consume the template plasmid. (6) The agarose gel electrophoresis method is the same as in section 1.1 of this example.

[0218] The results are as follows Figure 19 As shown, the PCR products of signal peptides PROSCW10, Expl KR, INU1, OST1, and SCW10, when analyzed by agarose gel electrophoresis, showed bands around 93bp, 108bp, 69bp, 66bp, and 54bp, respectively, which are basically consistent with the theoretical lengths. Meanwhile, no extraneous bands were observed in the negative control, indicating that the PCR system was not contaminated.

[0219] This embodiment uses a seamless cloning (single-fragment recombination) method to replace the base sequence atgagatttccttcaatttttactgctgttttattcgcagcatcctccgcattagct (SEQ ID NO. 4) of the -alpha-factor secretion signal (α-signal peptide) in the pPICZαA-PGK plasmid with the base sequences of signal peptides PROSCW10, ExPL KR, INU1, OST1, and SCW10, respectively. The latter half of the α-signal peptide base sequence is retained.

[0220] gctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttcc aacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagct (SEQ ID NO. 29), therefore, signal peptides PROSCW10-α, ExpLKR-α, INU1-α, OST1-α, and SCW10-α are simply the base sequences of signal peptides PROSCW10, ExpLKR, INU1, OST1, and SCW10 combined with the latter half of the retained α signal peptide base sequence.

[0221] (7) Gel recovery: ① Add Buffer GM to three times the volume (mL) of the gel (mg). ② Thaw by shaking at 37℃. ③ Then, place the gel purification column onto an uncapped EP tube, add 700 μL of the thawed liquid, centrifuge at 12000 rpm for 1 min, and discard the filtrate. ④ Add 700 μL of Buffer WB, centrifuge at 12000 rpm for 30 sec, discard the filtrate, and repeat the operation twice. ⑤ Centrifuge the empty column at 12000 rpm for 1 min, and discard the filtrate. ⑥ Replace the lower layer tube and evaporate the alcohol for 5 min. ⑦ Add ddH2O, centrifuge at 12000 rpm for 1 min, and collect the liquid in the bottom tube, which is the DNA solution. ⑧ Measure the concentration of the recovered DNA using Nanodrop; the concentration is only reliable when the A260 / A280 ratio is between 1.8 and 2.0.

[0222] 1.3 Single-segment recombination

[0223] The optimal amount of cloning vector (0.003 pmol) and insert fragment (0.006 pmol) were determined. The optimal amount of cloning vector is equal to 0.02 times the number of cloning base pairs (ng), and the optimal amount of insert fragment is equal to 0.04 times the number of cloning base pairs (ng). Therefore, the corresponding amounts of cloning vector and insert fragment for the promoter recombinant expression plasmid and the chimeric signal peptide recombinant expression plasmid can be calculated, as shown in Table 21.

[0224] Table 21. Amounts of each fragment used in the recombinant reaction.

[0225]

[0226]

[0227] After the calculations are completed and the reaction system is prepared according to Table 22, heat at 50°C for 5-15 minutes and then immediately cool to 4°C or place on ice to cool. The recombinant product can be stored at -20°C for one week.

[0228] Table 22 Single-Fragment Recombination System

[0229]

[0230] 1.4 Transformation of Recombinant Products

[0231] (1) Place the competent Escherichia coli DH5α cells for cloning on ice. (2) Add 5-10 μL of recombinant product to 100 μL of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. (3) After heat shock in a 42℃ water bath for 30 sec, immediately place on ice to cool for 2-3 min. (4) Add 900 μL of LB liquid medium (without antibiotics), and shake at 37℃ for 1 h at 200-150 rpm. (5) Preheat 7 LB solid medium plates containing zeocin in an incubator at 37℃. (6) Centrifuge at 5000 rpm for 5 min, discard 900 μL of supernatant. Resuspend and plate. (7) Incubate upside down at 37℃ for 12-16 h.

[0232] 1.5 Identification of Recombinant Products

[0233] (1) Colony PCR: Pick a single clone and mix it into 10 μL ddH2O as a template for colony PCR. (2) The upstream primers for PCR amplification of plasmids pPICZA-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK and pPICZA-SCW10-α-PGK are shown in Table 23. The primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd., and the downstream primers were all PGK-R.

[0234] Table 23 PCR Amplification Primers

[0235] Primer name Primer sequence (5' to 3') PROSCW10-α-F ATGCAAGTTAAATCTATCGTTAACCTACT(SEQ ID NO.30) ExpLKR-α-F ATGAAGCTCTCCACCAATTTGATT(SEQ ID NO.31) INU1-F ATGAAGTTAGCATACTCCCTCTTGC(SEQ ID NO.32) OST1-F ATGAGGCAGGTTTGGTTCTCTTG(SEQ ID NO.33) SCW10-F ATGCAAGTTAAATCTATCGTTAACCTACT(SEQ ID NO.34)

[0236] (3) The preparation of PCR reaction solution is shown in Table 24.

[0237] Table 24 Preparation of PCR Reaction Solution

[0238]

[0239]

[0240] (4) The PCR reaction procedure is shown in Table 19.

[0241] (5) The agarose gel electrophoresis method is the same as in section 1.1 of this example, except that ② sample preparation: take 5 μL of PCR product and add 1 μL of 6× loading buffer. The rest is the same as in section 1.1 of this example.

[0242] The results are as follows Figure 20 As shown, the PCR products of the chimeric signal peptide recombinant expression plasmids pPICZA-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK, and pPICZA-SCW10-α-PGK, as well as the bands observed by agarose gel electrophoresis, were located around 1557bp, 1572bp, 1533bp, 1530bp, and 1518bp, respectively, which is basically consistent with the theoretical length. Meanwhile, no extraneous bands were observed in the negative control, indicating that the PCR system was not contaminated.

[0243] 1.6 Plasmid Extraction

[0244] (1) Take 2 mL of overnight culture of five different E. coli strains containing different plasmids and place them in separate EP tubes. Centrifuge at 10000×g for 1 min at room temperature, discard the supernatant, and collect the bacteria. Repeat the operation twice. (2) Add 250 μL of Solution I and RNase A mixture and vortex to completely disperse the bacteria. (3) Add 250 μL of Solution II to the resuspension and gently invert several times to mix. If necessary, let the lysate stand at room temperature for 2-3 min. (4) Add 350 μL of Solution III and gently invert several times until a white flocculent precipitate forms. Centrifuge at 13000g or higher for 10 min at room temperature. (5) Place the HiBindDNAMini Column into a 2 mL open centrifuge tube. (6) Transfer no more than 700 μL of supernatant to the HiBindDNAMini Column, centrifuge at the maximum speed for 1 min at room temperature, and discard the filtrate. (7) Reassemble the HiBind DNA Mini Column into the collection tube, add 500 μL of HBC Buffer (correctly diluted with isopropanol), centrifuge at maximum speed for 1 min at room temperature, and discard the filtrate. (8) Reassemble the HiBind DNA Mini Column into the collection tube, add 700 μL of DNA Washing Buffer (correctly diluted with anhydrous ethanol), centrifuge at maximum speed for 1 min at room temperature, and discard the filtrate. Repeat the operation twice. (9) Reassemble the HiBind DNA Mini Column into the collection tube, centrifuge the empty column at maximum speed for 2 min at room temperature to remove the binding column matrix. (10) Place the HiBind DNA Mini Column into a clean 1.5 mL EP tube, add 30-100 μL of Eluent Buffer to the binding column matrix, let stand for 5 min, and centrifuge at 13000×g for 1 min to elute the DNA. (11) The eluent in the EP tube after centrifugation is the plasmid. Take 1 μL and use NanoDrop to determine the concentration of the two plasmids and record the results. The results are shown in Table 25.

[0245] Table 25 Concentrations of plasmids pPICZαA and pPICZαA-PGK (S.rug.)

[0246] plasmid name Concentration (ng / μL) pPICZA-PROSCW10-α-PGK 156 pPICZA-ExpLKR-α-PGK 172 pPICZA-INU1-α-PGK 187 pPICZA-OST1-α-PGK 248 pPICZA-SCW10-α-PGK 169

[0247] Plasmids were extracted from engineered *E. coli* strains *E. coli* DH5α-pPICZA-PROSCW10-α-PGK*, *E. coli* DH5α-pPICZA-ExpL KR-α-PGK*, *E. coli* DH5α-pPICZA-INU1-α-PGK*, *E. coli* DH5α-pPICZA-OST1-α-PGK*, and *E. coli* DH5α-pPICZA-SCW10-α-PGK*, which were transformed with five recombinant signal peptide expression plasmids. The agarose gel electrophoresis results are as follows: Figure 21 As shown, the bands of plasmids pPICZ A-PROSCW10-α-PGK, pPICZA-ExpL KR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK, and pPICZ A-SCW10-α-PGK, as shown by agarose gel electrophoresis, are located around 4808bp, 4823bp, 4787bp, 4781bp, and 4769bp, respectively, which are basically consistent with the theoretical values ​​of the two plasmids.

[0248] 2. Construction of Pichia pastoris expression vector

[0249] 2.1 Preparation of Pichia pastoris electrocompetent cells

[0250] (1) Streak Pichia pastoris K. phaffii X33 glycerol culture onto YPD solid plates. Incubate upside down for 2-5 days until white transformants appear. (2) Inoculation culture: Pick a single colony from the plate and inoculate it into a 5 mL test tube of antibiotic-free YPD liquid medium. Incubate overnight at 30°C and 220 rpm on a shaker. (3) Re-inoculation culture: Take about 2 mL of bacterial culture and inoculate it into a new 50 mL flask of antibiotic-free YPD liquid medium (flask at least 250 mL). Incubate at 30°C and 220 rpm on a shaker for about 12 h until the bacterial OD600 reaches between 1.2 and 1.5. (4) Pour the cultured bacterial culture into a 50 mL sterile centrifuge tube (pre-cooled). Centrifuge at 4°C and 5000 rpm for 5 min. (5) After centrifugation, quickly discard the supernatant, add 50 mL of ddH2O (pre-cooled), gently resuspend the bacterial cells, and centrifuge at 4°C and 5000 rpm for 5 min. (6) Repeat step 5 and wash the bacterial cells twice more. (7) Discard the supernatant completely, add 10 mL of 1M sorbitol (pre-cooled), gently resuspend the bacterial cells by pipetting, and centrifuge at 5000 rpm for 5 min at 4°C. (8) Discard the supernatant completely, add 1 mL of 1M sorbitol (pre-cooled), gently resuspend the bacterial cells by pipetting, and aliquot into pre-cooled sterile 1.5 mL EP tubes at 100 μL / tube. Do not add glycerol and store at -80°C for later use.

[0251] 2.2 Linearization of five chimeric signal peptide recombinant expression plasmids using the restriction endonuclease Pem I

[0252] Prepare the reaction solution, ensuring that the linearized plasmids subsequently introduced into Pichia pastoris are all greater than or equal to 5 μg. Therefore, the specific volume of plasmid used needs to be calculated based on the concentration measured in step 11 of section 1.6 above. 1 μg of plasmid corresponds to 1 μL of Pem I enzyme, so the amount of enzyme can be directly selected as 5 μL. The amount of 10× Buffer added will vary depending on the reaction system; ensure the final concentration is 1×. After adding each liquid in sequence, gently pipette or tap the tube wall to mix (do not vortex), then briefly centrifuge to allow the liquid to settle to the bottom. Gently mix and briefly centrifuge again, then incubate at 37°C for 15 min. A water bath is preferred for the enzyme digestion reaction, as the reaction temperature is usually more constant.

[0253] 2.3 Verify whether the plasmid has been cut

[0254] The agarose gel method is the same as 1.5 in Example 1.

[0255] The results are as follows Figure 22 As shown, the Pem I single enzyme digestion products of plasmids pPICZA-PROSCW10-α-PGK, pPICZA-ExpLKR-α-PGK, pPICZA-INU1-α-PGK, pPICZA-OST1-α-PGK, and pPICZA-SCW10-α-PGK were analyzed by electrophoresis. Figure 22 The presence of a single band, positioned higher than the undigested circular plasmid, indicates successful linearization.

[0256] 2.4 Transformation of linearized plasmids into Pichia pastoris

[0257] (1) Take 5 μg of each of the five chimeric signal peptide recombinant expression plasmids, and add them to 100 μL of Pichia pastoris electroporation competent cells (competent cells thawed on ice). Add the mixture to a 0.1 cm electroporation cuvette (pre-cooled). Place the mixture in the cuvette on ice for 5 min. (2) Place the electroporation cuvette (make sure it is completely dry) into the electroporator. Set the electroporator to 1.5 kV, 25 μF, 200 Ω, and 5 ms. (3) After electroporation, quickly add 1 mL of 1 M sorbitol solution to the cuvette, gently aspirate and mix, transfer to a sterile centrifuge tube, and then incubate at 30 °C on a shaker for 2 h. (4) Centrifuge at 3000 × g for 5 min, discard the supernatant (900 μL), and keep less than 200 μL of supernatant for resuspension. (5) Spread YPD plates containing 100 μg / mL bleomycin (Zeocin) in a clean bench and incubate upside down at 30°C for 2-5 days until single colonies (milky white Pichia pastoris transformants) are formed. The five transformants are K. phaffii X33-pPICZ A-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpLKR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK.

[0258] 2.5 Yeast colony PCR verification of transformation results

[0259] (1) Based on the gene sequence of phosphoglycerate kinase (S.rug.-PGK) and the gene sequences of signal peptides in five chimeric signal peptide recombinant expression plasmids, PCR amplification verification primers were designed using SnapGene software. The primers are shown in the design in 1.5 (2). (2) Single colonies were picked and placed into 40 μL of 20 mM NaOH solution. The PCR instrument was heated to 98℃ and held for 5 min, then cooled to 12℃ and held for 1 min. Five sets of temperature cycles were run. 2 μL of the cell wall-broken bacterial solution was aspirated for PCR amplification. (3) The PCR reaction solution was prepared as shown in Table 24. (4) The PCR system was shown in Table 19.

[0260] 2.6 Agarose gel electrophoresis was used to verify whether the plasmid had recombined into the Pichia pastoris genome.

[0261] The agarose gel method is the same as in section 1.5 of this example.

[0262] The results are as follows Figure 23As shown, single colonies of *K. phaffii* X33-pPICZ A-PROSCW10-α-PGK, *K. phaffii* X33-pPICZA-ExpLKR-α-PGK, *K. phaffii* X33-pPICZA-INU1-α-PGK, *K. phaffii* X33-pPICZA-OST1-α-PGK*, and *K. phaffii* X33-pPICZ A-SCW10-α-PGK were analyzed by agarose gel electrophoresis. The band positions were approximately 1557 bp, 1572 bp, 1533 bp, 1530 bp, and 1518 bp, respectively. Meanwhile, no extraneous bands were observed in the negative control, indicating that the PCR system was not contaminated.

[0263] Induced expression of 3 strains

[0264] 3.1 Single clone culture

[0265] Five single colonies of Pichia pastoris were selected: K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK. Each colony was placed in a separate 15ml test tube, and 2ml of YPD medium containing 2μL Zeocin was added to each tube as a seed culture. The tubes were incubated at 30℃ and 220rpm for 16 hours.

[0266] 3.2 Scale up cell culture with glycerol and collect cells

[0267] Five seed cultures were added to five 250 mL shake flasks containing 25 mL of BMGY medium and incubated under the same conditions (30 °C and 220 rpm) for approximately 24 hours until OD was reached. 600 Centrifuge at 2.4℃, 3400×g for 5 min, and wash twice with sterile water.

[0268] 3.3 Methanol-induced expression

[0269] Cells were centrifuged at 3400×g for 5 min at 4℃ and resuspended in 25 ml of BMMY medium. Cells were cultured at 30℃ and 220 rpm for 120 h (5 days), with methanol added daily to maintain a final concentration of 1% (250 μL of methanol added every 24 hours per bottle).

[0270] 3.4 Measure the final OD of the bacteria at the end of induction. 600

[0271] Dilute the induced bacterial culture 10-fold with BMMY medium, measure the absorbance at 600 using a microplate reader, add 200 μL to each well, and prepare three replicates for each bacterial strain. Use BMMY medium as a blank control. Record the values.

[0272] 4SDS-PAGE protein electrophoresis verification

[0273] 4.1 Preparation of enzyme solution and standard protein samples

[0274] Five bacterial strains were induced in shake flasks for 120 h, then transferred to centrifuge tubes and centrifuged at 3000×g for 10 min at 4 °C. The BMMY culture supernatant was used for SDS-PAGE. A 0.25 mg / mL solution of BSA was prepared. Since the protein samples were in BMMY medium, the standards should also be diluted with BMMY medium.

[0275] 4.2 SDS-PAGE protein electrophoresis

[0276] (1) Preparation of SDS-PAGE gel: Clean the gel plate successively with dish soap, tap water, and ddH2O. Clamp the gel plate, check for leaks with ddH2O, pour off the ddH2O, and blot off any remaining water with paper. Take 5 mL each of the lower gel solution and lower gel buffer, mix well, add 100 μL of the modified coagulant accordingly, mix well, and prepare 10 mL of 12% separating gel. Add the separating gel to the gel plate, add 70% alcohol and press for 5 min, pour off the alcohol, and blot off any remaining liquid with paper. When a crease appears between the gel and alcohol, it indicates that the gel has solidified. Take 2 mL each of the upper gel solution and upper gel buffer, mix well, add 40 μL of the modified coagulant accordingly, mix well, and prepare 4 mL of stacking gel. Insert the comb, let stand for 10 min, and after the upper gel has solidified, remove the comb and use it. Immerse it in ddH2O and store it in a 4℃ refrigerator for later use. (2) Prepare 1× electrophoresis buffer (store at 4℃, recyclable): Add 3.02g Tris, 14.4g glycine and 1g SDS, stir with a rotor to dissolve, and bring the volume to 1L with ddH2O. (3) Loading the tank: When clamping the plates, make sure to clamp a symmetrical plate if there is only one gel. After placing the tank, fill the space between the plates with electrophoresis buffer and pour an appropriate amount outside the plates. (4) Sample processing: Mix 12μL of culture medium supernatant or BSA protein standard sample with 3μL of 5× Protein Loading Buffer, heat the metal bath to 100℃ for 10-15 minutes, and use it as the sample. (5) Spotting: Spot 5μL of marker and 10-15μL of sample. (6) Gel running: Run the stacking gel at 80V and the separating gel at 110V. (7) Staining with Coomassie Brilliant Blue fast staining solution: Immerse the gel in Coomassie Brilliant Blue fast staining solution, stain at 30℃ and 110rpm for 30min. (8) Destaining: Carefully remove the protein gel from the Coomassie Brilliant Blue staining solution, add ddH2O to cover the protein gel for destaining, and replace with new ddH2O several times during the destaining process until the protein gel becomes light and transparent. Use a gel electrophoresis instrument to save the protein electrophoresis image.

[0277] 4.3 Estimation of protein concentration using SDS-PAGE protein bands

[0278] Open ImageJ software to process protein electrophoresis images. Image processing requires background removal. For each band, record its mean gray value. Generally, optical density is inversely proportional to band concentration; the stronger the band, the lower the mean gray value.

[0279] 5. Bradford assay for PGK protein expression

[0280] 5.1 Prepare protein standards

[0281] Prepare protein standards at concentrations of 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / mL. Since the protein samples are in BMMY medium, the standards should also be diluted with BMMY medium.

[0282] 5.2 Determination of protein concentration

[0283] Add 10 μL of protein standards of different concentrations to the protein standard wells of a 96-well plate. Add 10 μL of sample to the protein standard wells of a 96-well plate. Add 300 μL of G250 staining solution to each well, and measure A595 using a microplate reader within 30 minutes, recording the result. Calculate the protein concentration in the sample based on the standard curve and the sample volume used.

[0284] The results of the induction of expression of the above-mentioned chimeric signal peptide recombinant expression plasmids in Pichia pastoris X33 are shown below:

[0285] (1) Bacterial concentration of different chimeric signal peptide recombinant expression plasmids at the end of induction

[0286] After induction and expression of recombinant expression plasmids with different promoters, bacterial cultures were diluted 10-fold with BMMY medium. The absorbance was measured at 600 using a microplate reader. 200 μL was added to each well, with three replicates for each bacterial strain. BMMY medium was used as a blank control. Recorded values ​​are shown in Table 26.

[0287] Therefore, the OD values ​​of the bacterial cultures of K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK can be calculated. 600 The scores are 9.66, 9.78, 8.91, 9.81 and 9.88 respectively.

[0288] Table 26 Concentrations of bacterial cultures after fermentation of engineered bacteria with recombinant expression plasmids from different promoters.

[0289]

[0290]

[0291] (2) Expression results SDS-PAGE diagram

[0292] The recombinant Pichia pastoris engineered strains K. phaffii X33-pPICZαA-PGK, K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, K. phaffii X33-pPICZA-SCW10-α-PGK, and K. phaffii X33-pPICZA-INU1-α-PGK were induced to express the gene. After centrifugation, the supernatant of BMMY was used for further processing.

[0293] SDS-PAGE protein electrophoresis, results after staining and destaining are as follows: Figure 24 As shown. By Figure 24 As can be seen, lane 8 is the control group, with no expression of the target protein. The bands in lanes 2, 3, 4, 6, and 7, between 50 kDa and 70 kDa, represent the target gene *S.rug.-PGK* protein. These bands are clear and largely consistent with the theoretical target protein size of approximately 49 kDa, indicating that *S.rug.-PGK* protein can be successfully expressed in the clones *K.phaffii X33-pPICZ A-PROSCW10-α-PGK*, *K.phaffii X33-pPICZ A-ExpLKR-α-PGK*, *K.phaffii X33-pPICZA-OST1-α-PGK*, and *K.phaffii X33-pPICZA-SCW10-α-PGK*. No expression was observed in *K.phaffii X33-pPICZA-INU1-α-PGK*.

[0294] (3) SDS-PAGE estimation of protein concentration

[0295] Open ImageJ software to process SDS-PAGE adhesive. Figure 24 Select 8-bit for Type and remove background. Record the Mean Gray Value of each band in Table 27, and use the gray values ​​of protein concentration to calculate the concentrations of the extracellular expressed protein PGK (S.rug.) of Pichia pastoris K. phaffiiX33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK.

[0296] The measured grayscale value of the blank area is 253.56.

[0297] Table 27 Gray values ​​of the S.rug.-PGK protein bands produced by BSA standard protein samples and engineered bacteria.

[0298]

[0299] The concentration of each protein is directly proportional to the difference between the blank gray value and the protein's gray value. Therefore, the concentrations of K. phaffiiX33-pPICZ A-PROSCW10-α-PGK, K. phaffii X33-pPICZ A-ExpLKR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK can be calculated to be 0.425 g / L, 0.431 g / L, 0, 0.378 g / L, and 0.437 g / L, respectively.

[0300] (4) Bradford method for determining protein concentration

[0301] The absorbance (A595) of the standard protein after reaction with G250 staining solution was measured using an ELISA reader and recorded in Table 28. A standard protein curve was then plotted based on protein concentration and A595. Figure 25 The average absorbance (A595) of S. rug.-PGK produced by K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK after reaction with G250 staining solution was 1.389, 1.391, 1.152, 1.361, and 1.397, respectively.

[0302] Substitute Figure 25The concentrations of the extracellular expressed protein S.rug.-PGK of Pichia pastoris K. phaffii X33-pPICZA-PROSCW10-α-PGK, K. phaffii X33-pPICZA-ExpL KR-α-PGK, K. phaffii X33-pPICZA-INU1-α-PGK, K. phaffii X33-pPICZA-OST1-α-PGK, and K. phaffii X33-pPICZA-SCW10-α-PGK were calculated to be 0.430 g / L, 0.434 g / L, 0, 0.380 g / L, and 0.445 g / L, respectively, from the standard equation.

[0303] Table 28 A595 after BSA standard protein sample reacted with G250

[0304]

[0305] (5) Expression results of protein S.rug.-PGK in Pichia pastoris

[0306] Comparing the data on S.rug.-PGK protein produced by each strain in Table 29, it can be seen that selecting the signal peptide SCW10-a is the optimal result.

[0307] Table 29. Expression results of protein S.rug.-PGK in Pichia pastoris with different signal peptides.

[0308]

[0309] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A chimeric recombinant vector containing a SCW10 signal peptide, characterized in that, The N-terminal of the SCW10 signal peptide is chimeric with the C-terminal sequence of the α-factor signal peptide in the recombinant vector, the nucleotide sequence of the SCW10 signal peptide is shown as SEQ ID NO. 1; the recombinant vector is a recombinant vector containing S.rug.-PGK from S.rugosum, the amino acid sequence of S.rug.-PGK is shown as SEQ ID NO.

2.

2. The chimeric recombinant vector of claim 1, wherein, The recombinant vector comprises pPICZαA-PGK.

3. The chimeric recombinant vector of claim 1, wherein, The nucleotide sequence encoding S.rug.-PGK is shown as SEQ ID NO.

3.

4. The chimeric recombinant vector of claim 1, wherein, The nucleotide sequence of SEQ ID NO. 4 in the α-factor signal peptide in the recombinant vector is replaced by the nucleotide sequence of the SCW10 signal peptide.

5. A recombinant Pichia pastoris engineering bacterium containing the chimeric recombinant vector of any one of claims 1-4.

6. The recombinant Pichia pastoris engineered bacteria according to claim 5, characterized in that, The Pichia pastoris comprises Pichia pastoris X33 or Pichia pastoris GS115.

7. Use of the chimeric recombinant vector of any one of claims 1-4 or the recombinant Pichia pastoris engineering bacterium of any one of claims 5-6 in the production of phosphoglycolate kinase.

8. A method for producing phosphoglycerate kinase, characterized by, comprising the following steps: culturing the recombinant Pichia pastoris engineering bacteria of claim 5 or 6 in BMMY medium, when OD 600 = 2, adding methanol to induce production.

9. The method of claim 8, wherein, Methanol is added to a final concentration of 1%.

Images