HER2 targeting RNA interference method, nucleic acid and application of HER2 targeting RNA interference method and nucleic acid

Abstract

The present invention provides nucleic acid molecules for modulating the level or amount of mRNA of HER2. In particular, the invention provides delivery of primary microRNAs to form precursors after in vivo processing, as well as microRNAs, for in vivo inhibition of expression of mRNA of HER2. The invention also provides a delivery system of the nucleic acid molecule, comprising a carrier, an exosome and a cell, and a pharmaceutical composition containing the same. The invention also provides the application of the nucleic acid molecule and the delivery system in cancer treatment and drug preparation.

Description

[0001] This application claims priority to Chinese Patent Application No. 202410918570.2, filed on July 9, 2024, entitled "Method for RNA Interference Targeting HER2, Nucleic Acid and Its Application", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the fields of molecular biology and pharmaceuticals. Specifically, this invention relates to systems for delivering precursor miRNAs and their applications in disease treatment. Background Technology

[0003] HER2, or receptor tyrosine protein kinase erbB-2, is a member of the EGFR receptor tyrosine kinase family. Unlike other members of the family, it lacks an endogenous ligand. HER2 activates various signaling pathways by interacting with heterodimers of other family members, promoting cell proliferation and survival. HER2 mutations are considered a potential driver of tumorigenesis. Current research indicates that HER2 is abnormally expressed in multiple tumor types, including breast cancer, ovarian cancer, and gastric cancer. Current therapeutic agents targeting HER2 mainly include monoclonal antibodies, bispecific antibodies, antibody-drug conjugates (ADCs), and CAR-T therapy.

[0004] Various delivery systems have been employed in the art to safely and precisely deliver artificial miRNAs or siRNAs to target tissues in the form of pri-miRNAs or pre-miRNAs. However, there is still a need in the art for improved methods and approaches to deliver artificial miRNAs with higher efficiency and fewer off-target effects, and for their use in drugs to treat cancer. Summary of the Invention

[0005] This invention provides nucleic acid molecules and methods for regulating (increasing or decreasing) the level or amount of mRNA of receptor tyrosine protein kinase erbB-2 (HER2). Specifically, this invention provides nucleic acid molecules for delivering primary microRNAs (pri-miRNAs or pri-miRs) to form precursors and microRNAs (miRNAs or miRs) after in vivo processing.

[0006] ERBB2 (also known as HER2) is a member of the epidermal growth factor receptor (EGFR) tyrosine kinase receptor family. HER2 itself lacks a ligand-binding domain and therefore cannot bind to growth factors. However, it can bind tightly to other ligand-binding EGFR family members, forming a heterodimer, stabilizing ligand binding, and enhancing the activation of kinase-mediated downstream signaling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. HER2 gene amplification and / or overexpression have been reported in many cancers, including breast and ovarian cancer. Alternative splicing of the HER2 gene has produced several transcript variants, some encoding different isoforms, while others are not yet fully identified. The human HER2 gene has a Gene ID of 2064.

[0007] In this article, protein symbols are not italicized and are all uppercase; gene symbols are italicized. For example, HER2 is a protein, and the gene encoding this protein is written as Her2. Sometimes gene symbols are also not italicized in this article. For example, sometimes "Her2" in this article refers to the HER2 protein. Sometimes gene symbols are also not italicized in this article. For example, sometimes "HER2" or "HER2 gene" in this article refers to the gene Her2 that encodes the HER2 protein.

[0008] Specifically, the present invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding RNA that represses HER2 gene expression, wherein the nucleic acid sequence comprises a miRNA sequence that represses the HER2 gene.

[0009] In one aspect, the nucleic acids provided by the present invention are used to deliver primary microRNAs or precursor microRNAs into the body, which are processed in cells to produce highly specific artificial microRNAs or siRNAs that reduce HER2 expression.

[0010] The term "microRNA (or miRNA or miR)" as used herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3′UTR of a nucleic acid molecule and downregulates gene expression (by reducing the stability of the nucleic acid molecule or by inhibiting translation). The regulatory polynucleotides of this invention may comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, for example, sequences that function as microRNAs.

[0011] The term "pre-miRNA" in this article refers to precursor microRNAs. Pre-miRNAs are approximately 70 base pairs long and are generated in the cell nucleus after being cleaved by Drosha. Pre-miRNAs are exported into the cytoplasm via export protein 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0012] The term "siRNA" in this article refers to small interfering RNA, sometimes also called short interfering RNA or silent RNA. It is a type of double-stranded RNA, typically 17-24 base pairs in length. It interferes with the expression of specific genes by degrading mRNA with a nucleotide sequence complementary to the antisense strand (also known as the guide strand) of the siRNA, thereby preventing translation.

[0013] The polynucleotide provided by this invention can efficiently deliver exogenous nucleotide sequences to exosomes, and after the exosomes reach the target cells, they can specifically inhibit the target genes in the target cells, and can minimize off-target side effects.

[0014] In one aspect of the invention, an isolated nucleic acid is provided, comprising a nucleic acid sequence encoding a pri-miRNA that represses HER2 gene expression. The pri-miRNA comprises a miRNA sequence that represses the HER2 gene, and one or more compensating sequences comprising a flanking structure sequence, a stem-loop structure, and the RNA sequence. In one embodiment of the invention, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, from 5' to 3', a 5' flanking structure sequence, the miRNA sequence that represses the gene expression, a stem-loop sequence, a compensating sequence, and a 3' flanking structure sequence.

[0015] As used in this article, "isolated" means that a substance has been separated from its original environment. For example, nucleic acids and polypeptides in their native state within living cells are not isolated and purified, but the same nucleic acid or polypeptide is isolated if it is separated from other substances present in its native state.

[0016] In one embodiment of the invention, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the invention, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it includes 2, 3, or 4 copies.

[0017] In one embodiment of the invention, the sequences encoding the pri-miRNAs that suppress gene expression of the plurality of copies in the aforementioned nucleic acids have spacer sequences between them. In yet another embodiment of the invention, the spacer sequences have 6-50 nucleotides, preferably 10-30 nucleotides.

[0018] Specifically, in one aspect of the present invention, the pri-miRNA has the structure of Formula I:

[0019]

[0020] Where "|" represents base pairing (A1A2…A a-1 A a (B) is the first RNA sequence; b B b-1 …B2B1) is the second RNA sequence, (A1A2…A a-1 A a ) and (B b B b-1 …B2B1) Completely complementary or substantially completely complementary, wherein a and b are each independent integers of about 15-29, preferably integers of about 18-22;

[0021] [M1M2…M m-1 M m [N] is the 5' end flank structure sequence; n N n-1 …N2N1] is a 3' end flanking structure sequence, where m and n are each independent integers of approximately 25-50, preferably, m <n;

[0022] The septal sequence that forms the stem-loop structure is called the C-stem-loop.

[0023] Where c is an integer of approximately 10-30, preferably an integer of approximately 16-20.

[0024] The pri-miRNA provided by this invention, after biological processing (in vivo, in tissues, or in cells, etc.) (hereinafter referred to as "processing"), generates pre-miRNA or miRNA, ultimately producing an RNA sequence targeting the target mRNA. In this invention, the 5' flanking structural sequence (such as [M1M2…M...M...) in Formula I... m-1 M m ]) and the first RNA sequence (such as A1A2…A in Formula I) a-1 A a The structure composed of 3' flanking structures (such as [N in Formula I]) is also called the 5' arm, and the first RNA sequence in it is called the 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure is composed of 3' flanking sequences (such as [N in Formula I]). n N n-1 …N2N1]) and the second RNA sequence (as shown in Formula I, B) b B b-1The structure consisting of …B2B1) is also called the 3' arm, and the second RNA sequence therein is called the 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by this invention contains an RNA sequence targeting the target mRNA, which can be located or situated on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e., the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by this invention can generate one or two single-stranded mature miRNAs. Based on processing from the 5' and 3' arms of the precursor, the corresponding first miRNA sequence (A1A2…A…B1) is... a- 1A a The single-stranded mature miRNA can be called miRNA-5p, corresponding to the second miRNA sequence (B). b B b-1 Mature miRNAs of …B2B1 can be called miRNA-3p.

[0025] miRNAs can be substantially complementary to at least a portion of the sequence of the mRNA encoding a gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures. Typically, two "substantially complementary" nucleotide sequences have at least 70% complementary nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Functionally, miRNAs interfere with the post-transcriptional degradation of mRNA expressing a specific gene with a complementary nucleotide sequence, thereby preventing translation.

[0026] In one aspect of the invention, the miRNA is 15-29 nucleotides (nt) in length, preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. Extensive testing has shown that RNA sequences shorter than 18 nt, especially less than 15 nt, are mostly ineffective. Conversely, RNA sequences longer than 22 nt, especially greater than 25 nt, not only significantly increase circuit costs but also do not outperform 18-22 nt sequences, resulting in poor economic efficiency. Therefore, miRNA sequences with a length of 15-25 nt, particularly 18-22 nt, are most effective.

[0027] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially yields only miRNAs with the sequence of the first miRNA, while the other RNA sequence does not form or hardly forms miRNA. In one embodiment of the present invention, the miRNA with the sequence of the first miRNA obtained after in vivo processing of the pri-miRNA provided by the present invention is active, that is, the 5' arm miRNA is active, while the miRNA with the sequence of the second miRNA is almost impossible to obtain, that is, the 3' arm miRNA is inactive or almost inactive.

[0028] In one aspect of the invention, the almost non-formed miRNA obtained after biological processing of the pri-miRNA provided by the invention accounts for less than 40% of the total miRNA obtained after processing the pri-miRNA, preferably less than 10%, more preferably less than 5%, for example less than or equal to 2%.

[0029] In one aspect of the invention, the target knockdown (KD) of the target mRNA that inhibits the miRNA sequence of the gene obtained by in vivo processing of the pri-miRNA of the nucleic acid provided by the invention is at least higher than about 30%, about 40%, 50%, 90%, 95%, or up to 99%.

[0030] In one aspect of the invention, the miRNA sequence of the nucleic acid pri-miRNA provided by the invention, after in vivo processing, inhibits the expression of the gene by a protein target knockdown of at least 40%, 50%, 90%, 95%, or up to 99%.

[0031] In one aspect of the invention, the target knockdown achieved by the pri-miRNA provided by the invention, which is almost non-formed after biological processing, is less than about 40%, 10%, 5%, or close to 0%.

[0032] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially produces miRNA without off-target effects.

[0033] In one embodiment of the present invention, the miRNA sequence that inhibits HER2 gene expression has the following nucleotide sequence:

[0034] TCTCACACCGCTGTGTCCAT(SEQ ID NO.:7);

[0035] AGTCTCAAACACTTGGAGCTG (SEQ ID NO.:9);

[0036] ATTGGCACTGGTAACTGCCCT(SEQ ID NO.:11);

[0037] TGCTGTCACCTCTTGGTTGTG (SEQ ID NO.: 13);

[0038] TCCCACGTCCGTAGAAAGGTA(SEQ ID NO.:15); or

[0039] TTCTTGCAGCCAGCAAACTCC (SEQ ID NO.:17).

[0040] In one embodiment of the present invention, the combination of the RNA sequence that inhibits HER2 gene expression and its compensating sequence is a sequence group having the following nucleotide sequence:

[0041]

[0042]

[0043] In one embodiment of the present invention, the RNA that inhibits HER2 gene expression is a pri-miRNA having a stem-loop structure. In one embodiment of the present invention, the sequence of the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO.:27).

[0044] In one embodiment of the present invention, the RNA that inhibits HER2 gene expression is pri-miRNA, which has a 5' flanking sequence (such as [M1M2…M in Formula I). m-1 M m ]) and the 3' end flank structure sequence (as shown in Equation I [N n N n-1 …N2N1]. In one embodiment of the invention, the 5' flanking structure sequence and the 3' flanking structure sequence each independently or simultaneously share greater than 80% identity with the pri-miR sequence of mammals (especially humans), preferably greater than 90%, preferably greater than 95%, and preferably 100%. In one embodiment of the invention, the pri-miR is pri-miR155.

[0045] In one embodiment of the present invention, the 5' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.:25).

[0046] In one embodiment of the present invention, the 3' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO.:26).

[0047] In one aspect of the invention, the invention also provides a pre-miRNA, which is processed from the pri-miRNA of the invention described above.

[0048] The present invention also provides isolated nucleic acids encoding a combination of RNAs that repress the expression of one or more target genes. The nucleic acids comprise (1) a nucleic acid sequence encoding RNA that represses the expression of the HER2 gene, and (2) a nucleic acid sequence encoding RNA that represses the expression of a second gene.

[0049] In another aspect of the present invention, the second gene includes the TAU gene, LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, TGFB gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, SNCA gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene, and α-synuclein gene, etc.

[0050] In one embodiment of the invention, in the isolated nucleic acid of the combination encoding RNA that inhibits the expression of one or more target genes, a spacer sequence is provided between the sequence encoding the RNA that inhibits the expression of the HER2 gene and the sequence encoding the RNA that inhibits the expression of the second gene. In another embodiment of the invention, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0051] In another aspect of the invention, a vector is provided comprising the isolated nucleic acid of the present invention, including the one encoding repression of HER2 gene expression. In yet another aspect of the invention, the vector is an expression vector. The nucleic acid of the present invention may be located downstream of a promoter of the vector (e.g., but not limited to, CMV, U6, CBA, or a CBA promoter having an SV40 intron).

[0052] In one embodiment of the invention, the vector is a plasmid. In one embodiment of the invention, after administration to a mammal, the plasmid can be enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver), transcribe and / or express the RNA fragment of the invention, and the RNA fragment is encapsulated in exosomes within the cells of the tissue.

[0053] In one embodiment of the present invention, the vector is a viral vector. For example, it may be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector, or a lentivirus vector. In one embodiment of the present invention, the vector is an adenovirus vector, such as adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9.

[0054] In one embodiment of the invention, the plasmid or viral vector is enriched and expressed in the liver of a mammal after administration, and its product is encapsulated in large quantities in exosomes.

[0055] In one aspect of the invention, a cell comprising the isolated nucleic acid of the invention as described above is provided. Cells comprising the nucleic acid of the invention as described above can be obtained by transfecting cells with plasmids or viral vectors. Transfection of cells with nucleic acid constructs can be performed using various methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.

[0056] In one aspect of the invention, an exosome is provided containing RNA that inhibits HER2 gene expression, comprising the pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above. In one embodiment of the invention, the exosome is an exosome derived from human tissue or cells. The tissue includes the liver, lungs, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the invention, the exosome is an exosome derived from the liver or liver cells.

[0057] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example, at 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, such as immunoprecipitation using specific antibodies, magnetic bead purification, or resin-based purification. The exosomes can then be quantified and characterized.

[0058] The RNA provided by this invention can be delivered to different tissues to inhibit specific target genes and treat related diseases.

[0059] In one aspect of the invention, a pharmaceutical composition is provided comprising the nucleic acid, carrier, or cell as described above. The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, carrier, or cell to a subject.

[0060] The drug can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to mammals, the plasmids or viral vectors in the drug accumulate in tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver). The products expressed are encapsulated in large quantities in exosomes within the cells of these tissues and delivered to the target tissue to exert a therapeutic effect.

[0061] The pharmaceutical composition can be used to treat cancer, acute and chronic infectious diseases, or other acute and chronic diseases. The cancer can be any type of cancer, including leukemia, lymphoma, multiple myeloma, or solid tumors. For example, leukemia may include acute lymphoblastic leukemia, acute myeloid leukemia, acute promyelocytic leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, monocytic leukemia, and hairy cell leukemia; lymphomas may include Hodgkin's lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, and small lymphocytic lymphoma; solid tumors may include bladder cancer, urethral, ​​ureteral, and renal pelvis urothelial carcinoma, multiple myeloma, kidney cancer, breast cancer, colon cancer, head and neck cancer, lung cancer, prostate cancer, glioblastoma, osteosarcoma, liposarcoma, soft tissue sarcoma, ovarian cancer, melanoma, liver cancer, esophageal cancer, pancreatic cancer, and stomach cancer, etc.

[0062] The aforementioned acute and chronic infectious diseases include: viral influenza, viral hepatitis, AIDS, viral diseases such as SARS, bacterial diseases (e.g., tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. Other acute and chronic diseases include: respiratory system diseases, immune system diseases, blood and hematopoietic system diseases such as cardiovascular diseases, endocrine and metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and musculoskeletal system diseases. For example, these diseases include cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0063] In one aspect of the invention, a method of treating a disease is provided, comprising administering to a subject a nucleic acid, vector, or exosome as described above. The disease includes tumors, acute or chronic infectious diseases, or other acute or chronic illnesses.

[0064] Those skilled in the art will understand that the actual dose administered varies depending on a variety of factors, such as the carrier, target cells or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the manner of administration, the type of transformation / modification sought, and so on. Detailed Implementation

[0065] The following will further illustrate the essence and beneficial effects of the present invention with reference to embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the present invention.

[0066] Example 1: Materials and Methods

[0067] Table 1. Cells, Materials, and Reagents:

[0068] name Item number brand <![CDATA[Opti-MEM TM I. Serum-reduced culture medium 31985062 Thermo Fisher <![CDATA[Lipofectamine TM 3000 Transfection Reagent]]> L3000015 Thermo Fisher 2×Taq Pro Univerdal SYBR qPCR Master Mix Q-712 Vazyme RNeasy Mini Kit 74106 QIAGEN HiScript IIQ RT SuperMix for qPCR R222-01 Vazyme BCA Protein Quantification Kit E8053-500T-PKG Adamas life Anti-HER2 Antibody [29D8] 2165S CST Anti-Tubulin antibody [DM1A] Ab7291 Abcam RIPA lysis buffer (strong) P0013B Azure Sky <![CDATA[SurePAGE TM ,Bis-Tris,10x8,4-12%,15wells]]> M00654 GeneScript <![CDATA[NuPAGE TM LDS Sample Buffer (4X) NP0007 Thermo Fisher 293T SCSP-502 Cell Bank of Chinese Academy of Sciences

[0069] Example 2 Nucleic Acid Synthesis and Plasmid Preparation

[0070] 1. Commission Suzhou Genewiz Biotechnology Co., Ltd. to synthesize or prepare the nucleic acid fragments listed in Table 2 below.

[0071] The sequence of the pri-miRNA is shown in the table below.

[0072] Table 2. Sequence and structure of single-copy pri-miRNA

[0073]

[0074]

[0075] Among them, miHER2#1 to miHER2#6 are nucleic acid fragments of pri-miRNA that encode the expression of a single pri-miRNA that represses the expression of the HER2 gene, and contain RNA sequences of mRNA that target HER2.

[0076] The structure of the single pri-miRNA sequence from 5' to 3' includes: a 5' flanking sequence TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.:19); a miRNA sequence; a stem-loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO.:21); a compensation sequence; and a 3' flanking sequence CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO.:20).

[0077] The combinations of miRNA sequences and compensation sequences possessed by miHER2#1 to miHER2#6 are as follows:

[0078] Table 3 miRNA sequences of pri-miRNA

[0079]

[0080] 2. Construct a pri-miRNA nucleic acid fragment containing the above-mentioned HER2-inhibiting miRNA and a plasmid expressing the contained miRNA.

[0081] The above-mentioned nucleic acid fragments encoding pri-miRNA were inserted into the pcDNA6.2-EmGFP-mir9 vector to prepare plasmids carrying the sequence of pri-miRNA targeting HER2. The resulting plasmids were named miHER2#1 to miHER2#6.

[0082] Example 3: Preparation and Analysis of Cells and Exosomes

[0083] The plasmid prepared in Example 2 was transfected into HEK293T cells, and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number and size distribution of secreted exosomes were similar in each group, with peak values ​​between 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited typical round vesicle morphology and were of the correct size. Furthermore, the enrichment of specific exon markers (CD63, TSG101, and CD9) was detected only in the purified exosomes and not in the cell culture medium. Exosomal RNA was extracted and miRNAs were analyzed to determine the miRNA composition, including the amount and ratio of 5' arm miRNA (i.e., the first miRNA) and 3' arm miRNA (i.e., the second miRNA) in the exosomal RNA.

[0084] The results are shown in Table 4 below.

[0085] Table 4 miRNA composition detection

[0086]

[0087] Example 4 miRNA activity

[0088] 1. Changes in HER2 mRNA levels

[0089] 293T cells were seeded overnight in 6-well plates at a density of 1.2E6 cells per well. The cells were then transfected with Lipofectamin 3000 at a density of 2.5ug miRNA plasmid per well. Cells were harvested 48 hours after transfection.

[0090] HER2 mRNA was extracted from cells and detected using qPCR. RNA was extracted using a total RNA extraction kit (UE) according to the manufacturer's instructions, and reverse transcription was performed using a reverse transcription reagent (Takara). qPCR was then performed using HER2 / GAPDH / β-actin primers. The primer sequences are as follows:

[0091] Forward primer sequence (5' to 3') Reverse primer sequence (5' to 3') HER2-QP2 CCTGCACAACCAAGAGGT GCACTGGTAACTGCCCTC GAPDH GAGAAGGCTGGGGCTCATTT TGATGACCCTTTTGGCTCCC β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

[0092] The results are shown in Table 5 below.

[0093] Table 5 miRNA activity assay - mRNA target knockdown (KD)

[0094] pri-miRNA HER2 mRNA miHER2#1 62.0％ miHER2#2 66.3％ miHER2#3 63.0％

[0095] 2. Changes in HER2 protein levels

[0096] In addition, Western blotting was used to detect HER2 protein in cells. A portion of cells were lysed using RIPA (Beyotime), and the total protein concentration was measured using the BCA method (Adamas Life). BSA standard was diluted, and 20 μL of sample or standard was added to each well, followed by 200 μL of reaction reagent. The cells were incubated at 37°C for 30 minutes, and the OD value was measured using a Thermo Fisher microplate reader (562m). The total protein concentration of the sample was calculated based on the standard curve.

[0097] After adding 4X LDS (Thermo Fisher) to the sample, heating at 70℃ for 10 min, loading the sample onto an SDS-PAGE gel for transfer, adding HER2 and Vinculin (Abcam) antibodies for incubation, and imaging and grayscale analysis of the HER2 and Vinculin bands on a TANON 5200multi imager and software.

[0098] The results are shown in Table 6 below.

[0099] Table 6 miRNA activity assay - protein target knockdown (KD)

[0100]

[0101] The foregoing description of the present invention should not be construed as limiting it. Unless otherwise indicated, the present invention will be practiced using conventional techniques such as organic chemistry, polymer chemistry, and biotechnology, and it is obvious that the invention can be implemented in other ways besides those specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art. Many changes and variations are possible based on the teachings of the present invention, and therefore fall within the scope of the invention.

Claims

1. An isolated nucleic acid comprising a nucleic acid sequence encoding a pri-miRNA that inhibits HER2 gene expression, wherein the pri-miRNA comprises, from 5' to 3', a 5' flanking sequence, a miRNA sequence that inhibits HER2 gene expression, a stem-loop sequence, a compensation sequence, and a 3' flanking sequence, wherein the miRNA sequence that inhibits HER2 gene expression is an RNA sequence that is complementary or substantially complementary to the mRNA sequence that expresses the HER2 gene.

2. The nucleic acid of claim 1, comprising a plurality of copies of the nucleic acid sequence of the pri-miRNA, preferably, the plurality of copies being 2-10 copies, for example, 2, 3 or 4 copies.

3. The nucleic acid according to claim 1 or 2, wherein the miRNA sequence that inhibits HER2 gene expression has the following nucleotide sequence: TCTCACACCGCTGTGTCCAT(SEQ ID NO.:7); AGTCTCAAACACTTGGAGCTG (SEQ ID NO.:9); ATTGGCACTGGTAACTGCCCT(SEQ ID NO.:11); TGCTGTCACCTCTTGGTTGTG (SEQ ID NO.: 13); TCCCACGTCCGTAGAAAGGTA(SEQ ID NO.:15); or TTCTTGCAGCCAGCAAACTCC (SEQ ID NO.:17).

4. The nucleic acid according to claim 3, wherein the combination of the miRNA sequence that inhibits HER2 gene expression and its compensating sequence is a sequence group having the following nucleotide sequence: 1TCTCACACCGCTGTGTCCAT ATGGAACAGCGGTGTGAGA (SEQ ID NO.:7); and (SEQ ID NO.:8); 2AGTCTCAAACACTTGGAGCTG CAGCTCCATGTTTGAGACT (SEQ ID NO.:9); and (SEQ ID NO.:10); 3ATTGGCACTGGTAACTGCCCT AGGGCAGTCCAGTGCCAAT (SEQ ID NO.:11); and (SEQ ID NO.:12); 4TGCTGTCACCTCTTGGTTGTG CACAACCAAGGTGACAGCA (SEQ ID NO.:13); and (SEQ ID NO.:14); 5TCCCACGTCCGTAGAAAGGTA TACCTTTCCGGACGTGGGA (SEQ ID NO.:15); and (SEQ ID NO.:16); or 6TTTCTTGCAGCCAGCAAACTCC GGAGTTTGGGCTGCAAGAA (SEQ ID NO.:17); and (SEQ ID NO.:18).

5. The nucleic acid according to claim 1, wherein the RNA that inhibits HER2 gene expression has a stem-loop structure, and its sequence has, for example, the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO.:27).

6. The nucleic acid according to claim 1, wherein the miRNA that inhibits HER2 gene expression has a 5' flanking sequence and a 3' flanking sequence, each of which independently or simultaneously shares greater than 80% identity with a mammalian or human pri-miR (e.g., pri-miR155) sequence, preferably greater than 95%, more preferably 100%.

7. The nucleic acid according to claim 6, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.:25); And / or the 3' flanking structure sequence therein has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO.:26).

8. A vector comprising encoding the isolated nucleic acid of any one of claims 1-7.

9. A cell comprising the nucleic acid of any one of claims 1-7 or the vector of claim 8. Optionally, the exosomes in the cells contain RNA obtained by in vivo processing of the pri-miRNA.

10. A pharmaceutical composition comprising the nucleic acid of any one of claims 1-7 or the carrier of claim 8, the cell of claim 9 or the exosomes secreted by said cell.

11. Use of the nucleic acid of any one of claims 1-7, or the vector of claim 8, or the cell of claim 9, or the exosomes secreted by said cell, in the preparation of a medicament for treating a disease. Preferably, the disease is cancer, acute or chronic infectious diseases, or other acute or chronic diseases. More preferably, the cancer is leukemia, lymphoma, multiple myeloma, or solid tumor, such as leukemia including acute lymphoblastic leukemia, acute myeloid leukemia, acute promyelocytic leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, monocytic leukemia, and hairy cell leukemia; lymphoma including Hodgkin's lymphoma; non-Hodgkin's lymphoma; Burkitt's lymphoma; and small lymphocytic lymphoma; solid tumor including bladder cancer, urethral, ​​ureteral, and renal pelvis urothelial carcinoma, multiple myeloma, kidney cancer, breast cancer, colon cancer, head and neck cancer, lung cancer, prostate cancer, glioblastoma, osteosarcoma, liposarcoma, soft tissue sarcoma, ovarian cancer, melanoma, liver cancer, esophageal cancer, pancreatic cancer, and gastric cancer.

Images