Artificial breeding method for mackerel fries

By screening SNP sites for molecular markers related to Vibrio resistance in blue-spotted mackerel, a molecular marker-assisted selection technique was established. This technique solved the problems of low efficiency and drug dependence in disease resistance traits during blue-spotted mackerel breeding, enabling a rapid and accurate breeding method that improves the disease resistance and breeding efficiency of fish.

CN121294670APending Publication Date: 2026-01-09XIANGSHAN HARBOR AQUATIC SEEDS CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511478768.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

In existing blue-spotted mackerel farming, the prevention and control of vibriosis relies on antibiotics and chemical disinfectants, leading to increased drug resistance, drug residues, and disruption of the microecological balance. Traditional disease-resistant breeding methods are inefficient and raise ethical issues, making it difficult to quickly improve the disease resistance of fish.

Method used

By screening for SNP molecular markers associated with the vibrio resistance trait in blue-spotted mackerel, and using PCR primer pairs to screen for CC homozygous individuals, molecular marker-assisted selection technology was established to achieve early, rapid, and accurate screening of seedlings and to cultivate disease-resistant blue-spotted mackerel seedlings.

Benefits of technology

It significantly improves the resistance of blue-spotted mackerel to Vibrio disease, shortens the breeding cycle, increases breeding efficiency and survival rate, reduces antibiotic use, and promotes the healthy development of the industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294670A_ABST
    Figure CN121294670A_ABST
Patent Text Reader

Abstract

The invention provides an artificial breeding method for mackerel squalane fry, namely, on the basis of screening molecular markers related to vibrio resistance characters of squalane squalane, the artificial breeding method for the mackerel squalane fry is established, and the squalane squalane fry with vibrio resistance is cultivated. According to the SNP site molecular marker linked with the blue-point Chimaera anti-vibrio disease character, the SNP site molecular marker is located at the 130 site of the sequence SEQ ID NO: 1, and the basic group of the SNP site molecular marker is C / T. The molecular marker related to the vibrio resistance character of Chimaera blue-dot is obtained through screening and is used for screening disease-resistant parents, so that the disease-resistant genetic breeding speed of Chimaera blue-dot is increased, and the breeding efficiency and the breeding survival rate of disease-resistant strains are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding and seedling technology of aquaculture species, specifically relating to an artificial breeding method for blue-spotted mackerel seedlings. Background Technology

[0002] Blue-spotted mackerel ( Scomberomorus niphonius Mackerel, commonly known as Spanish mackerel, is an important marine economic fish belonging to the genus *Scombrina* of the family Scombridae. In China, it is mainly distributed in the Bohai Sea, Yellow Sea, and East China Sea. Its flesh is tender, delicious, and nutritious, making it highly popular with consumers and possessing significant economic value and market development potential. With the decline of near-shore fishery resources and the continuous increase in market demand, the artificial breeding scale of blue-spotted mackerel is gradually expanding.

[0003] However, in the intensive farming of blue-spotted mackerel, disease problems have become increasingly prominent, among which are caused by Vibrio bacteria ( Vibrio spp Vibriosis caused by bacteria is particularly common and serious, and has become a major bottleneck restricting the healthy development of the industry.

[0004] Vibrio infection is a bacterial hemorrhagic sepsis, with common causative agents including Vibrio anguillarum (…). Vibrio anguillarum ), Vibrio harveyi ( Vibrio harveyi ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus Vibrio infection in fish typically presents with skin ulcers, hemorrhagic erythema, congestion and ulceration at the base of fins, abdominal swelling, and anal swelling. Autopsy reveals enlarged, hemorrhagic, and even necrotic internal organs such as the liver, spleen, and kidneys. The disease has a long epidemic season, and outbreaks are particularly likely to occur at water temperatures of 15-25℃. It is highly contagious and has a high mortality rate, often causing significant economic losses to fish farmers.

[0005] Currently, aquaculture farmers mainly rely on antibiotics and chemical disinfectants to prevent and control Vibrio disease in blue-spotted mackerel. This approach has significant drawbacks: long-term and excessive use of antibiotics leads to the emergence of drug-resistant Vibrio strains and a decline in drug efficacy; improper use of aquatic drugs results in drug residues in the fish, posing food safety risks; and the overuse of disinfectants and antibiotics disrupts the microecological balance of the aquaculture water, polluting the environment and contradicting the requirements for green and sustainable development in aquaculture.

[0006] Therefore, fundamentally improving the resistance of blue-spotted mackerel to vibrio disease and breeding and promoting superior new varieties with innate disease resistance is the fundamental way to solve this disease problem at its source. Traditional disease-resistant breeding methods mainly rely on challenge tests for screening, that is, screening resistant parents based on their survival rate after artificially infecting them with Vibrio. Although this method is direct, it has significant drawbacks: the experimental cycle is long and costly, requiring specialized laboratories for handling live bacteria and high-level biosafety protection; the process causes considerable suffering and death to the experimental fish, raising animal welfare and ethical issues; more importantly, disease resistance is a complex quantitative trait, regulated by multiple genes and easily affected by the environment, so selection based solely on post-infection phenotypes has limited accuracy and low efficiency, leading to slow breeding progress.

[0007] The development of molecular marker-assisted selection (MAS) technology has provided a new solution for disease resistance breeding in aquatic animals. This technology identifies DNA molecular markers closely linked to target disease resistance traits, enabling early, rapid, and accurate genotyping at the fry or juvenile stage, thereby significantly improving breeding efficiency and shortening the breeding cycle. Among various molecular markers, single nucleotide polymorphism (SNP) markers have become the mainstream technology in modern molecular breeding research and application due to their extremely wide distribution throughout the genome, high genetic stability, and suitability for automated high-throughput detection.

[0008] While SNP marker technology has achieved significant results in the breeding of growth, stress resistance, and disease resistance traits in various other economically important fish species, systematic research on SNP markers related to vibrio resistance in the specific species *Mackerel rubescens*, particularly its resistance to vibrio, has not been systematically reported both domestically and internationally. Therefore, screening SNP molecular markers significantly associated with vibrio resistance in *Mackerel rubescens* and establishing an efficient and accurate molecular marker-assisted selection technology system is of urgent practical significance and important application value for overcoming the breeding bottleneck of vibrio resistance in *Mackerel rubescens*, reducing antibiotic use in aquaculture, and promoting the sustainable and healthy development of the industry. Summary of the Invention

[0009] The purpose of this invention is to provide an artificial breeding method for blue-spotted mackerel fry. Specifically, based on screening and obtaining molecular markers related to the vibrio resistance trait of blue-spotted mackerel, an artificial breeding method for blue-spotted mackerel fry is established to cultivate blue-spotted mackerel fry with vibrio resistance.

[0010] The present invention first provides a SNP site molecular marker linked to the vibrio resistance trait of blue-spotted mackerel, wherein the SNP site molecular marker is located at position 130 of the sequence SEQ ID NO:1 and its base is C / T; ATAATCGTATTTCTAATCAGTGCGTTCGTACTTTACATTATTGTAGCTATGATCACAACTAAACTCACCAATAGCTACATCCTCGACTCCCAAGAGATTGAAATCATCTGAACAGTCCTCCCAGCTATCCTTCTCATCCTTATTGCTCTTCCCTCCCTACGTATTCTTTACCTAATAGACGAAATTAATGACCCTCATTTAACAATCAAGGCTGTAGGTCATCAGTG (SEQ ID NO: 1).

[0011] The sequence information of the primer pairs used to detect the above SNP sites is as follows: Forward primer: 5'-TCAGTGCGTTCGTACTTTACA-3' (SEQ ID NO:2); Reverse primer: 5'-CACTGATGACCTACAGCCTTGA-3' (SEQ ID NO:3); In another aspect, the present invention provides an application of the molecular marker in screening blue-spotted mackerel individuals with vibriosis resistance; Another aspect of the present invention is to provide a method for screening blue-spotted mackerel parents resistant to vibrio, wherein individuals with the SNP locus being homozygous for CC are selected; The method involves amplifying the nucleic acid samples of selected individuals using PCR primers, and then typing or sequencing the amplification products.

[0012] The specific sequence information of the primer pairs used is as follows: Forward primer F: TCAGTGCGTTCGTACTTTACA (SEQ ID NO:2) Reverse primer R: CACTGATGACCTACAGCCTTGA (SEQ ID NO:3); In another aspect, the present invention provides an artificial breeding method for blue-spotted mackerel fry, which uses the individuals selected above as parent stock for fry breeding.

[0013] The present invention screens molecular markers related to the resistance to Vibrio spp. in blue-spotted mackerel and uses them to screen disease-resistant parents, thereby accelerating the genetic breeding and selection of disease-resistant blue-spotted mackerel and improving the breeding efficiency and survival rate of disease-resistant strains. Attached Figure Description

[0014] Figure 1 : Survival rate data of blue-spotted mackerel within 14 days after viral infection; Figure 2 Agarose gel electrophoresis image; Figure 3 SNP locus typing map. Detailed Implementation

[0015] This invention screens for markers that are significantly associated with the anti-Vibrio trait of blue-spotted mackerel, and uses them to screen for blue-spotted mackerel parent individuals with disease resistance advantages.

[0016] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0017] Example 1: Construction of a blue-spotted mackerel population with anti-Vibrio trait

[0018] Experiments were conducted at the aquaculture workshop of Xiangshan Harbor Aquatic Seedling Co., Ltd. in Huangbiao Township, Xiangshan County. Culture ponds with a water depth of 1.5-2m and a bottom area of ​​80-100m² were used. The water temperature was controlled at 16-26℃, and the salinity was maintained at 20‰-24‰ to provide a suitable growth environment for the Spanish mackerel. Spanish mackerel with a body length of approximately 25cm and a weight of approximately 100g were introduced and temporarily kept for one week.

[0019] After one week of rearing, 300 healthy and intact blue-spotted mackerel were randomly selected for an experiment to challenge them with Vibrio anguillarum (injection concentration 1×10⁻⁶). 7 CFU / mL). After challenge, observe for 14 days, record the daily mortality rate, and calculate the cumulative survival rate. Figure 1 Twenty surviving individuals (disease-resistant group) and twenty individuals that died first (susceptible group) were selected for subsequent analysis.

[0020] Example 2: Screening for SNP markers associated with disease resistance in blue-spotted mackerel

[0021] 2.1 Sample preparation and DNA extraction Fin tissue samples were collected from 50 individuals each in the disease-resistant and susceptible groups selected in Example 1, with each sample weighing approximately 15-20 mg. Genomic DNA was extracted using the Marine Animal Genomic DNA Extraction Kit from Tiangen Biotech Co., Ltd. 5 μL of DNA sample was mixed with 6× Loading buffer and electrophoresed on a 1.5% agarose gel at 4 V / cm for 30 min. The gel was observed and photographed using a gel imaging system, and the DNA concentration and OD260 / OD280 ratio were measured using a microplate reader. Results showed that all samples had clear bands, indicating good extraction quality. The OD260 / OD280 values ​​were all between 1.8 and 2.0, and the concentration reached 50-100 ng / μL, meeting the requirements for subsequent experiments. Figure 2 ).

[0022] 2.2 Primer Design and Synthesis Based on the blue-spotted mackerel gene sequence, 15 pairs of specific primers were designed and synthesized. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the 5′ end of the forward primer was labeled with FAM fluorescent markers. Primer information is shown in Table 1.

[0023] Table 1: Primer information for screening SNPs in blue-spotted mackerel

[0024] 2.3 PCR amplification and genotyping The PCR reaction system consisted of 25 μL: 17.75 μL ddH2O, 2.5 μL 10×Buffer, 2.0 μL dNTPs, 0.5 μL each primer, 1.5 μL DNA template, and 1.25 U Taq enzyme. Reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55-60℃ annealing for 30 s (adjusted according to primers), 72℃ extension for 45 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The PCR products were sent to Shanghai Meiji Biomedical Technology Co., Ltd. for electrophoresis and genotyping.

[0025] 2.4 Data Analysis The allele frequency, observed heterozygosity (Ho), expected heterozygosity (He), and polymorphism information content (PIC) of each SNP locus were calculated using POPGENE32 software. SPSS 22.0 software was used to perform association analysis between SNP loci and disease resistance traits in the two populations. The chi-square test was used to compare differences in genotype distribution, with P < 0.01 considered highly significant.

[0026] The results showed that 33 alleles were detected at the 10 SNP loci in the resistant group, with an average of 3.3 alleles; and 22 alleles were detected in the susceptible group, with an average of 2.2 alleles. Polymorphism analysis is shown in Table 2.

[0027] Table 2: Polymorphism information of SNP sites related to disease resistance in blue-spotted mackerel

[0028] 2.5 Results of Association Analysis General linear model (GLM) analysis revealed that the DL-7 and DL-8 SNP loci were significantly associated with disease resistance (P<0.01). Specifically, the CC genotype at the DL-8 locus had a significantly higher frequency of distribution in the resistant group than in the susceptible group (76% vs 12%), and the survival rate of individuals with this genotype after challenge was significantly higher than that of individuals with the CT and TT genotypes (P<0.01). The association analysis results between different genotypes and disease resistance are shown in Table 3.

[0029] Table 3: Association analysis of different DL-8 genotypes with disease resistance traits at SNP loci

[0030] Sequencing analysis results indicate that the DL-8 site ( Figure 3 The frequency of the CC genotype was significantly higher in the disease-resistant group than in the susceptible group.

[0031] The SNP site is molecularly labeled as being located at position 130 of the sequence SEQ ID NO:1, with the bases C / T. ATAATCGTATTTCTAATCAGTGCGTTCGTACTTTACATTATTGTAGCTATGATCACAACTAAACTCACCAATAGCTACATCCTCGACTCCCAAGAGATTGAAATCATCTGAACAGTCCTCCCAGCTATC[C / T]TTCTCATCCTTATTGCTCTTCCCTCCCTACGTATTCTTTACCTAATAGACGAAATTAATGACCCTCATTTAACAATCAAGGCTGTAGGTCATCAGTG.

[0032] Therefore, by using upstream and downstream primers (SEQ ID NO:2 and SEQ ID NO:3), blue-spotted mackerel individuals with anti-Vibrio potential can be screened; among them, the CC genotype blue-spotted mackerel has better disease resistance potential.

[0033] Example 3: Application of SNP markers associated with disease resistance traits in blue-spotted mackerel At Xiangshan Harbor Aquatic Seedling Co., Ltd. in Huangbiao Township, Xiangshan County, Ningbo, 200 offspring individuals of blue-spotted mackerel fry were tested. Genomic DNA of each blue-spotted mackerel was obtained through non-destructive sampling. PCR amplification and sequencing were performed using primer pairs with upstream and downstream sequences of SEQ ID NO:2 and SEQ ID NO:3 to screen individuals with the CC genotype.

[0034] From 200 blue-spotted mackerel fry, 65 individuals with the CC genotype were selected. These selected individuals were then raised under the same conditions as the other individuals: water temperature of 25-30 degrees Celsius, salinity maintained at 32-35‰, pH between 6-8, and water quality kept clear. Ammonia nitrogen, nitrite, and other indicators were regularly monitored to maintain water quality stability. After 7 months of rearing, a challenge experiment was conducted using Vibrio anguillarum (injected at a concentration of 1×10⁻⁶). 7 The CFU / mL concentration was observed for 14 days, and the results (Table 4) showed that individuals with the CC genotype had significant disease resistance.

[0035] Table 4: Survival rate of blue-spotted mackerel after virus challenge in different genotype groups

[0036] The 65 individuals with the CC genotype obtained through screening were used as parents for seedling cultivation. When the offspring reached 5 months of age, 100 healthy individuals were randomly selected for a challenge experiment (under the same conditions as in Example 1). The offspring population showed a high average survival rate (87%).

[0037] In summary, individuals screened using the SNP sites provided by this invention exhibit significant disease resistance. When these individuals are used as parents for breeding, the offspring also show good disease resistance, indicating that the SNP molecular markers provided by this invention can be used to screen blue-spotted mackerel parents with better disease resistance traits.

Claims

1. A molecular marker for an SNP site, characterized in that, The SNP site molecular marker is located at position 130 of the sequence SEQ ID NO:1, and its base is C / T.

2. The SNP site molecular marker as described in claim 1, characterized in that, The SNP site molecular markers mentioned above are linked to the vibrio resistance trait of blue-spotted mackerel.

3. A primer pair, characterized in that, The primer pair is used to detect the SNP site molecular markers of claim 1.

4. The primer pair as described in claim 3, characterized in that, The primer pair has the sequence of the forward primer as SEQ ID NO:2 and the sequence of the reverse primer as SEQ ID NO:

3.

5. The application of the SNP site molecular marker as described in claim 1 as a screening site in screening blue-spotted mackerel individuals with vibriosis resistance.

6. A method for screening blue-spotted mackerel parents resistant to Vibrio spp., characterized in that, The method described herein is to screen individuals whose SNP site molecular markers as described in claim 1 are homozygous for CC.

7. The method as described in claim 6, characterized in that, The method described involves amplifying the nucleic acid samples of individuals to be screened using PCR primers, and then performing genotyping or sequencing on the amplified products for screening.

8. The method as described in claim 7, characterized in that, The primer pair described herein is the primer pair as described in claim 3.

9. A method for artificial breeding of blue-spotted mackerel fry, characterized in that, The method involves using the parent stock selected by the method described in claim 6 for seedling cultivation.