Saccharopolyspora spinosa as well as construction method and application thereof

Abstract

The invention discloses saccharopolyspora spinosa as well as a construction method and application thereof, the saccharopolyspora spinosa is a spinosad production strain HU27365 of overexpression propionyl-coenzyme A carboxylase pccB gene, the saccharopolyspora spinosa HU27365 is preserved in the China Center for Type Culture Collection (CCTCC) on August 7, 2025, and the preservation number is CCTCCM 20251793. According to the method, by enhancing a fatty acid metabolic pathway and overexpressing a key gene propionyl-coenzyme A carboxylase pccB gene for biosynthesis of spinosad, supply of an important precursor methylmalonyl-coenzyme A for biosynthesis of spinosad is improved, and the yield of spinosad is remarkably increased. According to the metabolic engineering method, the saccharopolyspora spinosa can be promoted to synthesize the spinosad, and the fermentation level of the spinosad is remarkably improved.

Description

TECHNICAL FIELD

[0001] The present application relates to a strain of Saccharopolyspora spinosa, a construction method and application thereof, and belongs to the technical field of biotechnology, in particular to a method for improving the production of polymyxin by metabolic engineering technology to transform Saccharopolyspora spinosa. BACKGROUND

[0002] Saccharopolyspora spinosa is an aerobic gram-positive non-acid-fast actinomycete of the genus Saccharopolyspora, which can produce the large ring lactone green biological insecticide polymyxin, has the advantages of high efficiency, target, wide insecticidal spectrum, natural degradation, and no carcinogenic, teratogenic, mutagenic properties, and is widely used in the prevention and control of agricultural and forestry pests. Although chemical pesticides play a key role in the prevention and control of pests, the ecological environmental pollution, pest resistance and food safety problems caused by long-term abuse have seriously threatened the sustainable development of agriculture. In addition, the application of polymyxin has expanded to emerging fields in recent years, especially in the treatment of pet parasites.

[0003] However, the core problem restricting the industrialization development of polymyxin is the insufficient metabolic efficiency of the production strain. The original strain of Saccharopolyspora spinosa has technical defects such as long fermentation cycle and low product titer, but in the process of constructing high-yield strains, the precise selection of key target genes and the directional optimization of metabolic pathways are still the technical bottlenecks to be broken through. The current genetic improvement based on synthetic biology strategy still faces major challenges brought by metabolic node gene function redundancy and regulatory network complexity. Therefore, based on the existing high-yield mutant strains in the laboratory, the transcriptional data screening and gene editing for directional modification of high-yield strains aim to improve the production of polymyxin, provide new evidence for analyzing the regulation network of polymyxin biosynthesis, and provide innovative strategies for constructing high-yield engineering strains, which has important practical value for promoting the construction of green plant protection technology system and ensuring food security in China.

[0004] The main active ingredient of spinosad is composed of spinosyn A and spinosyn D, wherein spinosyn A accounts for about 85-95%, which is the main component of the biological activity of the compound, and the molecular structure is as follows. The molecule takes the tetraloop polyketone glycoside as the core skeleton, and its unique structure is composed of a twelve-membered lactone macrocycle and a three-ring system with a 5,6,5-cis-trans-cis configuration. The C9 and C17 positions are respectively modified by stereospecific glycosylation, and covalently connected with forosamine and 2,3,4-tri-O-methylated rhamnose (TMR). The spatial cooperation of this double sugar unit makes the group present a stable spatial conformation. In contrast, although spinosyn D only accounts for 5-15%, the difference in substituents at the C6 site of its molecule affects its binding ability to the target receptor, thereby exhibiting a complementary insecticidal spectrum to spinosyn A.

[0005]

[0006] At present, the traditional physical and chemical mutagenesis method is mainly used to improve the fermentation yield of spinosad. This random mutation has certain blindness, and the screening workload is large, the period is long, and the yield does not change much after multiple mutations. In order to overcome the above problems, through the method of metabolic engineering directed transformation, the strain can be optimized more rationally, and the supply of precursor substances closely related to the synthesis of spinosad is enhanced through strengthening the key synthesis and metabolic pathways, which is an effective means to improve the fermentation unit.

[0007] Therefore, a method for enhancing the expression of the fatty acid beta oxidation pathway of Saccharopolyspora spinosa is provided, and a high-yield genetic engineering strain of spinosad is constructed, which is of great significance for improving the fermentation unit of spinosad. SUMMARY

[0008] The purpose of the present application is to provide a strain of Saccharopolyspora spinosa and its construction method and application.

[0009] To achieve the above-mentioned objects and other related objects, the technical scheme provided by the present application is as follows: a strain of Saccharopolyspora spinosa, wherein the strain of Saccharopolyspora spinosa is Saccharopolyspora spinosa HU27365, which has been preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC M 20251793 and a preservation date of August 7, 2025.

[0010] To achieve the above-mentioned objects and other related objects, the technical scheme provided by the present application is as follows: a method for constructing the Saccharopolyspora spinosa, comprising the following steps:

[0011] Step 1: constructing an expression plasmid containing a pccB gene encoding propionyl coenzyme A carboxylase;

[0012] Step 2: the expression plasmid is introduced into Saccharopolyspora spinosa, and thus the genetically engineered strain is obtained.

[0013] The preferred technical solution is that the pccB fragment of the propionyl-CoA carboxylase gene is from Saccharopolyspora spinosa.

[0014] The preferred technical solution is that the pccB fragment of the propionyl-CoA carboxylase gene is obtained by using the genomic DNA of Saccharopolyspora spinosa as a template and using the nucleotide sequence shown in the sequence table SED ID NO. 1 and SED ID NO. 2 as a primer for amplification.

[0015] The preferred technical solution is that the introduction method is conjugation transfer.

[0016] To achieve the above-mentioned and other related purposes, the technical solution provided by the present application is: a method for improving the production of spinosyn by Saccharopolyspora spinosa.

[0017] Due to the use of the above technical solution, the present application has the following advantages compared with the prior art:

[0018] The present application improves the supply of important precursors of spinosyn biosynthesis, acetyl-CoA and malonyl-CoA, by enhancing the expression of the fatty acid beta oxidation pathway of Saccharopolyspora spinosa, and the production of spinosyn of the obtained genetically engineered strain is significantly improved compared with the original strain. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 : Construction map of vector pOJ260-PermE.

[0020] Figure 2 : Schematic diagram of construction of pccB expression enhancement vector of fatty acid metabolism pathway propionyl-CoA carboxylase gene.

[0021] Figure 3 : Band map related to construction of pccB overexpression vector, including linearized vector pOJ260-PermE, PCR amplified pccB gene fragment and PCR verification of transformed monoclonal; M: DNA marker (Takara DL5000).

[0022] Figure 4 : Schematic diagram of construction of overexpression strain Spinosad∷27365.

[0023] Figure 5 : PCR verification map of related sequences of overexpression strain Spinosad∷27365.

[0024] Figure 6: Overexpression plasmid poJ260-PermE-27365 and overexpression strain Spinosad∷27365 genome sequencing comparison verification. DETAILED DESCRIPTION

[0025] The following specific embodiments illustrate the embodiments of the present application, and those skilled in the art can easily understand other advantages and effects of the present application from the content disclosed in the specification.

[0026] Please refer to Figures 1-6 It should be understood that the structures, proportions, sizes, etc. shown in the drawings attached to the specification are only used to cooperate with the content disclosed in the specification for those skilled in the art to understand and read, and are not used to limit the defined conditions under which the present application can be implemented, so they do not have technical significance. Any modification of the structure, change of the proportional relationship or adjustment of the size, without affecting the effects that can be produced by the present application and the purposes that can be achieved, should still fall within the scope of the technical content disclosed by the present application. At the same time, the terms such as "upper", "lower", "left", "right", "middle" and "one" used in the specification are only for the convenience of clear description, and are not used to limit the scope in which the present application can be implemented, and the change or adjustment of the relative relationship, without substantially changing the technical content, is also considered as the scope in which the present application can be implemented.

[0027] Preservation of the strain: Saccharopolyspora spinosa HU27365 has been preserved in the China Center for Type Culture Collection (CCTCC), with the preservation number CCTCC M 20251793 and the preservation date August 7, 2025. The preservation address is Wuhan University, Wuhan, China.

[0028] Example 1: A strain of Saccharopolyspora spinosa and its construction method and application

[0029] 1. Obtaining of the starting strain

[0030] The common Saccharopolyspora spinosa strain preserved in the laboratory is the starting strain.

[0031] 2. PCR amplification of the pccB fragment of the Saccharopolyspora spinosa propionyl-CoA carboxylase encoding gene

[0032] 2.1 Design of primers Gene ID: IAG28_RS27365 coding region DNA sequence, a pair of primers are designed for amplification.

[0033] The primer sequences are as follows:

[0034] The primer sequence for amplifying the 1.647 kb length pccB DNA fragment is as follows:

[0035] Primer 1 (41-27365-LF forward primer, as shown in the sequence listing SED ID NO.1): 5´-gtgccggttggtaggatccacatatgatgagcagcgcgacggagc-3´;

[0036] Primer 2 (42-27365-LR reverse primer, as shown in the sequence listing SED ID NO.2): 5´- cggatcctctagaggatccccaacatatgtcacagcgggatgttgccgtg-3´;

[0037] 2.2 PCR amplification of the pccB gene in Polyspora sacchariformis

[0038] Amplification of pccB: Using *Polysporium spp.* genomic DNA as a template, primers Primer 1 and Primer 2 were used. PCR amplification was performed using HS DNA polymerase (TaKaRa). PCR reaction solution composition:

[0039] 5 x PrimeSTAR Buffer 10 μl

[0040] dNTP Mixture 5 μl

[0041] Primer 1 1 μl

[0042] Primer 2 1 μl

[0043] Template 1 μl

[0044] PrimeSTAR HS DNA Polymerase 0.5 μl

[0045] DMSO 0.5 μl

[0046] sterile water to 50 μl

[0047] The amplification conditions were as follows: 94℃ for 5 minutes; followed by 98℃ for 10 seconds, annealing at 68℃ for 20 seconds, and 72℃ for 1 minute, for a total of 29 cycles; and finally 72℃ for 5 minutes. After the reaction, the PCR products were detected by 1% agarose gel electrophoresis, and the expected specific bands appeared at the marker size of 1.5 kb. Figure 3 The target band (B) was gel-digested and recovered for subsequent vector construction. The sequence of the obtained pccB gene fragment is as follows:

[0048] ATGAGCAGCG CGACGGAGCC GGTCGGTCAG CCGCCGGTTG ACGTGCCGGA CATCCACACGACCGCCGGCA AGCTGGCGGA TCTGTACCGG CGGAATGATG AGGCGGTGCA CGCCGGCTCG GCGCGCGCGGTTGCCAAGCA GCACGCGAAG GGCAAGAACA CCGCCCGCGA ACGCATCGAC ATGCTGCTGG ACCCGGGTTCGTTCGTGGAG CTCGACGAGC ACGCGCGGCA CCGCTCCACG AACTTCGGCA TGGACGCGAA CCGCCCCTACGGCGACGGCG TGGTGACCGG CTACGGCACC GTCGACGGCC GCAAGGTGTG CGTGTTCTCC CAGGACTTCACCGTCTTCGG CGGGTCGTTG GGCGAGGTGT TCGGCGAGAA GATCGTCAAG GTCATGGACC TGGCGCTGAAGACCGGCTGC CCGCTGATCG GCATCAACGA TTCCGGCGGC GCGCGCATCC AGGAGGGCGT CGCCGCGCTCGGCCTGTACG CCGAGATCTT CAAGCGCAAC ACCCACGCCT CCGGCGTCAT CCCGCAGATC TCGCTGATCATGGGCCCGTG CGCGGGCGGC GCGGTGTACT CCCCGGCGAT CACCGACTTC ACCGTGATGG TCGACCAGACCTCGCACATG TTCATCACCG GCCCGGACGT GATCAAGACG GTCACCGGCG AGGACGTGAC CTTCGAGGAGCTCGGCGGCG CGCGCACCCA CAACTCGCGC TCCGGCAACG CGCACTACCT GGCCACCGAC GAGGCGGACGCCATCGCCTA CGTCAAGGAG CTGCTGTCGT TCCTGCCCAG CAACAACCTG GCCGAGGCGC CGGTGTTCGAGGGCACCGAC ACCGACGCGG GCACCGGCTC GGTCGCCGAG TCGATCACAG ACGCCGACCG CGAGCTGGACGCGCTGATCC CGGACTCGCCGAACCAGCCC TACGACATGC ACGAGGTCAT CTCCCGCGTC GCGGACGACGAGGAGTTCCT GGAGGTCGGG GCGCTGTTCG CACCGAACAT CATCACCGGC TACGGGCGCA TCGAGGGCCACCCGGTGGGT GTGGTGGCCA ACCAGCCCAC CCAGTTCGCC GGCACCCTGG ACATCGACGC CAGCGAGAAGGCCGCGCGGT TCGTGCGCAC CTGCGACGCC TTCAACATCC CGGTGCTGAC CTTCGTGGAC GTACCGGGCTTCCTGCCGGG CACCGACCAG GAGTGGAACG GCATCATCCG GCGCGGCGCG AAGCTGCTGT ACGCCTACGCCGAGGCGACC GTCCCGCTGG TCACCGTGAT CACCCGCAAG GCCTACGGCG GCGCCTACGA CGTGATGGGCTCGAAGCACC TGGGGGCCGA CGTCAACCTG GCGTGGCCGA CCGCGCAGAT CGCGGTGATG GGGGCGCAGGGCGCGGTGAA CATCCTGCAC CGGCGGCAGC TGGCGGAGGC GGCGGACAAC GGCGAGGACG TCGAGGCCGTGCGCGCGCAG TTGCAGCAGG AGTACGAGGA CACCCTCTGC AACCCGTACG TGGCCGCCGA ACGCGGCTACGTCGACTCGG TGATCCCACC GTCCTACACC CGCGGGTACG TGGCGCGGTC GCTGCGGATG CTCCGCGACAAGCGCGCCAG CCTGCCCGCG AAGAAGCACG GCAACATCCC GCTGTGA.

[0049] 3. Construction of plasmid for enhanced expression of fatty acid metabolic pathway

[0050] The expression vector of the fatty acid metabolic pathway enhancement gene pccB is shown in the following scheme: Figure 2 The specific method is as follows: the vector poJ260 is treated with Nde I for single enzyme cutting as shown in Fig. A, and the map of the vector is shown in Fig. B. Figure 3 Figure 1 ​The enzyme digestion products were recovered by gel recovery and the recovered products were ligated by Gibson Assembly technology. The ligation products were transformed into E. coli Top 10 competent cells, which were incubated overnight at 37°C on LB (yeast extract 5 g, tryptone 10 g, NaCl 10 g, agar 20 g, add water to 1 liter, adjust pH to 7.2) plates containing 50 μg / mL apramycin.

[0051] The primer sequences are as follows:

[0052] A single colony was picked for amplification of a 841 bp DNA fragment using the following primer sequences:

[0053] Primer 3 (62, forward primer, as shown in SEQ ID NO. 3 of the sequence listing): 5'- ttgatcggcactttgcatcgg-3';

[0054] Primer 4 (63, reverse primer, as shown in SEQ ID NO. 4 of the sequence listing): 5'- aagacggtgaagtcctgggag-3';

[0055] The plasmid construction was verified by amplification using specific primers Primer 3 and Primer 4 Figure 3 C): The transformant PCR product was consistent with the expected size (841 bp). No frameshift or point mutations were detected by sequencing analysis, and the overexpression vector was officially named pOJ260-PermE-27365.

[0056] 4. Obtaining of a strain with enhanced fatty acid metabolic pathway of Saccharopolyspora spinosa

[0057] The plasmid pOJ260-PermE-27365 was transformed into E. coli S17-1 λpir, which was spread on LB plate medium containing 50 μg / mL apramycin, and transformants were picked to extract plasmids and perform enzyme digestion verification. The construction of the donor bacterium E. coli S17-1 poJ260-PermE-27365 was completed.

[0058] Intergeneric mycelial conjugation between E. coli and Saccharopolyspora:

[0059] Donor bacteria E. coli S17-1 poJ260-PermE-27365 culture, collection and washing: 1) pick 3 single colonies of E. coli S17-1 from the LB plate with the corresponding antibiotic, inoculate into LB medium containing the corresponding antibiotic, 37°C, 220 rpm overnight culture (about 12 h); 2) perform PCR verification on the 3 clones respectively to determine whether the inoculated E. coli clone is correct; 3) add 10% bacterial solution to the LB liquid medium containing the antibiotic. 37°C, 220 rpm, culture for about 3 h, measure OD 600 whether it is 0.4-0.6; 4) distribute the bacterial solution into 2 1.5 mL EP tubes, 12000 rpm, instant separation, remove the supernatant on the clean bench; 5) add 1 mL of sterilized LB liquid medium without antibiotic to collect into one tube, mix well with a pipette, and wash the bacterial cells; 6) repeat the washing 3 times, add 600 μL of liquid LB medium to resuspend the bacterial cells, and place at room temperature for standby. Culture in the LB liquid medium containing the above apramycin to OD 600 = 0.4-0.6.

[0060] Recipient bacteria S. spinosa treatment method: 1) inoculate the seed liquid frozen at -20°C into 20 mL TSB medium (TSB 30 g / L, 121°C sterilization for 20 min) at an inoculation amount of 1%, and culture at 28°C for 48 h; 2) inoculate the above bacterial solution into 18 mL TSB medium at an inoculation amount of 10%, and culture at 28°C for 24 h; 3) inoculate the above bacterial solution into 16 mL TSB medium at an inoculation amount of 25%, and culture at 28°C for 6 h as the recipient bacteria; 4) centrifuge at 8000 rpm for 5 min to collect the mycelium, discard the supernatant, and resuspend in 1 mL TSB medium. 12000 rpm, instant separation, remove the supernatant; 5) take 300 μL of the treated E. coli to resuspend the S. spinosa precipitate, evenly spread on the R6 conjugation transfer plate, and culture at 28°C for 16 h; 6) add NA and Apra each 25 μL in 300 mL sterile water, mix well, and pour onto the R6 culture medium (Sucrose 200g, BHI 26 g, Dextrin 10g, Casamino Acids 1g, K2SO4 0.1g, FeSO4•7H2O 0.1g, MgSO4•7H2O 0.05g, MnCl2•4H2O 0.001g, ZnSO4•7H2O 0.001g, Agar 20g, add ddH2O to 950 mL, 115°C sterilization for 25 min. Add 32.5 mL of 2M L-glutamic acid sodium, 10 mL of 5M CaCl2•2H2O and 5 mL of 1M MOPS) surface, and after the adsorption layer is completely dried, culture at 28°C for 7-14 d, and the colonies grown are the conjugants containing poJ260-PermE-27365.

[0061] The spores of the conjugants were inoculated on the plate medium containing Apra (50 μg / mL) and incubated at 28°C for 10 days. Based on the characteristics of the pOJ260 suicide vector (unable to replicate autonomously, its stable existence depends on genomic integration), the continuous growth of positive clones confirmed that the recombinant plasmid pOJ260-PermE-27365 had been stably integrated into the host genome by homologous recombination mechanism, as shown in Figure 4

[0062] 5. PCR verification of the conjugant strain

[0063] The conjugants with abundant sporulation were selected and passaged on fresh solid plate medium (soluble starch 5 g, glucose 5 g, mannitol 5 g, yeast extract powder 5 g, malt extract powder 10 g, enzymatic hydrolysis casein 7.5 g, MgSO4·7H2O 2 g, agar 20 g, add water to 1 liter, adjust pH to 7.2. Sterilize at 115°C for 30 min) containing 50 μg / mL apramycin. After about 10 days of culture, spores were obtained. The grown spores were further passaged on solid medium without antibiotics for 3 times. The single colonies with good growth were inoculated into TSB medium and cultured at 28°C for 2-3 days. The whole genome DNA was extracted and PCR verification was performed to determine whether the conjugants lost the plasmid during the antibiotic-free passage. The specific steps are as follows: using the extracted strain DNA as the template, the primer pair Primer 5 / Primer 6 and Primer 7 / Primer 8 were used for PCR verification of the internal strong promoter and Apra resistance band of the strain, respectively. The primer pair Primer 9 / Primer 10 was used for PCR detection of whether the vector was integrated into the specific site in the strain.

[0064] The primer sequences are as follows:

[0065] Primer 5 (54, forward primer, as shown in SEQ ID NO. 5 of the sequence listing): 5'-ctcttcgctattacgccagct-3'

[0066] Primer 6 (42, reverse primer, as shown in SEQ ID NO. 6 of the sequence listing): 5'-cggatcctctagaggatccccaacatatgtcacagcgggatgttgccgtg-3'

[0067] Primer 7 (Apra-F, forward primer, as shown in SEQ ID NO. 7 of the sequence listing): 5'-gctcatcggtcagcttctcaac-3'

[0068] ​Primer 8 (Apra-R, reverse primer, as shown in SEQ ID NO. 8 of the Sequence Listing): 5'-cttcgcatcccgcctctg-3'

[0069] Primer 9 (64-27365-G-F, forward primer, as shown in SEQ ID NO. 9 of the Sequence Listing): 5'-atggctgaggtgagcaatccac-3'

[0070] Primer 10 (40-27365-yz-I-R, reverse primer, as shown in SEQ ID NO. 10 of the Sequence Listing): 5'-agcttggagcgaacgacctaca-3'

[0071] PCR amplification of PermE-pccB, agarose gel electrophoresis verification showed that the genomic PCR amplification product of the gene modified strain conjugant presented a specific band at 2.0 kb, while the negative control (genomic DNA of the high-yield mutant strain of Saccharopolyspora spinosa) had no target band at the same migration position as shown in Fig. A of Figure 5 Apra resistance gene PCR fragment detection, a DNA band of about 719 bp appeared as shown in Fig. B of Figure 5 Using the Spinosad∷27365 genome as a template, the PCR amplification of the upstream homologous arm and the internal primer Primer 9 / Primer 10 fragment was performed, and a DNA band of about 3.8Kb appeared, while the negative control had no band at the corresponding size position as shown in Fig. C of Figure 5 No frameshift or point mutation was detected by sequencing analysis, and the overexpression mutant strain Spinosad∷27365 was successfully constructed as shown in Fig. D of Figure 6

[0072] Example 2: Comparison of shake flask fermentation of fatty acid metabolic pathway enhanced strain and starting strain

[0073] 1. Shake flask fermentation of starting strain and overexpression mutant strain Spinosad∷27365

[0074] The spores of the Saccharopolyspora spinosa starting strain and the engineering strain were diluted and spread on solid plate medium. After incubation at 28°C for 6d, single colonies were picked and cultured on solid medium for 12d.

[0075] ​Seed culture of Saccharopolyspora spinosa: well-grown single colonies were inoculated into 250 mL flasks containing 20 mL seed culture medium, and cultured at 28°C, 220 rpm for 72 h to obtain Saccharopolyspora spinosa seed liquid. The seed culture medium (1 L) contained 20 g of glucose, 20 g of dextrin, 15 g of yeast extract, 25 g of cottonseed cake powder, 1 g of ammonium sulfate, 2 g of MgSO4·7H2O, and the pH was 7.0. The medium was sterilized at 121°C for 20 min.

[0076] Fermentation culture of Saccharopolyspora spinosa: the seed liquid was inoculated into 250 mL flasks containing 25 mL fermentation medium at an inoculation amount of 10%, and cultured at 28°C, 220 rpm for 14 d. The fermentation medium (1 L) contained 80 g of glucose, 32.5 g of cottonseed cake powder, 6.5 g of soybean cake powder, 7 g of corn steep liquor, 10 g of corn starch, 2 g of yeast extract, 5 g of CaCO3, and 42 mL of methyl oleate, and the pH was adjusted to 7.0. The medium was sterilized at 121°C for 20 min.

[0077] Saccharopolyspora spinosa and strain Spinosad∷27365 were sampled at different time points during fermentation culture, and each strain was designed to have three flask replicates at each sampling point. After fermentation for 14-20 d, the HPLC fermentation parameters of spinosad were detected, and the specific detection method was as follows:

[0078] HPLC detection of spinosad: 250 μL of fermentation liquid was mixed with 750 μL of methanol solution, diluted by 10 times, and oscillated in a shaker at 2500 r / min for 30 min. Centrifugation was performed at 12000 r / min for 5 min. The supernatant was collected by a syringe and filtered through a 0.22 μm organic phase filter. Welch Ultimate® XB-C18 (5 μm, 4.6×250 mm) was used, the column temperature was 25°C, the mobile phase was methanol-acetonitrile-water (45:45:10), the mobile phase contained 10% 6 mM ammonium acetate, the flow rate was 1.0 mL / min, the injection volume was 20 μL, and the wavelength was 250 nm.

[0079] By metabolic engineering of the fatty acid metabolic pathway of Saccharopolyspora spinosa, the yield of spinosad was increased by more than 35% compared with the original strain, reaching 10.8 g / L.

[0080]

[0081] Example 3: A strain of Saccharopolyspora spinosa and a construction method and application thereof

[0082] The present example provides a method for constructing a high-yield genetically engineered strain of spinosad by strengthening the fatty acid metabolic pathway, which comprises the following steps:

[0083] (1) Constructing an expression plasmid containing a pccB fragment of a gene encoding propionyl-CoA carboxylase.

[0084] (2) Introducing the expression plasmid into Saccharopolyspora spinosa to obtain a genetically engineered strain HU27365 with high yield of spinosad.

[0085] The pccB fragment of the gene encoding propionyl-CoA carboxylase in the present application is from bacteria, and the two genes are widely present in organisms (prokaryotic and eukaryotic organisms); preferably from Saccharopolyspora spinosa.

[0086] Further, the pccB fragment of the gene encoding propionyl-CoA carboxylase is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 of the sequence listing, respectively, with Saccharopolyspora spinosa genomic DNA as a template. An artificially synthesized promoter sequence is introduced at the 5' end of the pccB gene by the above method.

[0087] The method for introducing the expression plasmid into Saccharopolyspora spinosa can be conjugation transfer, protoplast transformation, electroporation, etc.

[0088] In the conjugation transfer method, the expression plasmid is first transformed into Escherichia coli S17-1 lambda pir to obtain a recombinant Escherichia coli, and then the recombinant Escherichia coli is subjected to conjugation transfer with Saccharopolyspora spinosa.

[0089] The starting vector for constructing the expression plasmid in the present application is an Escherichia coli-Streptomyces shuttle vector, including but not limited to the suicide vectors pOJ260, pRM4, pSET152, etc. The vector has a DNA transferase gene, an integration site, and an antibiotic resistance selection marker.

[0090] In a preferred embodiment of the present application, the Escherichia coli-Streptomyces shuttle vector is pOJ260, and the expression plasmid constructed using pOJ260 as the starting vector is poJ260-PermE-27365.

[0091] Further, after the expression plasmid is transformed into the Saccharopolyspora spinosa mutant strain in step (2), a transformant strain is obtained, and the transformant is subjected to PCR verification using primers with nucleotide sequences as shown in SEQ ID NO. 9 and SEQ ID NO. 10 of the sequence listing, to finally obtain the genetically engineered strain Spinosad∷27365 with high yield of spinosad.

[0092] The spores of the genetically engineered strain are subcultured on solid plate medium without antibiotics. The stability of the expression plasmid in the genome is confirmed by three subcultures. The stably subcultured strain is subjected to fermentation culture, and compared with the S. cisticola strain (the starting strain) to verify the high production performance of the spores.

[0093] The above merely explains the preferred embodiments of the present application, and is not intended to limit the present application in any form. Any modification or change related to the present application made under the same inventive spirit shall still be included in the scope intended to be protected by the present application.

Claims

1. A strain of Saccharopolyspora sp. characterized in that, The Saccharopolyspora is Saccharopolyspora HU27365, which has been preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC M 20251793 and a preservation date of August 7, 2025.

2. A method of constructing the C. spinose spores of claim 1, characterized by, The method comprises the following steps: Step 1: constructing an expression plasmid containing a pccB gene encoding propionyl-CoA carboxylase; Step 2: introducing the expression plasmid into the Saccharopolyspora to obtain the Saccharopolyspora.

3. The method of claim 2, wherein: The pccB gene encoding propionyl-CoA carboxylase is from the Saccharopolyspora.

4. The method of claim 2, wherein: The pccB gene encoding propionyl-CoA carboxylase is obtained by amplification using a primer with a nucleotide sequence as shown in the sequence table SED ID NO. 1 and SED ID NO. 2 as a template of genomic DNA of the Saccharopolyspora.

5. The method of claim 2, wherein: The introduction method is conjugation transfer.

6. A method of increasing production of a spinosyn by Saccharopolyspora spinosa, the method comprising: The Saccharopolyspora of claim 1 is used for fermentation.

Images