Saccharomyces cerevisiae with high yield of salidroside as well as construction method and application of saccharomyces cerevisiae

Abstract

The invention discloses saccharomyces cerevisiae with high yield of salidroside as well as a construction method and application of the saccharomyces cerevisiae. According to the recombinant saccharomyces cerevisiae, ribulose-5-phosphate isomerase RKI1 and transketolase TKL1 are expressed in host bacteria, so that precursor supply is increased; reverse methyltransferase ARO2 and phenylalanine decarboxylase ARO10 are expressed at the same time, and a tyrosine branch pathway is adjusted; then, UDP-glycosyl transferase of different sources is expressed, and iterative site-specific mutagenesis is carried out on the UDP-glycosyl transferase to enhance conversion of hydroxytyrosol to salidroside; the salidroside production performance of the recombinant strain is verified on the basis of a precursor supply pathway, a tyrosine regulation pathway and key enzyme screening, and the salidroside production capacity of the saccharomyces cerevisiae is further improved.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a high-yield Rhodioloside-producing Saccharomyces cerevisiae strain, its construction method, and its application. Background Technology

[0002] brewing yeast ( Saccharomyces cerevisiae Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is one of the most widely used engineered bacteria in the field of bioengineering. It was also the first eukaryote to have its genome sequenced. It boasts advantages such as a short growth cycle, strong fermentation capacity, ease of large-scale cultivation, and rich nutritional components including various proteins, amino acids, vitamins, and bioactive substances. Saccharomyces cerevisiae is listed as "Generally Recognized As Safe" (GRAS) strains by the U.S. Food and Drug Administration (FDA) and the Codex Alimentarius Commission (CAC), meaning it can be used in the production of food, health products, or pharmaceutical intermediates without requiring additional complex safety assessments. Saccharomyces cerevisiae possesses a complete eukaryotic protein folding system, avoiding the problem of "inactive inclusion bodies" that easily form when prokaryotic engineered bacteria (such as E. coli) express eukaryotic proteins, thus maintaining enzyme catalytic activity. Due to its excellent genetic characteristics, clear genetic background, mature molecular manipulation tools, broad substrate spectrum, and strong acid resistance, Saccharomyces cerevisiae has a natural advantage in the production of various amino acid derivatives.

[0003] Rhodioloside is a natural product with anti-hypoxia, antioxidant, anti-aging, and anti-tumor activities, and is widely used in cosmetics and pharmaceuticals. On one hand, it directly scavenges harmful free radicals such as reactive oxygen species (ROS) and hydroxyl radicals (·OH) in the body; on the other hand, it activates the body's antioxidant enzyme system (such as superoxide dismutase SOD and glutathione peroxidase GSH-Px), enhancing the cell's own antioxidant capacity. It reduces free radical damage to cell membranes and DNA, delays skin aging (e.g., reducing wrinkles and improving skin elasticity), protects vascular endothelial cells (reducing the risk of atherosclerosis), and also has antioxidant protective effects on nerve cells and liver cells. In recent years, with the continuous development of synthetic biology, the synthesis of rhodioloside using metabolic engineering and genetic engineering techniques to modify Saccharomyces cerevisiae has become a new research hotspot. Summary of the Invention

[0004] The application provides a recombinant Saccharomyces cerevisiae strain for high-yield production of rhodiolin, wherein reverse methyltransferase ARO2 and phenylalanine decarboxylase ARO10 are expressed in Saccharomyces cerevisiae alone or simultaneously to improve tyrosine utilization; different sources of UDP-glycosyltransferase are screened to promote the conversion of tyrosine to rhodiolin; and iterative site-directed mutation is performed on UDP-glycosyltransferase AtUGT85A1 derived from Arabidopsis thaliana to further improve the rhodiolin yield of the recombinant strain.

[0005] The application also provides a construction method of the above-mentioned recombinant Saccharomyces cerevisiae strain.

[0006] The application also provides application of the above-mentioned recombinant Saccharomyces cerevisiae strain in synthesis of natural product rhodiolin.

[0007] The application adopts the following technical scheme: The recombinant Saccharomyces cerevisiae strain for producing rhodiolin is obtained by expressing endogenous ribulose-5-phosphate isomerase RKI1, transketolase TKL1, reverse methyltransferase ARO2, phenylalanine decarboxylase ARO10 and UDP-glycosyltransferase in a host strain, and the UDP-glycosyltransferase is one of UDP-glycosyltransferases derived from Rhodiolax sachalinenis or Arabidopsis thaliana.

[0008] Preferably, the UDP-glycosyltransferase is UDP-glycosyltransferase RsUGT73B6 and RsUGT74R1 derived from Rhodiolax sachalinenis, and UDP-glycosyltransferase AtUGT73C5 and AtUGT85A1 derived from Arabidopsis thaliana. More preferably, the UDP-glycosyltransferase is UDP-glycosyltransferase AtUGT85A1 derived from Arabidopsis thaliana, which has synergistic ability with RKI1, TKL1, ARO2 and ARO10 and can better promote the production of rhodiolin.

[0009] The host strain is Saccharomyces cerevisiae BY4742.

[0010] The nucleotide sequences of the ribulose-5-phosphate isomerase RKI1 and the transketolase TKL1 are shown in SEQ ID NO: 1-2, respectively. The nucleotide sequences of the reverse methyltransferase ARO2 and the phenylalanine decarboxylase ARO10 are shown in SEQ ID NO: 3-4, respectively. The nucleotide sequences of the UDP-glycosyltransferase RsUGT73B6 and RsUGT74R1 derived from Rhodiolax sachalinenis and the UDP-glycosyltransferase AtUGT73C5 and AtUGT85A1 derived from Arabidopsis thaliana are shown in SEQ ID NO: 5-8, respectively.

[0011] The application also performs site-directed saturation mutation on the I308, F403 sites of the UDP-glycosyltransferase AtUGT85A1, and the yield of salidroside is increased by more than 40%.

[0012] The mutation is any one of I308A, I308L, I308V, I308M, I308F, I308W, I308Y, I308N, I308C, I308Q, I308S, I308T, I308R, I308H, I308K, I308D, I308E, I308G, I308P at the I308 site.

[0013] Further preferably, the 403 site of the I308T mutant is further mutated and replaced by F403A, F403L, F403V, F403M, F403W, F403Y, F403I, F403N, F403C, F403Q, F403S, F403T, F403R, F403H, F403K, F403D, F403E, F403G, F403P, respectively.

[0014] The application also provides a UDP-glycosyltransferase AtUGT85A1 mutant I308T, which is obtained by mutating the 308th amino acid of the UDP-glycosyltransferase AtUGT85A1 shown in SEQ ID NO: 9 from isoleucine (I) to threonine (T).

[0015] The application also provides a UDP-glycosyltransferase AtUGT85A1 mutant I308T F403A, which is obtained by mutating the 308th amino acid of the UDP-glycosyltransferase AtUGT85A1 shown in SEQ ID NO: 9 from isoleucine (I) to threonine (T) and mutating the 403th amino acid from phenylalanine (F) to alanine (A), and the amino acid sequence is shown in SEQ ID NO: 10, and the nucleotide sequence is shown in SEQ ID NO: 11.

[0016] The application also provides a construction method of the recombinant Saccharomyces cerevisiae strain. The recombinant plasmid of RKI1 and TKL1 is constructed by taking pRS404 as a carrier, and the recombinant plasmid is integrated into the TRP1 site of the Saccharomyces cerevisiae BY4742 genome to obtain the Saccharomyces cerevisiae Sc-01 with increased precursor supply; The recombinant plasmid of ARO2 and ARO10 is constructed by taking pRS405 as a carrier, and the recombinant plasmid is integrated into the LEU2 site of the Saccharomyces cerevisiae Sc01 genome to obtain the Saccharomyces cerevisiae Sc-02 with a regulated tyrosine branch pathway; The recombinant plasmids containing the coding genes of UDP-glycosyltransferases RsUGT73B6 and RsUGT74R1 from Rhodiola sachalinenis, AtUGT73C5 and AtUGT85A1 from Arabidopsis thaliana are constructed by taking pRS406 as a carrier, and the recombinant plasmids are integrated into the URA3 site of the genome of Saccharomyces cerevisiae Sc-02 to obtain the Saccharomyces cerevisiae Sc-03, Sc-04, Sc-05 and Sc-06 for producing salidroside. The I308 site and the F403 site of pRS406-AtUGT85A1 are respectively or combinedly subjected to saturation mutation, and the saturation mutation is introduced into the URA3 site of the genome of Saccharomyces cerevisiae Sc-02 to obtain the Saccharomyces cerevisiae for producing salidroside.

[0017] The application of the above-mentioned recombinant Saccharomyces cerevisiae strains in the synthesis of natural products salidroside.

[0018] The application comprises: (1) the recombinant Saccharomyces cerevisiae strains constructed above are cultured on a nutrient medium to obtain a fermentation product; (2) the supernatant of the fermentation liquor is taken every 4 h, and the salidroside yield is detected in liquid phase.

[0019] The medium takes glucose as a carbon source.

[0020] Further preferably, the medium is: 40 g / L glucose, 20 g / L tryptone, 10 g / L yeast extract.

[0021] Further preferably, a fed-batch fermentation mode can be adopted, the initial glucose concentration in the fermenter is 40 g / L, and when the glucose is about to be depleted, the glucose is added to maintain the glucose concentration in the fermenter below 5 g / L.

[0022] Beneficial effects:

[0023] The recombinant Saccharomyces cerevisiae of the application can utilize glucose to synthesize salidroside from scratch, the supply of precursors is increased by expressing ribulose-5-phosphate isomerase and transketolase in Saccharomyces cerevisiae, the tyrosine branch pathway is adjusted by expressing reverse methyltransferase and phenylalanine decarboxylase, and finally, the high-efficiency biosynthesis of salidroside is successfully realized by screening UDP-glycosyltransferases of different sources and iteratively saturating the active sites of the enzymes. Through shake flask fermentation, the strain Sc-08 I308T F403A can realize the production of 1243.17 mg / L of salidroside by utilizing glucose. Meanwhile, the production of 41.07 g / L of salidroside is realized in a 5 L fermenter. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1Figure 1 is a structural diagram of plasmid pRS404-RKI1-TKL1, which carries a TRP1 gene as a screening marker for Saccharomyces cerevisiae.

[0025] Figure 2 Figure 2 is a structural diagram of plasmid pRS405-ARO2-ARO10, which carries a LEU2 gene as a screening marker for Saccharomyces cerevisiae.

[0026] Figure 3 Figure 3 is a structural diagram of plasmid pRS406-RsUGT73B6, which carries a URA3 gene as a screening marker for Saccharomyces cerevisiae.

[0027] Figure 4 Figure 4 is a structural diagram of plasmid pRS406-RsUGT74R1, which carries a URA3 gene as a screening marker for Saccharomyces cerevisiae.

[0028] Figure 5 Figure 5 is a structural diagram of plasmid pRS406-AtUGT73C5, which carries a URA3 gene as a screening marker for Saccharomyces cerevisiae.

[0029] Figure 6 Figure 6 is a structural diagram of plasmid pRS406-AtUGT85A1, which carries a URA3 gene as a screening marker for Saccharomyces cerevisiae.

[0030] Figure 7 Figure 7 is a production yield diagram of the engineered strain BY4742, Sc-01, Sc-02, Sc-03, Sc-04 for producing tyramine with glucose as a carbon source.

[0031] Figure 8 Figure 8 is a production yield diagram of the engineered strain Sc-05, Sc-06, Sc-07, Sc-08 for producing salidroside with glucose as a carbon source.

[0032] Figure 9 Figure 9 is a production yield diagram of the engineered strain Sc-08 I308 site for producing salidroside with glucose as a carbon source.

[0033] Figure 10 Figure 10 is a production yield diagram of the engineered strain Sc-08 I308T F403 site for producing salidroside with glucose as a carbon source.

[0034] Figure 11 Figure 11 is a production yield diagram of the engineered strain Sc-08 I308T F403A for producing salidroside with glucose as a carbon source in a 5 L fermenter. DETAILED DESCRIPTION

[0035] The technical solutions of the present application are further described below in connection with the accompanying drawings, descriptions and examples.

[0036] The original strain used in the examples is Saccharomyces cerevisiae BY4742 strain. Saccharomyces cerevisiae BY4742 strain can be purchased from commercial channels.

[0037] In the examples, the quantitative analysis method of rhodioloside: The liquid chromatograph used in this study is HPLC 1260 series, equipped with a Zorbax SB-C18 chromatographic column (Agilent, 5 μm, 4.6 mm x 250 mm), and the column temperature is 30 ℃. The mobile phase A is 0.05% formic acid aqueous solution, and the mobile phase D is acetonitrile; the flow rate is 1 mL / min. The gradient program is set as follows: within 0-20 min, the proportion of mobile phase D is 10%, within 20-25 min, it is reduced to 5%, then linear gradient from 5% to 95% (25-35 min), maintain 95% concentration for 5 min, finally restore to 10% concentration for 10 min. The absorbance detection wavelength of tyrosol and rhodioloside is 224 nm.

[0038] Example 1 Amplification of genetic elements and preparation of target plasmid (I) Acquisition of target gene According to the coding sequences of ribulose-5-phosphate isomerase RKI1, transketolase TKL1, reverse methyltransferase ARO2, and phenylalanine decarboxylase ARO10 from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed with Saccharomyces cerevisiae genome as template, and the gene sequences are shown in SEQ ID NO: 1-4.

[0039] According to the nucleotide sequences of UDP-glycosyltransferase RsUGT73B6 and RsUGT74R1 from Rhodiola sachalinenis, and UDP-glycosyltransferase AtUGT73C5 and AtUGT85A1 from Arabidopsis thaliana provided on NCBI, the gene sequences shown in SEQ ID NO: 5-8 were obtained after codon optimization. After optimization of the gene codon, the exogenous gene is better adapted to the Saccharomyces cerevisiae chassis.

[0040] (II) Construction of recombinant plasmid 1. Recombinant plasmids BB1-23-RKI1, BB1-23-TKL1, BB1-23-ARO2 and BB1-23-ARO10 were amplified by PCR using Saccharomyces cerevisiae genome as template to obtain RKI1, TKL1, ARO2 and ARO10 gene sequences, and each gene fragment was inserted into plasmid BB1-23 by Goldengate method to obtain recombinant plasmids BB1-23-RKI1, BB1-23-TKL1, BB1-23-ARO2 and BB1-23-ARO10; the construction of recombinant plasmids BB1-23-RsUGT73B6, BB1-23-RsUGT74R1, BB1-23-AtUGT73C5 and BB1-23-AtUGT85A1 was entrusted to Jinshuibiotech Co., Ltd. to synthesize RsUGT73B6, RsUGT74R1, AtUGT73C5 and AtUGT85A1 gene sequences and integrate them into BB1-23.

[0041] RKI1 fragment was amplified using RKI1-F and RKI1-R primers and Saccharomyces cerevisiae genome as template, and the primer sequences are shown in Table 4.

[0042] TKL1 fragment was amplified using TKL1-F and TKL1-R primers and Saccharomyces cerevisiae genome as template, and the primer sequences are shown in Table 4.

[0043] ARO2 fragment was amplified using ARO2-F and ARO2-R primers and Saccharomyces cerevisiae genome as template, and the primer sequences are shown in Table 4.

[0044] ARO10 fragment was amplified using ARO10-F and ARO10-R primers and Saccharomyces cerevisiae genome as template, and the primer sequences are shown in Table 4.

[0045] The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase from Nanjing Novozyme Bio-tech Co., Ltd. The system is shown in Table 1.

[0046] Table 1 System 50 µL Phanta Max Super-Fidelity DNA Polymerase 1 µL buffer 25 µL distilled water 20 µL DNTP 1 µL up 1 µL down 1 µL template 1 µL The amplified RKI1, TKL1, ARO2 and ARO10 fragments were recovered, and agarose gel electrophoresis was used for purification and recovery.

[0047] Bsa1 enzyme and T4 ligase from Shanghai Biyun Tian Bio-technology Co., Ltd. were used for GoldenGate assembly, and the reaction system is shown in Table 2.

[0048] Table 2 System 10 µL BB1-23 1 µL RKI1 / TKL1 / ARO2 / ARO10 1 µL Bsal 0.5 µL BSA 1 µL T4 ligase 0.5 µL T4 buffer 1 µL distilled water 5 µL The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. Positive recombinant plasmids BB1-23-RKI1, BB1-23-TKL1, BB1-23-ARO2 and BB1-23-ARO10 were obtained by screening for kanamycin sulfate resistance plates and verifying by colony PCR and sequencing.

[0049] 2. Recombinant plasmid BB2-AB-pTEF1-RKI1-ScCYC1tt was obtained by inserting plasmid BB1-23-RKI1, plasmid BB1-12-pTEF1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. Recombinant plasmid BB2-BC-pPGK1-TKL1-RPP1Btt was obtained by inserting plasmid BB1-23-TKL1, plasmid BB1-12-pPGK1, and plasmid BB1-34-RPP1Btt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. The GoldenGate method uses Bpi1 enzyme and T4 ligase to insert plasmid BB2-BC, yielding plasmid BB2-BC-pPGK1-TKL1-RPP1Btt; the recombinant plasmid BB2-AB-pTEF1-ARO2-ScCYC1tt is obtained by inserting plasmid BB1-23-ARO2, plasmid BB1-12-pTEF1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase, yielding plasmid BB2-AB-pTEF1-ARO2-ScCYC1tt; the recombinant plasmid BB2-BC-pPGK1... -ARO10-RPP1Btt is obtained by inserting plasmid BB2-BC into plasmid BB2-BC using the GoldenGate method with Bpi1 enzyme and T4 ligase, along with plasmids BB1-23-ARO10, BB1-12-pPGK1, and BB1-34-RPP1Btt. The recombinant plasmid BB2-AB-pTEF1-RsUGT73B6-ScCYC1tt is obtained by inserting plasmid BB1-23-RsUGT73B6 into plasmid BB1-12-pTEF1 and BB1-34-ScCYC1tt using the GoldenGate method with Bpi1 enzyme and T4 ligase. The GoldenGate method uses Bpi1 enzyme and T4 ligase to insert plasmid BB2-AB to obtain plasmid BB2-AB-pTEF1-RsUGT73B6-ScCYC1tt; the recombinant plasmid BB2-AB-pTEF1-RsUGT74R1-ScCYC1tt is obtained by inserting plasmid BB1-23-RsUGT74R1, plasmid BB1-12-pTEF1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase.The recombinant plasmid BB2-AB-pTEF1-AtUGT73C5-ScCYC1tt was obtained by inserting plasmid BB1-23-AtUGT73C5, plasmid BB1-12-pTEF1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. The recombinant plasmid BB2-AB-pTEF1-AtUGT85A1-ScCYC1tt was prepared by inserting plasmid BB1-23-AtUGT85A1, plasmid BB1-12-pTEF1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase, resulting in plasmid BB2-AB-pTEF1-AtUGT85A1-ScCYC1tt.

[0050] The construction process of the recombinant plasmid BB2-AB-pTEF1-RKI1-ScCYC1tt is as follows: GoldenGate was assembled using Bpi1 enzyme and T4 ligase from Nanjing Fomax Biotechnology Co., Ltd., and the reaction system is shown in Table 3.

[0051] Table 3 System 10 µL BB2-AB 1 µL BB1-12-pTEF1 1 µL BB1-23-RKI1 1 µL BB1-34-ScCYC1tt 1 µL Bpil 0.5 µL BSA 1 µL T4 ligase 0.5 µL T4 buffer 1 µL distilled water 3 µL The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-AB-pTEF1-RKI1-ScCYC1tt was obtained by screening for ampicillin resistance on plates and verifying by colony PCR and sequencing.

[0052] The construction process for other recombinant plasmids is the same as described above.

[0053] 3. The construction process of recombinant plasmid pRS404-RKI1-TKL1 is as follows: The recombinant plasmid pRS404-RKI1-TKL1 was constructed by inserting plasmids BB2-AB-pTEF1-RKI1-ScCYC1tt and BB2-BC-pPGK1-TKL1-RPP1Btt into plasmid pRS404 using the GoldenGate method with Bsa1 enzyme and T4 ligase, resulting in plasmid pRS404-RKI1-TKL1. The structure of the recombinant plasmid pRS404-RKI1-TKL1 is shown below. Figure 1 .

[0054] 4. The construction process of the recombinant plasmids pRS405-ARO2 / pRS405-ARO10 / pRS405-ARO2-ARO10 is as follows: The recombinant plasmid pRS405-ARO2 / pRS405-ARO10 was obtained by inserting plasmid BB2-AB-pTEF1-ARO2-ScCYC1tt / BB2-BC-pPGK1-ARO10-RPP1Btt into plasmid pRS405 using the GoldenGate method with sa1 enzyme and T4 ligase.

[0055] The recombinant plasmid pRS405-ARO2-ARO10 was constructed by inserting plasmids BB2-AB-pTEF1-ARO2-ScCYC1tt and BB2-BC-pPGK1-ARO10-RPP1Btt into plasmid pRS405 using the GoldenGate method with Bsa1 enzyme and T4 ligase. The structure of the recombinant plasmid pRS405-ARO2-ARO10 is shown below. Figure 2 .

[0056] 5. The construction process of recombinant plasmid pRS406-RsUGT73B6 / RsUGT74R1 / AtUGT74R1 / AtUGT85A1 is as follows: The recombinant plasmid pRS406-RsUGT73B6 / RsUGT74R1 / AtUGT74R1 / AtUGT85A1 is based on the plasmid BB2-AB-pTEF1-RsUGT73B6-ScCYC1tt / BB2-AB-pTEF1-RsUGT74R1-ScCYC1tt / BB2-AB-pTEF1-AtUGT74R1-ScCYC1tt / BB2-AB-pTEF1- AtUGT85A1-ScCYC1tt was inserted into plasmid pRS405 using the GoldenGate method with Bsa1 enzyme and T4 ligase to obtain plasmid pRS406-RsUGT73B6 / RsUGT74R1 / AtUGT74R1 / AtUGT85A1, thus completing the construction of the recombinant plasmid pRS406-RsUGT73B6 / RsUGT74R1 / AtUGT74R1 / AtUGT85A1. The structure of the recombinant plasmid pRS406-RsUGT73B6 / RsUGT74R1 / AtUGT74R1 / AtUGT85A1 is shown below. Figures 3-6 .

[0057] 6. Saturation mutation at the I308 site in recombinant plasmid pRS406-AtUGT85A1 The I308 site of the recombinant plasmid pRS406-AtUGT85A1 was replaced with I308A, I308L, I308V, I308M, I308F, I308W, I308Y, I308N, I308C, I308Q, I308S, I308T, I308R, I308H, I308K, I308D, I308E, I308G, and I308P, respectively.

[0058] 7. Saturation mutation at the F403 site in recombinant plasmid pRS406-AtUGT85A1 I308T Replace the 403 site of the recombinant plasmid pRS406-AtUGT85A1 I308T with F403A, F403L, F403V, ​​F403M, F403W, F403Y, F403I, F403N, F403C, F403Q, F403S, F403T, F403R, F403H, F403K, F403D, F403E, F403G, and F403P, respectively.

[0059] Table 4 Primer List Primer name Sequence (5'— 3') RKI1-F GGTCTCCCATGGCTGCCGGT RKI1-R GGTCTCGAAGCTCACTTTTCGGTAACTTCA TKL1-F GGTCTCCCATGACTCAATTCACTGA TKL1-R GGTCTCGAAGCTTAGAAAGCTTTTTTCAAAG ARO2-F GGTCTCCCATGTCAACGTTTGGGA ARO2-R GGTCTCGAAGCTTAATGAACCACGGAT ARO10-F GGTCTCCCATGGCACCTGTTACA ARO10-R GGTCTCGAAGCCTATTTTTTATTTCTTTTA Example 2 Construction of recombinant bacteria 1. Construction of recombinant bacteria Sc-01 The plasmid pRS404-RKI1-TKL1 containing the RKI1-TKL1 gene expression cassette was introduced into Saccharomyces cerevisiae BY4742. The RKI1-TKL1 expression cassette was integrated into the TRP1 site of the genome, resulting in recombinant strain Sc-01.

[0060] The specific method is as follows: ① Competent cells were prepared by overnight culture of the original Saccharomyces cerevisiae in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0061] ② Linearized RKI1-TKL1 was introduced into competent cells of Saccharomyces cerevisiae using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0062] ③ Screening was performed using SD-TRP screening medium. Single colonies grew in 3-4 days. Positive clones identified by PCR were named recombinant bacteria Sc-01. The SD-TRP screening medium contained: glucose 20 g / L, Tris ethanesulfonic acid 2.26 g / L, ammonium sulfate 3 g / L, trace elements 1 ml / L, 100× salt solution 10 ml / L, and agar powder 25 g / L.

[0063] 2. Construction of recombinant bacteria Sc-02, Sc-03, Sc-04, Sc-05, and Sc-06 The plasmid pRS405-ARO2 / pRS405-ARO10 / pRS405-ARO2-ARO10 of the ARO2 / ARO10 / ARO2-ARO10 gene expression cassette was introduced into *Saccharomyces cerevisiae* Sc-01. The ARO2 / ARO10 / ARO2-ARO10 expression cassette was integrated into the LEU2 site of the genome, yielding recombinant strains Sc-02, Sc-03, and Sc-04. The RsUGT73B6 / RsUGT74R1 / AtUGT73C5 / AtUGT85A1 expression cassette was integrated into the URA3 site of Sc-04, yielding recombinant strains Sc-05, Sc-06, Sc-07, and Sc-08. The specific construction process was the same as that for Sc-01.

[0064] 3. Construction of the recombinant strain Sc-08 with a saturated mutant site at the I308 site A saturation mutant plasmid at the I308 site of the recombinant plasmid pRS406-AtUGT85A1 was introduced into the URA3 site of the recombinant bacterium Sc-06, resulting in the recombinant bacteria Sc-08 I308A, Sc-08 I308L, Sc-08 I308V, Sc-08 I308M, Sc-08I308F, Sc-08 I308W, Sc-08 I308Y, Sc-08 I308N, Sc-08 I308C, Sc-08 I308Q, Sc-08I308S, Sc-08 I308T, Sc-08 I308R, Sc-08 I308H, Sc-08 I308K, Sc-08 I308D, Sc-08I308E, Sc-08 I308G, and Sc-08 I308P. The specific construction process is the same as that of Sc-01.

[0065] 4. Construction of the recombinant strain Sc-08 I308T F403 site saturated mutant A saturation mutant plasmid at the F403 site of the recombinant plasmid pRS406-AtUGT85A1 I308T was introduced into the URA3 site of the recombinant bacterium Sc-06, resulting in the recombinant bacteria Sc-08 I308T F403A, Sc-08 I308T F403L, Sc-08 I308TF403V, ​​Sc-08 I308T F403M, Sc-08 I308T F403W, Sc-08 I308T F403Y, Sc-08 I308TF403I, Sc-08 I308T F403N, Sc-08 I308T F403C, Sc-08 I308T F403Q, Sc-08 I308TF403S, Sc-08 I308T F403T, Sc-08 I308T F403R, and Sc-08 I308T F403S. The following models are listed: I308T F403H, Sc-08 I308TF403K, Sc-08 I308T F403D, Sc-08 I308T F403E, Sc-08 I308T F403G, and Sc-08 I308TF403P. The specific construction process is the same as that of Sc-01.

[0066] Example 3: Application of recombinant bacteria in the production of rhodioloside The engineered bacteria were cultured using recombinant bacteria Sc-01, Sc-02, Sc-03, and Sc-04 from Example 2 to produce tyrosol, and recombinant bacteria Sc-05, Sc-06, Sc-07, and Sc-08 to produce rhodioloside.

[0067] The specific method is as follows: Take the strain from the seed preservation tube, inoculate it into the YPD test tube with a 1% inoculation amount, and culture it at 30℃ for 24 hours to obtain the seed liquid; The seed culture was inoculated at a rate of 1% into 50 mL of fermentation medium (40 g / L glucose, 10 g / L yeast extract, and 20 g / L tryptone). The culture was incubated at 25℃ and 220 rpm with shaking for 5 days, with 4 mL of 40 g / L glucose added every 24 h. After 120 h of fermentation, the tyrosol yields of recombinant strains BY4742, Sc-01, Sc-02, Sc-03, and Sc-04 were 162.93 mg / L, 328.65 mg / L, 449.22 mg / L, 443.41 mg / L, and 541.03 mg / L, respectively. Figure 7 The increased precursor supply pathway resulted in a 101.72% increase in tyrosine production compared to the original strain. The tyrosine-regulated pathways of ARO2 / ARO10 alone, or synergistically, both increased tyrosine production by 175.71%, 172.12%, and 232.06%, respectively. Subsequently, UDP-glycosyltransferases from different sources were screened in hopes of converting tyrosol into rhodioloside. The rhodioloside yields of recombinant strains Sc-05, Sc-06, Sc-07, and Sc-08 were 135.46 mg / L, 41.15 mg / L, 644.60 mg / L, and 877.73 mg / L, respectively. Figure 8 The highest rhodioloside yield was achieved by expressing AtUGT85A1 derived from Arabidopsis thaliana, and this enzyme may be able to fold successfully and stably achieve substrate transformation in Saccharomyces cerevisiae. The rhodioloside yields of recombinant strains Sc-08 I308A, Sc-08I308L, Sc-08 I308V, Sc-08 I308M, Sc-08 I308F, Sc-08 I308W, Sc-08 I308Y, Sc-08I308N, Sc-08 I308C, Sc-08 I308Q, Sc-08 I308S, Sc-08 I308T, Sc-08 I308R, Sc-08I308H, Sc-08 I308K, Sc-08 I308D, Sc-08 I308E, Sc-08 I308G, and Sc-08 I308P were 917.20 mg / L, 912.14 mg / L, 916.29 mg / L, 938.86 mg / L, and 945.45 mg / L, respectively. mg / L, 949.55mg / L, 937.65 mg / L, 891.88 mg / L, 948.88 mg / L, 964.86 mg / L, 978.62 mg / L, 1014.43 mg / L, 856.17 mg / L, 828.79 mg / L, 844.25 mg / L, 826.87 mg / L, 845.54 mg / L, 842.59 mg / L, 865.14 mg / L ( Figure 9Among them, I308T showed a 15.57% increase in yield compared to the non-mutated strain. Recombinant strains with iterative saturation mutations: Sc-08 I308T F403A, Sc-08 I308T F403L, Sc-08 I308T F403V, ​​Sc-08 I308TF403M, Sc-08 I308T F403W, Sc-08 I308T F403Y, Sc-08 I308T F403I, Sc-08 I308TF403N, Sc-08 I308T F403C, Sc-08 I308T F403Q, Sc-08 I308T F403S, Sc-08 I308TF403T, Sc-08 I308T F403R, Sc-08 I308T F403H, Sc-08 I308T F403K, Sc-08 The rhodioloside yields of I308TF403D, Sc-08 I308T F403E, Sc-08 I308T F403G, and Sc-08 I308T F403P were 1243.17 mg / L, 1005.65 mg / L, 1093.03 mg / L, 1040.50 mg / L, 986.39 mg / L, 1031.77 mg / L, 1058.24 mg / L, 1058.53 mg / L, 936.86 mg / L, 948.13 mg / L, 1047.80 mg / L, 1050.10 mg / L, 995.77 mg / L, 1018.22 mg / L, 1015.85 mg / L, 989.59 mg / L, and 1002.91 mg / L, respectively. mg / L, 1026.43 mg / L, 1001.21 mg / L ( Figure 10 Compared with the non-mutant strain, the rhodioloside yield of Sc-08 I308T F403A increased by 41.63%, indicating that enzyme modification of key enzymes in the synthetic pathway is an effective way to increase the yield of the target product.

[0068] Example 4: High-density fermentation production of rhodioloside by recombinant strain Sc-06 I308T F403A ① Seed culture: a. Primary seed culture: Take 1% of the recombinant strain Sc-08 I308T F403A bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose. b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.

[0069] ② Batch feeding fermentation The seed culture obtained from seed culture was inoculated into a 5 L fermenter containing fermentation medium (40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract). Recombinant strain Sc-08 I308T F403A underwent fed-batch fermentation in the 5 L fermenter at 30℃, 500 rpm, and dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was added continuously to maintain the glucose concentration below 5 g / L. Samples were taken every 12 h to determine the yields of tyrosol and rhodioloside. After 7 days of fermentation, the cell OD... 600 The concentration reached 101.45, while 4.03 g / L of tyrosol and 41.07 g / L of rhodioloside were obtained. Figure 11 ).

[0070] This invention increases tyrosol production by expressing key enzymes in the tyrosine precursor supply pathway and regulating branched metabolic pathways in *Saccharomyces cerevisiae*. Subsequently, by screening UDP-glycosyltransferases from different sources and performing site-directed mutagenesis targeting their key enzyme active sites, tyrosol is converted to rhodioloside. Finally, continuous fed-batch fermentation is conducted in a 5 L fermenter to evaluate the production capacity of the strain. The OD500 of the recombinant strain in the fermenter is measured. 600 The detection of rhodioloside production is expected to further increase the yield of rhodioloside in larger fermenters, laying the foundation for subsequent industrialization.

Claims

1. A recombinant Saccharomyces cerevisiae strain producing salidroside, characterized in that, The recombinant Saccharomyces cerevisiae strain is obtained by expressing ribulose-5-phosphate isomerase RKI1, transketolase TKL1, reverse methyltransferase ARO2, phenylalanine decarboxylase ARO10 and UDP-glycosyltransferase in a host strain, and the UDP-glycosyltransferase is one of UDP-glycosyltransferases derived from Rhodiola sachalinsk or Arabidopsis thaliana.

2. The recombinant Saccharomyces cerevisiae strain for producing rhodiolin according to claim 1, characterized in that, The nucleotide sequences of the ribulose-5-phosphate isomerase RKI1, transketolase TKL1, reverse methyltransferase ARO2 and phenylalanine decarboxylase ARO10 are shown in SEQ ID NOs: 1-4, respectively.

3. The recombinant Saccharomyces cerevisiae strain for producing rhodiolin according to claim 1, characterized in that, The UDP-glycosyltransferase derived from Rhodiola sachalinsk is RsUGT73B6 or RsUGT74R1, and the UDP-glycosyltransferase derived from Arabidopsis thaliana is AtUGT73C5 or AtUGT85A1.

4. The recombinant Saccharomyces cerevisiae strain for producing rhodiolin according to claim 3, characterized in that, The nucleotide sequences of the UDP-glycosyltransferases derived from Rhodiola sachalinsk, RsUGT73B6 and RsUGT74R1, and the UDP-glycosyltransferases derived from Arabidopsis thaliana, AtUGT73C5 and AtUGT85A1, are shown in SEQ ID NOs: 5-8, respectively.

5. The recombinant Saccharomyces cerevisiae strain for producing rhodiolin according to claim 1, characterized in that, The UDP-glycosyltransferase is AtUGT85A1 derived from Arabidopsis thaliana and a mutant thereof, and the mutant is at least one mutation in the 308th and 403rd sites of the amino acid sequence of AtUGT85A1.

6. A UDP-glycosyltransferase AtUGT85A1 mutant, characterized in that, The mutant is obtained by at least one mutation in the 308th and 403rd sites of the amino acid sequence shown in SEQ ID NO:

9.

7. The UDP-glycosyltransferase AtUGT85Al mutant of claim 6, wherein, The mutant is obtained by mutating the 308th amino acid in the sequence shown in SEQ ID NO: 9 from isoleucine to threonine and mutating the 403rd amino acid from phenylalanine to alanine.

8. The method for constructing a recombinant Saccharomyces cerevisiae strain producing rhodioside according to any one of claims 1 to 5, characterized in that, The recombinant plasmid of RKI1 and TKL1 is constructed by using pRS404 as a vector, and the recombinant plasmid is integrated into the TRP1 site of the Saccharomyces cerevisiae BY4742 genome to obtain the Saccharomyces cerevisiae Sc-01 with increased precursor supply; The recombinant plasmid of ARO2 and ARO10 is constructed by using pRS405 as a vector, and the recombinant plasmid is integrated into the LEU2 site of the Saccharomyces cerevisiae Sc-01 genome to obtain the Saccharomyces cerevisiae Sc-02 with regulated tyrosine branch pathway; The recombinant plasmid containing the gene encoding the UDP-glycosyltransferase is constructed by using pRS406 as a vector, and the recombinant plasmid is integrated into the URA3 site of the Saccharomyces cerevisiae Sc-02 genome to obtain the Saccharomyces cerevisiae for producing salidroside.

9. The recombinant Saccharomyces cerevisiae strain of any one of claims 1-5 for use in the production of salidroside.

10. Use according to claim 9, characterized in that, The recombinant Saccharomyces cerevisiae strain is cultured on a nutrient medium to obtain a fermentation product, and salidroside is separated and obtained.

Images