Genetically engineered bacterium for producing heparinogen as well as construction method and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for producing heparinogen and a construction method and application thereof, the genetically engineered bacterium takes Escherichia coli Nissle 1917 as a chassis bacterium, and the construction method comprises the following steps: (1) knocking out endonuclease I coding gene endA in a chassis bacterium genome; (2) knocking out a 6-phosphofructokinase I coding gene pfkA in a chassis bacterium genome; (3) carrying out overexpression on a 6-phosphoglucosamine synthetase encoding gene glmS and / or a UDP-glucose-6-dehydrogenase encoding gene kfiD from a chassis bacterium genome; (4) removing the feedback inhibition of the 6-phosphate glucosamine on the GlmS so as to promote the synthesis of UDP-N-acetylglucosamine; and (5) knocking out the 6-phosphate glucosamine deaminase coding gene nagB in the chassis bacterium genome. The engineering strain obtained by the invention can more efficiently synthesize the proheparin, the shake flask titer reaches 397.9 mg / L, which is increased by about 3 times compared with a wild strain, and the engineering strain has certain industrial application value.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to a genetically engineered bacterium for producing heparin, its construction method, and its application. Background Technology

[0002] Proheparosan, an unsulfated member of the glycosaminoglycan family, is a capsular polysaccharide composed of repeating N-acetylglucosamine (GlcNAc) and glucuronic acid (GlcA) disaccharide units, and is a precursor for heparin synthesis. Proheparosan can be naturally synthesized by specific pathogens (Escherichia coli K5, Pasteurella multocida D, and Avianella paragallinarum genotype II). The yield and chain length distribution of proheparosan produced by fermentation in different bacterial systems vary. However, pathogen fermentation is unsuitable for the production of pharmaceutical heparin for clinical applications, while the probiotic Escherichia coli Nissle 1917 (EcN) is non-pathogenic and offers greater biosafety.

[0003] Currently, commercial heparin production relies primarily on unsustainable animal tissues. However, contamination, adulteration, inadequate quality control, and the inherent heterogeneity of animal-derived heparin have drawn global attention. With the rapid development of synthetic biology, constructing efficient microbial cell factories for proheparin biosynthesis has become an important direction for sustainable development. Summary of the Invention

[0004] To address the aforementioned issues, this invention constructs a genetically engineered bacterium capable of efficiently producing heparin by weakening the flux of the central carbon metabolism pathway, strengthening and balancing the synthetic pull of the dual pathways of UDP-glucuronic acid and UDP-N-acetylglucosamine, relieving feedback inhibition of key enzymes in the synthetic pathway, and knocking out competing pathways.

[0005] To achieve the above and other related objectives, the technical solution adopted by the present invention is as follows: This invention provides a genetically engineered bacterium for producing heparin, constructed using *Escherichia coli* Nissle 1917 as the substrate bacterium, and its construction method includes at least one of the following steps: (1) Knockout of the gene encoding endonuclease I in the genome of *Bacillus subtilis* endA ; (2) Knockout of the gene encoding 6-phosphofructokinase I in the genome of *Bacillus subtilis* pfkA ; (3) Overexpression of the gene encoding 6-phosphate glucosamine synthase from the genome of Chameleonella spp. glmS and / or UDP-glucose-6-dehydrogenase encoding gene kfiD ; (4) To relieve the feedback inhibition of 6-phosphate glucosamine on GlmS, so as to promote the further synthesis of UDP-N-acetylglucosamine; (5) Knock out the gene encoding glucosamine 6-phosphate deaminase in the genome of the basal bacteria. nagB .

[0006] Preferably, the substrate bacteria is wild-type Escherichia coli Nissle 1917.

[0007] Preferably, the endonuclease I encoding gene endA The nucleotide sequence is shown in SEQ ID NO.1.

[0008] Preferably, the gene encoding 6-phosphofructokinase I is... pfkA The nucleotide sequence is shown in SEQ ID NO.2.

[0009] Preferably, the gene encoding the 6-phosphate glucose synthase is... glmS and the UDP-glucose-6-dehydrogenase encoding gene kfiD Both are controlled by the Trc promoter.

[0010] Preferably, the nucleotide sequence of the Trc promoter is shown in SEQ ID NO.3.

[0011] Preferably, the gene encoding the 6-phosphate glucose synthase is... glmS The nucleotide sequence is shown in SEQ ID NO.4.

[0012] Preferably, the UDP-glucose-6-dehydrogenase encoding gene kfiD The nucleotide sequence is shown in SEQ ID NO. 5.

[0013] Preferably, the method for relieving the feedback inhibition of GlmS products in step (4) includes performing the following combination mutations (1) to (4) on the amino acid sequence of 6-phosphate glucosamine synthase: (1) The glutamic acid at position 14 is mutated to lysine; (2) The aspartic acid at position 386 is mutated to valine; (3) Serine at position 449 is mutated to proline; (4) Glutamic acid at position 524 is mutated to serine.

[0014] Preferably, the gene encoding glucosamine 6-phosphate deaminase... nagB The nucleotide sequence is shown in SEQ ID NO.7.

[0015] The present invention also provides a 6-phosphate glucosamine synthase mutant, which is obtained by combining mutations at positions 14, 386, 449 and 524 of the amino acid sequence of 6-phosphate glucosamine synthase.

[0016] Preferably, the mutant is a combination mutation of the amino acid sequence of 6-phosphate glucosamine synthase as follows (1) to (4): (1) The glutamic acid at position 14 is mutated to lysine; (2) The aspartic acid at position 386 is mutated to valine; (3) Serine at position 449 is mutated to proline; (4) Glutamic acid at position 524 is mutated to serine.

[0017] This invention also provides a gene encoding a mutant of glucosamine 6-phosphate synthase. glmS * Its nucleotide sequence is shown in SEQ ID NO.6.

[0018] The present invention also provides a gene containing the 6-phosphate glucose synthase mutant encoding gene. glmS * Recombinant plasmid.

[0019] The present invention also provides a method for constructing a genetically engineered bacterium for producing heparin, comprising at least one of the following steps: (a) Using Escherichia coli Nissle 1917 as the substrate bacteria, the gene encoding endonuclease I in the substrate bacteria genome was knocked out using Red homologous recombination technology. endA ; (b) Knocking out the gene encoding 6-phosphofructokinase I in the genome of *Bacillus subtilis* and / or the genome of the engineered bacteria obtained in step (a) using CRISPR-Cas9-mediated gene editing technology. pfkA ; (c) Using a plasmid expression system, overexpress the 6-phosphate glucosamine synthase encoding gene derived from the genome of *Bacillus subtilis* in the engineered bacteria obtained in step (b). glmS and / or UDP-glucose-6-dehydrogenase encoding gene kfiD ; (d) Constructing the recombinant plasmid pETDuet- glmS *- kfiD The recombinant plasmid pETDuet- glmS *- kfiD Import the engineered bacteria obtained in step (b); (e) Knockout of the 6-phosphate glucosamine deaminase encoding gene in the engineered bacteria obtained in step (b) using CRISPR-Cas9-mediated gene editing technology. nagB ; (f) The recombinant plasmid pETDuet- glmS *- kfiD Import the engineered bacteria obtained in step (e).

[0020] Specifically, the present invention also provides a method for constructing a genetically engineered bacterium for producing heparin, comprising at least one of the following steps: (1) Using Escherichia coli Nissle 1917 (EcN) as the chassis bacteria, the Red homologous recombination technology was used to knock out the genome of the chassis bacteria. endA Genes were extracted to obtain engineered bacteria HP1; (2) Using engineered strain HP1 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene in the starting strain genome. pfkA Genes were used to obtain engineered bacteria HP2; (3) Using engineered bacteria HP2 as the starting strain, glmS The gene was constructed into the pETDuet-1 plasmid and controlled by the Trc promoter. The resulting recombinant plasmid pETDuet- glmS Transformed into the starting strain HP2, resulting in engineered strain HP3; (4) Using engineered bacteria HP2 as the starting strain, kfiD The gene was constructed into the pETDuet-1 plasmid and controlled by the Trc promoter. The resulting recombinant plasmid pETDuet- kfiD Transform the starting strain HP2 into the culture to obtain the engineered strain HP4; (5) Using engineered bacteria HP2 as the starting strain, glmS , kfiD The gene was constructed into the pETDuet-1 plasmid and controlled by the Trc promoter. The resulting recombinant plasmid pETDuet- glmS - kfiD Transform the starting strain HP2 into the culture to obtain the engineered strain HP5; (6) Using engineered bacteria HP2 as the starting strain, glmS *The gene was constructed into the pETDuet-1 plasmid and controlled by the Trc promoter. The resulting recombinant plasmid pETDuet- glmS *- kfiD Transfer to HP2 to obtain engineered bacteria HP6; (7) Using engineered strain HP2 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene in the starting strain genome. nagB Genes were used to obtain engineered bacteria HP7; (8) Using engineered bacteria HP7 as the starting strain, the recombinant plasmid pETDuet- glmS *- kfiDTransfect the starting strain HP7 to obtain the engineered strain HP8.

[0021] Specifically, the aforementioned endA The nucleotide sequence of the gene is shown in SEQ ID NO.1; pfkA The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the nucleotide sequence of the Trc promoter is shown in SEQ ID NO.3. The gene regulated by the Trc promoter... glmS The nucleotide sequence of the gene is shown in SEQ ID NO.4; the gene is regulated by the Trc promoter. kfiD The nucleotide sequence of the gene is shown in SEQ ID NO. 5; glmS The nucleotide sequence of the gene is shown in SEQ ID NO. 6. nagB The nucleotide sequence of the gene is shown in SEQ ID NO.7.

[0022] The present invention also provides an application of the genetically engineered bacteria in the preparation of proheparin through microbial fermentation.

[0023] Preferably, the application involves inoculating the genetically engineered bacteria that produce the proheparin into a shake flask for fermentation culture at 30–37°C and 200–250 rpm for 20–30 h. After fermentation, the supernatant of the fermentation broth is collected and purified to obtain the proheparin.

[0024] Preferably, the fermentation medium consists of the following components: 6.8 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 1 g / L ammonium chloride, and 0.5 g / L sodium chloride. The seed culture is inoculated into a 500 mL shake flask (50 mL volume) at a 4% inoculation rate for fermentation. Before inoculation, 1 mL of 40% glucose, 1 mL of 20% caseinate, 50 μL of 2 M magnesium sulfate, and 50 μL of 0.1 M calcium chloride are added. Additionally, 50 μL of 1 M β-D-thiogalactoside (IPTG) is added. Fermentation is carried out at 30–37°C and 200–250 rpm for 20–30 h. The fermentation broth is centrifuged, and the supernatant is purified by filtration through a 0.22 μm aqueous filter membrane to obtain proheparin.

[0025] This invention utilizes Red homologous recombination technology to knock out EcN in the genome. endA To improve gene editing efficiency, CRISPR / Cas9 gene editing technology is used to knock out genes. pfkA , nagB Genes are used to reduce metabolic flux in central carbon metabolism pathways and competing pathways; subsequently, key genes in the pathway are overexpressed and balanced. glmS , kfiDBy enhancing the biosynthesis of heparin precursors N-acetylglucosamine (GlcNAc) and glucuronic acid, and by using the GlmS mutant to relieve the negative feedback inhibition of glucosamine 6-phosphate on itself, a genetically engineered strain HP8 that produces heparin efficiently was finally obtained.

[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: (1) The genetically engineered strain of the present invention knocks out the genome endA This technology improves the gene editing efficiency of the CRISPR / Cas9 system in EcN. (2) The genetically engineered strain of the present invention knocks out the genome pfkA , nagB Genes that weaken the metabolic flux of central carbon metabolic pathways and competing pathways; (3) The genetically engineered strains of the present invention are optimized by screening key genes in the proheparin synthesis pathway and combining them. glmS , kfiD The expression intensity of heparin precursors is increased to enhance their biosynthesis. (4) The genetically engineered strain of the present invention further relieves the negative feedback inhibition of the product glucosamine 6-phosphate on itself by introducing the GlmS mutant; (5) The genetically engineered strain of the present invention can produce heparin more efficiently after metabolic engineering modification. The shake flask potency is increased from 132.6 mg / L to 397.9 mg / L compared with wild-type EcN, which has certain industrial application value. Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the proheparin biosynthesis pathway. Figure 2 OD for EcN and HP1 600 and bar chart showing changes in proheparin titer; Figure 3 OD for HP1, HP1-1 and HP2 600 and bar chart showing changes in proheparin titer; Figure 4 OD for HP2, HP2-1, HP2-2 and HP3 600 and bar chart showing changes in proheparin titer; Figure 5 OD for HP2, HP2-3, HP2-4 and HP4 600 and bar chart showing changes in proheparin titer; Figure 6 OD for HP4, HP4-1 and HP5 600 and bar chart showing changes in proheparin titer; Figure 7OD for HP5 and HP6 600 and bar chart showing changes in proheparin titer; Figure 8 OD for HP2 and HP7 600 and bar chart showing changes in proheparin titer; Figure 9 OD for HP6 and HP8 600 And bar chart showing changes in proheparin titer. Detailed Implementation

[0028] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0029] Unless otherwise specified, all methods used in the embodiments of this invention are conventional methods, and all reagents used are commercially available. All process equipment or apparatus not specifically mentioned in the embodiments of this invention are conventional equipment or apparatus in the art. The invention will be further described below with reference to specific embodiments, but the scope of protection of this invention is not limited thereto: In the following embodiments: LB liquid medium: 10 g / L peptone, 5 g / L yeast extract and 5 g / L sodium chloride.

[0030] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride and 20 g / L agar.

[0031] SOB medium: peptone 20 g / L, yeast extract 5 g / L, sodium chloride 0.5 g / L, potassium chloride 2.5 mM, magnesium chloride 10 mM.

[0032] M9C fermentation medium: 6.8 g / L disodium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 1 g / L ammonium chloride, 0.5 g / L sodium chloride, 1 mL 40% glucose, 1 mL 20% caseinate amino acids, 50 μL 2 M magnesium sulfate, and 50 μL 0.1 M calcium chloride.

[0033] In the following examples, the working concentration of ampicillin (Amp) in the culture medium is 100 μg / mL; the working concentration of kanamycin sulfate (Kan) in the culture medium is 50 μg / mL; the working concentration of spectinomycin (SD) in the culture medium is 50 μg / mL; and the working concentration of IPTG in the culture medium is 1 mM.

[0034] The primers used in plasmid construction in the following examples are shown in Table 1. *Escherichia coli* Nissle 1917 was purchased from Hangzhou Baosai Biotechnology Co., Ltd., product number T0023; plasmids pKD4, pKD46, and pCP20 were purchased from Youbao Biotechnology Co., Ltd., product numbers VT1690, VT1692, and VT1693; plasmid pTarget was donated by researcher Yang Sheng (Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences) (DOI: 10.1128 / aem.01181-16); plasmids pEcCas and pETDuet-1 were purchased from Shanghai Haijihaoge Biotechnology Co., Ltd., product numbers HH-YGE-026 and HH-Y-055.

[0035] Table 1 Primer names and sequences Primer name Sequence (5'-3') FRT-F TGTAGGCTGGAGCTGCTTC FRT-R CATATGAATATCCTCCTTAG ∆-F CCAAAACAACTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGTGTAGGCTGGAGCTGCTTC ∆-R GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGCATATGAATATCCTCCTTAG PTL-F CTGCAGAAGCTTAGATCTATTACCC PTL-R TCTAGAGAATTCAAAAAAAGCACCG PTM-Δ-F TAATACTAGTCCTGGTAAACGAAATCAAAGGTTTTAGAGCTAGAAATAGC PTM-Δ-R GCTCTAAAACCTTTGATTTCGTTTACCAGGACTAGTATTATACCTAGGAC Δ-Up-F CTTTTTTTGAATTCTCTAGATTTGCATGGTGGTATACCG Δ-Up-R GACTACCTCTGAACTTTGGA Δ-Down-F TCCAAAGTTCAGAGGTAGTCTGATTTCGGAAAAAGGCAGA Δ-Down-R ATAGATCTAAGCTTCTGCAGTCTGCGAGGATAGACTCAC PTM-Δ-F TAATACTAGTTAGTGAAAACTGCATTCAGGGTTTTAGAGCTAGAAATAGC PTM-Δ-R GCTCTAAAACCCTGAATGCAGTTTTCACTAACTAGTATTATACCTAGGAC Δ-Up-F CTTTTTTTGAATTCTCTAGAGGTTCAGAGTTCCATGTAAC Δ-Up-R CATTTCCTCCTATAGGCTG Δ-Down-F CAGCCTATAGGAGGAAATGCAAAAACATTCCCCCAGC Δ-Down-R ATAGATCTAAGCTTCTGCAGCAGCCAATCCGTTGTTCAG pETL-F AAGCTTGCGGCCGCATAATG pETL-R GAATTCCATGGTCTGTTTCCTG -pET-F GGAAACAGACCATGGAATTCATGTGTGGAATTGTTGGCG -pET-R CATTATGCGGCCGCAAGCTTTTACTCAACCGTTACCGATT -pET-F GGAAACAGACCATGGAATTCATGAGTAATCGTAAATATTTCG -pET-R CATTATGCGGCCGCAAGCTTTTAAACGGCTTTTACTGCATC -pET-F GGAAACAGACCATGGAATTCATGTTGAATAATGCTATGAGC -pET-R CATTATGCGGCCGCAAGCTTTTACTTTTTCTTTATCGGACG -pET-F GGAAACAGACCATGGAATTCATGTTCGGAACTAAAAATAAC -pET-R CATTATGCGGCCGCAAGCTTTTAGTCACATTTAAACAAATCG -pET-F GGAAACAGACCATGGAATTCATGGCAATCCACAATCGTG -pET-R CATTATGCGGCCGCAAGCTTTTACGCGTTTTTCAGAACTTC -pET-F GGAAACAGACCATGGAATTCATGGCTGCCATTAATACGAA -pET-R CATTATGCGGCCGCAAGCTTTTACTCTCTTAATGCCATCTTC --F AATCGGTAACGGTTGAGTAATTTCACAGGAAACAGACCATGTCCGGAACACTAAAATAAC -R TTACTCAACCGTTACCGATT --F ATTTGTTTAAATGTGACTAATTTCACAGGAAACAGACCATGTGTGGAATTGTTGGCG -R TTAGTCACATTTAAACAAATCG *-1-F TCGCGCAACGTGATGTAGCAAAAATCCTTCTTGAAGGTTTAC *-1-R GGATTCGCGCACCAGAGA *-2-F TCTCTGGTGCGCGAATCCGTGCTGGCGCTGATGACCAAC *-2-R CAGCATCTGCTCAATACG *-3-F CGTATTGAGCAGATGCTGCCGCAGGACAAACGCATTGAAG *-3-R GATTTCAGTTTTTCCAGCAAGCCGTTGTTCGGTGCAACGACG pETL-*-F TTGCTGGAAAAAACTGAAATCC pETL-*-R TGCTACATCACGTTGCCG PTM-Δ-F TAATACTAGTGTTCACGCAACCTTCAACGGGTTTTAGAGCTAGAAATAGC PTM-Δ-R GCTCTAAAACCCGTTGAAGGTTGCGTGAACACTAGTATTATACCTAGGAC Δ-Up-F CTTTTTTTGAATTCTCTAGATAAGGATGAACCGCTTAACG Δ-Up-R TTGTTATCCCTGCCCTGGC Δ-Down-F GCCAGGGCAGGGATAACAATATTCACCTCAATAAGTAAAATG Δ-Down-R ATAGATCTAAGCTTCTGCAGGCATAGAAGCGGTTGATATC

[0036] After fermentation is complete, take 1 mL of the shake flask fermentation broth, centrifuge at 12000 rpm for 1 min, separate the supernatant, take 250 μL of the supernatant and 250 μL of D-glucuronic acid standard solution, add 1 mL of borax-sulfuric acid solution (weigh 5 g sodium tetraborate and dilute to 500 mL with concentrated sulfuric acid), mix thoroughly, and let stand at 25℃ for 20 min for hydrolysis. Then add 37.5 μL of carbazole-ethanol solution (weigh 1 g carbazole and dilute to 500 mL with anhydrous ethanol), mix thoroughly, heat in a 100℃ water bath for 10 min, and cool to room temperature. Use deionized water as a blank control and measure the absorbance at 522 nm wavelength to establish a D-glucuronic acid standard curve. Calculate the proheparin content based on the standard curve.

[0037] (1) Construction of knockout fragments: Using pKD4 plasmid as a template, the fragment was amplified by PCR using FRT-F and FRT-R primers to obtain the fragment FRT-Kan-FRT, which provides kanamycin (Kan) resistance and the reverse enzyme recognition site FRT. Subsequently, primers ∆ end -F and ∆ end -R, using the fragment FRT-Kan-FRT as a template, amplifies the upper and lower homologous arms, with a homologous arm length of 50 bp, resulting in... end The knockout fragment Up-FRT-Kan-FRT-Down was obtained by purifying the knockout fragment using a PCR Cleanup kit (Beijing Qingke Biotechnology Co., Ltd.) and stored at -20℃.

[0038] (2) Preparation of EcN-transformed competent cells and construction of strain EcN / pKD46: The strain EcN was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar and cultured overnight at 37°C. 1 mL of seed culture was then transferred to 100 mL of LB agar and cultured at 37°C until the bacterial concentration (OD500) reached the target concentration. 600 The concentration of the bacterial culture was approximately 0.5. The bacterial culture was placed on ice for 10 min, centrifuged at 5500 rpm for 6 min to collect the bacterial cells, and the supernatant was discarded. 50 mL of pre-cooled and sterilized 0.1 M CaCl2 solution was added, mixed thoroughly, and incubated on ice for 30 min. The culture was then centrifuged at 6000 rpm for 6 min to collect the bacterial cells, and the supernatant was discarded. Based on the bacterial volume, 500 μL–1 mL of pre-cooled and sterilized 0.1 M CaCl2 solution containing 15% glycerol was added to resuspend the bacterial cells. The cells were then aliquoted and stored at -80°C.

[0039] Take 100 μL of the above competent cells, thaw them completely, add about 300 ng of pKD46 plasmid, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 90 s, immediately place on ice for 5 min, add 800 μL of pre-cooled and sterilized LB liquid medium, incubate at 30℃ and 180 rpm on a shaker for 30 min, centrifuge at 5500 rpm for 2 min, aspirate the excess supernatant, resuspend the cells and spread them on solid medium containing Amp resistance, incubate overnight at 30℃, and verify by colony PCR whether the pKD46 plasmid was successfully introduced into strain EcN.

[0040] (3) Preparation of electrocompetent cells of strain EcN / pKD46 and construction of strain HP1: Strain EcN / pKD46 was activated by streaking on LB solid medium and cultured at 30°C for 12 h. Single colonies were picked and inoculated into SOB medium, with 1% 1 M L-arabinose (L-Ara) and 1‰ Amp resistance added. The culture was incubated overnight at 30°C. 1 mL of the inoculum was then transferred to 50 mL of SOB medium, with 1% L-Ara and 1‰ Amp resistance added. The culture was then allowed to grow to OD... 600 Collect the bacterial cells at approximately 0.6, resuspend them in 40 mL of sterile water, centrifuge at 6000 rpm for 6 min, discard the supernatant, repeat the above steps once, resuspend the bacterial cells in 40 mL of 10% glycerol, centrifuge at 5500 rpm for 6 min, discard the supernatant, add 1 mL of 10% glycerol to resuspend the bacterial cells and aliquot, and freeze at -80℃.

[0041] Take 100 μL of the above competent cells, wait until they are completely thawed, and add approximately 500 ng. endAfter knocking out the fragment, let it stand on ice for 5 minutes, gently mix it by pipetting, and then transfer it to a dried electrode cup with a diameter of 0.2 cm. Shake to remove internal air bubbles and wipe off external moisture. Set the electroporator to level 2 to electrolyze the electrode cup, and immediately add 800 μL of pre-cooled and sterilized SOB medium. Incubate at 30°C on a shaker for 4 hours. Then collect the bacterial cells and spread them on LB solid medium containing Kan resistance. Incubate overnight at 37°C. After single bacteria have grown, verify whether the editing was successful by colony PCR and sequencing.

[0042] (4) Elimination of HP1 plasmid: The successfully edited strain HP1 was prepared into a chemically competent state. The preparation steps were as described in Example 2 (2). 100 μL of HP1 competent cells were taken and thawed completely. About 500 ng of pCP20 plasmid was added to eliminate the Kan selection resistance in the genome. The cells were cultured overnight at 30°C. Colony PCR and sequencing were used to verify whether the Kan resistance was successfully eliminated. The single colony that was successfully eliminated was then inoculated into LB liquid medium and cultured overnight at 37°C to eliminate the temperature-sensitive plasmid pCP20. The colony was then streaked onto a solid medium without resistance. Once a single colony grew, it was spotted onto a solid medium containing Amp resistance to verify whether the pCP20 plasmid was successfully eliminated. Thus, the anti-resistant engineered strain HP1 without plasmid was obtained.

[0043] (5) Shake-flask fermentation of strain HP1 Strawberry strain HP1 was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, cultured at 37°C for 10 h, and then 2 mL of seed culture was transferred to 50 mL of fermentation medium. Wild-type EcN was used as a control. After fermentation, the fermentation broth was centrifuged, and the supernatant was collected. The proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 2 As shown.

[0044] Depend on Figure 2 It is evident that knocking out EcN in the genome end The heparin proton potency decreased from 133.6 mg / L to 129.4 mg / L, without significantly affecting proheparin biosynthesis, according to literature reports. end The gene encodes endonuclease I. Knocking out this gene is more conducive to the stability of the introduced foreign gene, so the HP1 strain was selected for further research.

[0045] (1) Knockout plasmid pTarget-Δ pfkA Construction: The 20 bp preceding the PAM site located within the gene coding sequence near the start codon was selected as the sgRNA, and primer PTM-Δ was designed. pfkA -F / PTM-Δ pfkA -R used the original pTarget plasmid as a template for PCR amplification. The original plasmid template was eliminated by adding the restriction endonuclease Dpn I to the amplified PCR product, followed by digestion at 37°C for 1 h, and then inactivation at 80°C for 5 min. Subsequently, the digested product was linearized by PCR amplification using primers PTL-F / PTL-R. Simultaneously, Δ... pfkA -Up-F / Δ pfkA -Up-R and Δ pfkA -Down-F / Δ pfkA Using the EcN genome as a template, the Down-R primer pair amplified the upper homologous fragment Up and the lower homologous fragment Down, respectively. Then, using Δ... pfkA -Up-F / Δ pfkA Using Down-R as primers, homologous fragments Up and Down were used as templates for fusion PCR to obtain the DNA fragment Donor (Up+Down). The DNA fragment Donor and linearized pTarget were purified using a PCRCleanup kit, and the concentration and purity of the DNA fragment were determined using Nano Drop. Finally, Donor and linearized pTarget were ligated into a circular plasmid using the ClonExpress One Step Cloning Kit. Ligation was performed at 50°C for 1 h, followed by incubation at 4°C on ice. The reaction product was then transformed into DH5α competent cells. Once a single colony grew, the plasmid construction was verified, and the plasmid was extracted. The pTarget-Δ plasmid was then knocked out. pfkB The construction references pTarget-Δ pfkA The construction method.

[0046] (2) Preparation of HP1-transformed competent cells and construction of strain HP1 / pEcCas: Chemically competent cells of the starting strain HP1 were prepared according to the preparation method in Example 2 (2). The pEcCas plasmid was introduced into HP1 competent cells, and the strain HP1 / pEcCas was obtained by colony PCR and sequencing verification.

[0047] (3) Preparation of electrocompetent strains HP1 / pEcCas and construction of strain HP2 The strain HP1 / pEcCas was activated by streaking on LB solid medium containing Kan resistance and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB medium, with 1% L-Ara and 1‰ Kan added. The mixture was then incubated overnight at 37°C. Subsequently, 1 mL was transferred to a 50 mL LB shake flask, with 1% L-Ara and 1‰ Kan added, and cultured until OD was reached. 600To approximately 0.6. Place the shake flask on ice for 10 min, centrifuge at 5500 rpm for 6 min to collect the bacterial cells, discard the supernatant, add 50 mL of pre-chilled sterile deionized water, resuspend thoroughly, centrifuge at 6000 rpm for 6 min to collect the bacterial cells, add deionized water again to wash, centrifuge at 6000 rpm for 6 min to collect the bacterial cells, and add 500 μL-1 mL of pre-chilled sterile deionized water containing 10% glycerol according to the bacterial cell volume, resuspend the bacterial cells and aliquot, and store at -80℃.

[0048] The above HP1 / pEcCas electrocompetents were placed on ice and allowed to thaw naturally. Then, 500 ng of pTarget-Δ was added. pfkA After gently mixing the plasmid by pipetting, transfer it to a dried electrode cup with a diameter of 0.2 cm. Shake to remove internal air bubbles and wipe off external moisture. Set the electroporator to level 2 to electrolyze the electrode cup, and immediately add 800 μL of pre-cooled and sterilized LB liquid medium. Incubate at 37°C on a shaker for 4 h. Then collect the bacterial cells and spread them on LB solid medium containing Kan and SD resistance. Incubate overnight at 37°C. After single bacteria have grown, verify the editing success by colony PCR and sequencing.

[0049] (4) Elimination of HP2 plasmid in strain: To reduce the metabolic stress on the bacteria, plasmids need to be eliminated after successful gene editing. Single colonies of the corresponding strain are picked and inoculated onto LB agar, with 1% (1 M) L-rhamnose (L-Rha) and Kan resistance added. The cultures are incubated at 37°C with shaking for 12 h, then streaked onto Kan-only solid medium and incubated overnight at 37°C. Once single colonies grow, they are spotted onto LB agar containing SD resistance to verify successful pTarget elimination. Alternatively, single colonies with successfully eliminated pTarget are picked and inoculated onto LB agar, incubated at 37°C with shaking for 12 h, then streaked onto antibiotic-free solid medium containing glucose and sucrose and incubated at 37°C. Once single colonies grow, they are spotted onto plates containing Kan resistance to verify successful pEcCas elimination. Strain HP1-1 (HP1 / Δ pfkB The construction of strain HP2 was carried out using the same method as that used for strain HP2.

[0050] (5) Shake-flask fermentation of strain HP2 Strawberries HP1-1 and HP2 were activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP1 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 3 As shown.

[0051] Depend on Figure 3 It is evident that the cell growth of strains HP1-1 and HP2 was inhibited to some extent compared to the control strain HP1. Specifically, the proheparin titer of strain HP1-1 decreased from 132.5 mg / L to 120.8 mg / L, while that of strain HP2 increased to 205.8 mg / L, an increase of approximately 55.3%. This indicates that Δ pfkA This facilitates the reshaping of central carbon metabolism flux, allocating more carbon flux to the synthesis of proheparin, while Δ pfkB The decrease in potency may be due to metabolic imbalance within the bacteria.

[0052] (1) Overexpression plasmid pETduet- glmS Construction Using the EcN genome as a template, glmS -pET-F and glmS -pET-R is the primer PCR amplification fragment, yielding a fragment with 20 bp homology upstream and downstream of the pETduet-1 plasmid. glmS Gene fragments were linearized at the multiple cloning site using universal primers pETL-F and pETL-R, with pETduet-1 plasmid as a template. The ClonExpress One Step Cloning Kit was then used to... glmS The gene fragment was ligated and circularized with linearized pETduet-1 at 50°C for 30 min. The ligation product was then introduced into DH5α competent cells, incubated on ice for 30 min, heat-shocked for 90 s, and finally plated on plates containing Amp-resistant plasmids. Single colonies were observed to confirm the overexpression plasmid pETduet-1. glmS Overexpression plasmid pETduet- glmM pETduet- glmU The construction references pETduet- glmS Construction method.

[0053] (2) Preparation of HP2 strain competent cells and construction of HP3 strain The chemically competent cells of the starting strain HP2 were prepared according to the method described in Example 2 (2), by overexpressing the plasmid pETduet- glmS The cells were transformed into competent HP2 cells, and after single colonies grew, strain HP3 was obtained by colony PCR and sequencing verification. Strain HP2-1 (HP2 / pETduet- glmU HP2-2 (HP2 / pETduet-) glmM The construction of strain HP3 was carried out using the same method as that used for strain HP3.

[0054] (3) Shake-flask fermentation of strain HP3 Strains HP2-1, HP2-2, and HP3 were activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP2 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 4 As shown.

[0055] Depend on Figure 4 It is evident that the proheparin potency of strains HP2-1 and HP2-2 decreased to 187.7 mg / L and 171.9 mg / L, respectively, compared to the control group HP2 (205.3 mg / L), while the proheparin potency of strain HP3 increased to 240.8 mg / L, an increase of approximately 17.3%. This suggests... glmS The gene may be the rate-limiting step in the N-acetylglucosamine biosynthesis pathway, and overexpression of this gene is beneficial to promoting the biosynthesis of N-acetylglucosamine.

[0056] (1) Overexpression plasmid pETduet- kfiD Construction Using the EcN genome as a template, kfiD -pET-F and kfiD -pET-R is the primer PCR amplification fragment, yielding a fragment with 20 bp homology upstream and downstream of the pETduet-1 plasmid. kfiD Gene fragments were linearized at the multiple cloning site using universal primers pETL-F and pETL-R, with pETduet-1 plasmid as a template. The ClonExpress One Step Cloning Kit was then used to... kfiD The gene fragment was ligated and circularized with linearized pETduet-1 at 50°C for 30 min. The ligation product was then introduced into DH5α competent cells, incubated on ice for 30 min, heat-shocked for 90 s, and finally plated on plates containing Amp-resistant plasmids. Single colonies were observed to confirm the overexpression plasmid pETduet-1. kfiD Overexpression plasmid pETduet- pgm pETduet- stay The construction references pETduet- kfiD Construction method.

[0057] (2) Preparation of HP2 strain competent cells and construction of HP4 strain The chemically competent cells of the starting strain HP2 were prepared according to the method described in Example 2 (2), by overexpressing the plasmid pETduet- kfiDThe cells were transformed into competent HP2 cells, and after single colonies grew, strain HP4 was obtained by colony PCR and sequencing verification. Strain HP2-3 (HP2 / pETduet- pgm HP2-4 (HP2 / pETduet-) stay The construction of strain HP4 was carried out using the same method as that used for strain HP4.

[0058] (3) Shake-flask fermentation of strain HP4 Strawberries HP2-3, HP2-4, and HP4 were activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP2 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 5 As shown.

[0059] Depend on Figure 5 As can be seen, the proheparin potency of strains HP2-3 and HP2-4 decreased to 128.9 mg / L and 196.3 mg / L, respectively, compared to the control group HP2 (205.3 mg / L), while the proheparin potency of strain HP4 increased to 236.3 mg / L, an increase of approximately 15.1%. kfiD As a key gene in the glucuronic acid pathway, overexpression of this gene can promote the biosynthesis of glucuronic acid, thereby increasing the proheparin titer.

[0060] (1) Overexpression plasmid pETduet- glmS - kfiD Construction Using the EcN genome as a template, kfiD - glmS -F and kfiD -pET-R is the primer PCR amplification fragment, which is obtained by PCR amplification of the upstream and downstream components of the pETduet-1 plasmid. glmS The gene has a 20 bp homologous region downstream. kfiD Gene fragments, using primers pETL-F and glmS -R, with pETduet- glmS Linearization was performed using plasmids as templates, followed by the use of the ClonExpress One Step Cloning Kit. kfiD Gene fragments and linearized pETduet- glmSPlasmid ligation was performed by circularization at 50°C for 30 min. The ligation product was then introduced into DH5α competent cells, incubated on ice for 30 min, heat-shocked for 90 s, and finally plated on plates containing Amp resistance. Single colonies were observed to confirm the overexpression plasmid pETduet-. glmS - kfiD Overexpression plasmid pETduet- kfiD - glmS The construction references pETduet- glmS - kfiD Construction method.

[0061] (2) Preparation of HP2 strain competent cells and construction of HP5 strain The chemically competent cells of the starting strain HP2 were prepared according to the method described in Example 2 (2), by overexpressing the plasmid pETduet- glmS - kfiD The cells were transformed into competent HP2 cells, and after single colonies grew, strain HP5 was obtained by colony PCR and sequencing verification. Strain HP4-1 (HP2 / pETduet- kfiD - glmS The construction of strain HP5 was carried out using the same method as that used for strain HP5.

[0062] (3) Shake-flask fermentation of strain HP5 Strawberries HP4-1 and HP5 were activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP4 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 6 As shown.

[0063] Depend on Figure 6 As can be seen, the proheparin titers of strains HP4-1 and HP5 increased to 295.8 mg / L and 311.3 mg / L, respectively, compared to 255.9 mg / L in the control group HP4. This indicates that the combined overexpression of key genes in the UDP-GlcNAc pathway... glmS and key genes in the UDP-GlcA pathway kfiD It is beneficial to simultaneously enhance the synthesis of both proheparin precursors, while pETduet- glmS - kfiD The combination of these methods is more conducive to balancing the flux of the two pathways, thereby achieving efficient synthesis of heparin.

[0064] (1) Overexpression plasmid pETduet- glmS *- kfiD Construction by glmS Using genes as templates, glmS *-1-F、 glmS *-1-R、 glmS *-2-F、 glmS *-2-R、 glmS *-3-F、 glmS *-3-R, three pairs of primers were used to amplify the fragment by PCR, and the obtained glmS *-1、 glmS *-2、 glmS *-3 gene fragment was obtained as a complete fragment via fusion PCR. glmS *Gene fragments (mutation sites E14K, D386V, S449P, and E524S have been mutated using primers); using primer pETL- glmS *-F and pETL- glmS *-R, with pETduet- glmS - kfiD Linearization was performed using plasmids as templates, followed by the use of the ClonExpress One Step Cloning Kit. glmS *With linearized pETduet- glmS - kfiD Plasmid ligation was performed by circularization at 50°C for 30 min. The ligation product was then introduced into DH5α competent cells, incubated on ice for 30 min, heat-shocked for 90 s, and finally plated on plates containing Amp resistance. Single colonies were observed to confirm the overexpression plasmid pETduet-. glmS *- kfiD .

[0065] (2) Preparation of HP2-transformed competent cells and construction of HP-6 strain The chemically competent cells of the starting strain HP2 were prepared according to the method described in Example 2 (2), by overexpressing the plasmid pETduet- glmS *- kfiD The cells were transformed into competent cells of strain HP2, and after single colonies grew, strain HP6 was obtained by colony PCR and sequencing verification.

[0066] (3) Shake-flask fermentation of strain HP6 Strawberry strain HP6 was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP5 as a control. After fermentation, the fermentation broth was centrifuged, and the supernatant was collected. The proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600The growth status of the strain was determined, and the results are as follows: Figure 7 As shown.

[0067] Depend on Figure 7 It is evident that strain HP6 exhibited inhibited cell growth compared to strain HP5, and the proheparin titer decreased from [previous value]. The concentration increased from 311.2 mg / L to 363.7 mg / L, an increase of approximately 16.9%, indicating that the introduction of the mutant may have alleviated the feedback inhibition of glucosamine 6-phosphate to some extent. According to the literature, the metabolic flux of the N-acetylglucosamine synthesis pathway is naturally weaker than that of the glucuronic acid synthesis pathway. This modification may have further promoted the synthesis of N-acetylglucosamine, thereby increasing the potency of proheparin.

[0068] (1) Knockout plasmid pTarget-Δ nagB Construction The plasmid construction process is the same as that in Example 3 (1), and the primers involved are listed in Table 1.

[0069] (2) Preparation of HP2-transformed competent cells and construction of strain HP2 / pEcCas The competent cells of the starting strain HP2 were prepared according to the preparation method in Example 2 (2). The plasmid pEcCas was transformed into the competent cells of strain HP2. After single colonies grew, the strain HP2 / pEcCas was obtained by colony PCR and sequencing verification.

[0070] (3) Preparation of electrocompetent strains HP2 / pEcCas and construction of strain HP7 The preparation of electrocompetent cells for strain HP2 / pEcCas and the construction of strain HP7 were carried out according to the preparation and construction method of electrocompetent cells in Example 3 (3). At the same time, in order to reduce the metabolic stress of the bacteria, the plasmid needs to be eliminated after successful gene editing. The plasmid elimination procedure was carried out according to Example 3 (4).

[0071] (4) Shake-flask fermentation of strain HP7 Strawberry strain HP7 was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP2 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 8 As shown.

[0072] Depend on Figure 8It is evident that the growth of strain HP7 was not significantly affected compared to strain HP2, but the proheparin titer decreased from 205.8 mg / L to 98.8 mg / L, suggesting a potential Δ... nagB This leads to the excessive accumulation of the intermediate metabolite glucosamine 6-phosphate, which cannot be converted downstream, thereby inhibiting the expression of pathway genes and ultimately inhibiting the synthesis of proheparin.

[0073] (1) Preparation of HP7 strain competent cells and construction of HP8 strain The chemically competent cells of the starting strain HP7 were prepared according to the method described in Example 2 (2), by overexpressing the plasmid pETduet- glmS *- kfiD Transformed into HP7 strain, strain HP8 was obtained by colony PCR and sequencing verification, and the overexpression plasmid pETduet- glmS *- kfiD As constructed above.

[0074] (2) Shake-flask fermentation of strain HP8 Strawberry strain HP8 was activated by streaking on LB agar and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB agar, and cultured at 37°C for 10 h. 2 mL of seed culture was then transferred to 50 mL of fermentation medium, with strain HP6 as a control. After fermentation, the supernatant was collected by centrifugation, and the proheparin content was determined using the sulfuric acid-carbazole method. The precipitate was resuspended in sterile water, diluted 20-fold, and the OD was measured using a spectrophotometer. 600 The growth status of the strain was determined, and the results are as follows: Figure 9 As shown.

[0075] Depend on Figure 9 It is evident that strain HP8 showed improved growth compared to strain HP6, with the proheparin titer increasing from 363.7 mg / L to 397.9 mg / L, an increase of approximately 9.4%, indicating that Δ nagB More precursors were accumulated, and the overexpression plasmid pETduet- was introduced. glmS *- kfiD It facilitated the downstream conversion of intermediates in both pathways. However, insufficient expression or excessive intracellular accumulation of glycosyltransferases may have limited further enhancement of proheparin potency.

[0076] The above embodiments are for describing preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope of the present invention.

[0077] SEQ ID NO.1 ( end Gene): ATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCACAGCATTTTCCGGCCCGGCATTGGCCGAAGGTATCAATAGTTTTTCTCAAGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAACTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGAAAAAATGAAAACCGTGCCAGCCGCGTAGAGTGGGAACACGTCGTTCCTGCCTGGCAATTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAATTGCGCCAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTGCAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTTCAAAGAAAAAGTTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGTGACCAATACAACCTGACACTCTCTCGTCAGCAAACGCAGCTGTTCAACGCATGGGACAAGATGTATCCAGTTACCGACTGGGAGTGCGAGCGTGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTGCAACGCGCTTGCCAGGCGCGAAAGAGCTAA SEQ ID NO.2( pfkA Gene): ATGATTAAGAAAATCGGTGTGTTGACAAGCGGCGGTGATGCGCCAGGCATGAACGCCGCAATTCGCGGGGTTGTTCGTTCTGCGCTGACAGAAGGTCTGGAAGTAATGGGCATTTATGACGGCTATCTGGGTCTGTATGAAGACCGTATGGTACAGCTAGACCGTTACAGCGTTTCTGACATGATCAACCGTGGTGGTACGTTCCTCGGTTCTGCGCGTTTCCCGGAATTCCGCGACGAGAACATCCGCGCCGTGGCTATCGAAAACCTGAAAAAACGTGGGATCGACGCGCTGGTGGTTATCGGCGGTGACGGTTCCTACATGGGTGCAATGCGTCTGACCGAAATGGGCTTCCCGTGCATCGGCCTGCCGGGCACTATCGACAACGACATCAAAGGCACTGACTACACTATCGGTTTCTTCACTGCGCTGAGCACCGTTGTAGAAGCGATCGACCGTCTGCGTGACACCTCTTCTTCTCACCAGCGTATTTCCGTGGTGGAAGTGATGGGCCGTTATTGTGGCGATCTGACGTTGGCTGCGGCTATTGCCGGCGGCTGTGAATTCGTTGTGGTTCCGGAAGTTGAATTCAGCCGTGAAGACCTGGTAAACGAAATCAAAGCGGGTATCGCGAAAGGTAAAAAACACGCGATCGTGGCGATTACCGAACATATGTGTGATGTTGACGAACTGGCGCATTTCATCGAGAAAGAAACCGGTCGTGAAACCCGCGCAACTGTGCTGGGCCACATCCAGCGCGGTGGTTCTCCGGTGCCTTACGACCGTATTCTGGCTTCCCGTATGGGCGCTTACGCTATCGAGCTGCTGCTGGCAGGTTACGGTGGTCGTTGCGTAGGTATCCAGAACGAACAGCTGGTTCACCACGACATCATCGACGCTATCGAAAACATGAAGCGTCCGTTCAAAGGCGACTGGCTGGACTGCGCGAAAAAACTGTATTAA SEQ ID NO.3 (Trc promoter): TTGACAATTAATCATCCGGCTCGTATAATG SEQ ID NO.4 ( glmS Gene): SEQ ID NO.5 ( kfiD Gene): SEQ ID NO.6 ( glmS *Gene): SEQ ID NO.7 ( nagB gene): ATGAGACTGATCCCCCTGACTACCGCTGAACAGGTCGGCAAATGGGCTGCTCGCCATATCGTCAATCGTATCAATGCGTTCAAACCGACTGCCGATCGTCCGTTTGTACTGGGCCTGCCGACTGGCGGCACGCCGATGACCACCTATAAAGCGTTAGTCGAAATGCATAAAGCAGGCCAGGTCAGCTTTAAGCACGTTGTCACCTTCAACATGGACGAATATGTCGGTCTGCCGAAAGAGCATCCGGAAAGCTACTACAGCTTTATGCACCGTAATTTCTTCGATCACGTTGATATTCCAGCAGAAAATATCAACCTTCTCAACGGCAACGCCCCGGATATCGAAGCCGAATGCCGCCAGTATGAAGAAAAAATCCGTTCTTACGGAAAAATTCATCTGTTTATGGGCGGTGTAGGTAACGACGGTCATATTGCATTTAACGAACCGGCGTCTTCTCTGGCTTCTCGTACTCGTATCAAAACCCTGACTCATGACACTCGCGTCGCGAACTCTCGTTTCTTTGATAACGATGTTAATCAGGTGCCAAAATATGCCCTGACTGTCGGTGTTGGTACATTGCTGGATGCCGAAGAAGTGATGATTCTGGTGCTGGGTAGTCAGAAAGCACTGGCACTGCAGGCCGCCGTTGAAGGTTGCGTGAACCACATGTGGACCATCAGTTGTCTGCAACTGCATCCAAAAGCGATCATGGTGTGCGATGAACCTTCCACCATGGAGCTGAAAGTTAAGACTTTAAGATATTTCAATGAATTAGAAGCAGAAAATATCAAGGGTCTGTAA。

Claims

1. A genetically engineered bacterium for producing heparosan, characterized by, The E. coli Nissle 1917 is used as a chassis, and the construction method comprises at least one of the following steps: (1) Knocking out endonuclease I encoding gene in the genome of the chassis strain endA ; (2) knocking out the 6-phosphofructokinase I coding gene in the genome of the chassis strain pfkA ; (3) overexpression of a 6-phosphoglucomine synthase encoding gene derived from the genome of the chassis strain glmS and / or a UDP-glucose-6-dehydrogenase encoding gene kfiD ; (4) relieving the feedback inhibition of GlmS by glucosamine-6-phosphate to promote the synthesis of UDP-N-acetylglucosamine; (5) knocking out the 6-phosphoglucomate deaminase encoding gene in the genome of the chassis strain nagB .

2. The genetically engineered bacterium for producing heparosan according to claim 1, wherein: The endA The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

3. The genetically engineered bacterium for producing the proheparin according to claim 1, wherein: The pfkA The nucleotide sequence of the gene is shown as SEQ ID NO.

2.

4. The genetically engineered bacterium for producing the proheparin according to claim 1, wherein: The glmS gene and the kfiD gene are both strong promoters Trc.

5. The genetically engineered bacteria for producing heparosan according to claim 5, wherein: The Trc promoter nucleotide sequence is shown in SEQ ID NO. 3, the nucleotide sequence of the glmS gene is shown in SEQ ID NO. 4, and the nucleotide sequence of the kfiD gene is shown in SEQ ID NO.

5.

6. The genetically engineered bacterium for producing the proheparin according to claim 1, wherein In step (4), the method for relieving the feedback inhibition of the GlmS product comprises the following (1) to (4) combined mutations to the amino acid sequence of the 6-phosphoglucosamine synthetase: (1) the glutamic acid at position 14 is mutated to lysine; (2) the aspartic acid at position 386 is mutated to valine; (3) the serine at position 449 is mutated to proline; (4) the glutamic acid at position 524 is mutated to serine.

7. The genetically engineered bacterium for producing the proheparin according to claim 1, wherein: the proheparin is a proheparin having a molecular weight of 40,000 to 60,000. The nagB The nucleotide sequence of the gene is shown as SEQ ID NO.

7.

8. The method for constructing a genetically engineered bacterium for producing proheparin according to any one of claims 1 to 7, wherein the proheparin is a proheparin having a molecular weight of 30,000 to 60,000. comprises at least one of the following steps: (a) using the Red homologous recombination technology to knock out the endonuclease I coding gene in the genome of the Escherichia coli Nissle 1917 as a chassis endA ; (b) knocking out the 6-phosphofructokinase I encoding gene in the genome of the chassis strain and / or the engineered strain obtained in step (a) using CRISPR-Cas9 mediated gene editing technology pfkA ; (c) overexpressing the 6-phosphoglucomine synthase encoding gene derived from the genome of the chassis strain in the engineered bacteria obtained in step (b) using a plasmid expression system glmS and / or the UDP-glucose-6-dehydrogenase encoding gene kfiD ; (d) Construction of recombinant plasmid pETDuet- glmS *- kfiD The recombinant plasmid pETDuet- glmS *- kfiD Import the engineered bacteria obtained in step (b); (e) knocking out the 6-phosphogluconolactonase-encoding gene in the engineered bacteria obtained in step (b) using CRISPR-Cas9-mediated gene editing technology nagB ; (f) introducing the recombinant plasmid pETDuet- glmS kfiD into the engineered bacteria obtained in step (e).​ 9. The genetically engineered bacteria for producing heparosan according to any one of claims 1 to 7 for use in the preparation of heparosan.

10. Use according to claim 9, wherein The method for the use is as follows: the genetically engineered bacteria for producing heparosan are inoculated into a shake flask for fermentation culture, and the fermentation culture is carried out at 30 to 37°C and 200 to 250 rpm for 20 to 30 hours, and then the fermentation supernatant is separated and purified to obtain heparosan.

Images