A kit and detection method for quantitative detection of residual DNA in Pichia pastoris host cells.

The quantitative real-time PCR technique using SYBR Green fluorescent dye and specific primer pairs solves the problems of cumbersome operation and low detection limit in existing methods for detecting DNA residues in Pichia pastoris host cells. It enables rapid, economical and accurate detection of DNA residues in recombinant biological products derived from Pichia pastoris, with a quantification limit of 3.95 pg/mL.

CN121344255BActive Publication Date: 2026-06-30BEIJING PROTGEN +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BEIJING PROTGEN
Filing Date
2025-12-22
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing methods for quantitative detection of residual DNA in Pichia pastoris host cells are cumbersome to operate, have low stability and detection limits, and cannot meet the detection requirements for high-concentration doses of recombinant biological products such as human serum albumin.

Method used

Using primer pairs designed with SYBR Green fluorescent dye, the residual DNA in Pichia pastoris host cells can be accurately and quantitatively detected by real-time PCR. The designed primer pairs include forward and reverse primers. The kit contains DNA standards, extraction reagents, dissolving buffer and qPCR reaction solution. The reaction solution consists of SYBR Green, dNTPs, Mg2+, DNA polymerase and Tris-HCl.

Benefits of technology

This method enables rapid, economical, and accurate detection of nucleic acid residues in Pichia pastoris-derived recombinant biological products, with a limit of quantification of 3.95 pg/mL, meeting stringent quality control requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344255B_ABST
    Figure CN121344255B_ABST
Patent Text Reader

Abstract

This invention provides a kit and method for quantitatively detecting residual DNA in Pichia pastoris host cells, belonging to the field of biodetection technology. It addresses the problems of high probe synthesis costs and design difficulties associated with probe-based detection methods. The primer pairs involved in this application are effective for the quantitative detection of residual DNA in Pichia pastoris-derived recombinant human serum albumin preparations in biological products. The kit constructed from these primer pairs has been validated to exhibit good accuracy and repeatability in the quantitative detection of residual DNA in Pichia pastoris-derived biological products, and its calculated limit of quantification is 3.95 pg / mL. The kit can meet the requirements for the quantitative detection of residual DNA in all Pichia pastoris-derived biological products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a kit and detection method for quantitatively detecting residual DNA in Pichia pastoris host cells. Background Technology

[0002] Pichia pastoris, due to its high expression efficiency, rapid growth rate, and stable exogenous genes, has become the preferred host cell for several recombinant biological products. For example, G-CSF, hIFNγ, Xylanase, and Human interleukin (Zhiliang Yang, Zisheng Zhang) have all been efficiently recombinantly expressed in Pichia pastoris host cells and commercialized. Human serum albumin (HSA) has also achieved efficient recombinant expression in Pichia pastoris.

[0003] Strict quality standards are required for the amount of residual host DNA in biological products. The US FDA sets the acceptable limit for residual host DNA at 10 ng / dose, although this limit may vary depending on the source of the residual DNA and the route of administration. The European Pharmacopoeia also stipulates that the maximum residual amount of host cellular DNA should not exceed 10 ng / dose. The Chinese Pharmacopoeia (2015 edition) stipulates that the residual amount of host cellular DNA should not exceed 10 ng / dose.

[0004] Currently, the Chinese Pharmacopoeia (2015 edition) includes four methods for detecting residual exogenous DNA, including DNA probe hybridization and fluorescent staining. The DNA probe hybridization method primarily uses digoxigenin-labeled probes. Lü Hongliang et al. used digoxigenin-labeled probes to detect residual Vero cell DNA in Vero cell rabies vaccine, achieving a detection value of 5 pg / dose. Li Jia et al. used dot blot hybridization to determine residual Vero cell DNA, achieving a sensitivity of 0.1 pg. Zhao Xihong used digoxigenin-labeled probes to detect residual DNA in recombinant human interferon α2b, with results showing that the residual exogenous DNA was less than 10 ng. Fluorescent staining utilizes the specific binding of double-stranded DNA fluorescent dyes to form complexes, and the content of double-stranded DNA is determined by the fluorescence signal. Wang Qiuhong et al. used PicoGreen to detect total DNA, CHO total DNA, and E. coli plasmid DNA in E. coli, verifying that this method can basically meet the requirements of the biopharmaceutical industry for DNA residue quality control. However, these two methods are cumbersome to operate and have low stability and detection limits. They are not suitable for quantitative detection of nucleic acid residues for some high-concentration injectable protein drugs (such as HSA, which has a clinical use concentration of about 200 g / L and a single dose of 10 g / vial).

[0005] Real-time quantitative PCR (qPCR) is a technique that has emerged in recent years and been applied to the detection of residual DNA in biopharmaceuticals. Its principle involves adding a fluorescent dye to the PCR reaction system, collecting the fluorescence signal during the PCR process, and finally quantifying the nucleic acid sample using a standard curve. The United States Pharmacopeia (USP) included qPCR as a detection method in 2015. E. coli Methods for detecting CHO host DNA residues. DH Lee et al. used SYBR Green to... E. coli qPCR was used to detect residual host cell DNA, with a detection limit as low as 0.042 pg. B. Hua et al. used TaqMan to quantify residual CHO cell DNA, achieving a detection limit of 1 pg DNA / mL and a quantitation limit of 10 pg DNA / mL. Hu Guanghong et al. used real-time quantitative PCR to detect residual Vero host cell DNA, achieving a detection sensitivity of 0.3 fg / μL. Niu Dongyun et al. used qPCR to detect residual DNA in CHO cells from Conbercept products, achieving a detection limit as low as 0.9 pg / mL. qPCR detection of host cell DNA exhibits high specificity, accuracy, and sensitivity, and can be used as a routine method for detecting residual host cell DNA.

[0006] With increasingly stringent requirements for the quality and safety of recombinant biological products, researchers have developed several qPCR quantitative detection kits and methods for detecting residual host DNA in different host cells. Patent CN 10581641A invented a method and kit for detecting residual CHO host DNA, achieving a detection limit of 0.1 fg / μL. Patent CN 101565741B invented a kit for quantitatively detecting residual Vero cell DNA, with a sensitivity of 1.0 pg / mL. Patent CN 107365832A invented a qPCR method and kit for quantitatively detecting E. coli DNA content in biological products, with a detection limit as low as 2.0 fg / μL. For the Pichia pastoris host, patent CN 106676163A invented a DNA residue detection kit. This kit utilizes TaqMan probes for quantitative qPCR detection of residual host DNA, achieving a sensitivity of 1.0 fg / μL.

[0007] Currently, qPCR detection methods mainly rely on probe methods (TaqMan) and fluorescent dye methods (SYBR Green). Due to the different properties of their luminescent substrates, probe methods are approximately 10 times more sensitive than fluorescent dye methods. However, they also suffer from drawbacks such as higher probe synthesis costs and greater design complexity. For commercial users with large detection volumes, a convenient, economical, and rapid detection kit is needed. Based on these factors, this patent proposes a qPCR detection kit and method for the quantitative detection of residual nucleic acid in Pichia pastoris cells using SYBR Green fluorescent dye. This kit can meet the quantitative detection requirements of residual nucleic acid in all recombinant biological products using Pichia pastoris as the host, thereby achieving strict quality control of host cell DNA residues in the production process. Summary of the Invention

[0008] In view of the above-mentioned problems, and in order to overcome the shortcomings and deficiencies of the existing technology, this application proposes a kit and detection method for quantitative detection of residual host cell DNA in Pichia pastoris. This method uses SYBR Green as a fluorescent dye, combined with designed primer pairs, to accurately and quantitatively detect and control the quality of residual host DNA in the production process of Pichia pastoris-derived recombinant biological products using quantitative real-time polymerase chain reaction (qPCR) technology.

[0009] The technical solution adopted in this invention is as follows:

[0010] The primary objective of this invention is to protect a primer pair for quantitatively detecting residual DNA in Pichia pastoris host cells. The primer pair includes a forward primer and a reverse primer, wherein the sequence of the forward primer is shown in SEQ ID NO: 9, and the sequence of the reverse primer is shown in SEQ ID NO: 10.

[0011] The second objective of this invention is to protect a kit for quantitatively detecting residual DNA in Pichia pastoris host cells, the kit comprising the aforementioned forward and reverse primers.

[0012] Furthermore, the kit also includes DNA standards, DNA extraction reagents, DNA dissolving solution, and qPCR reaction solution.

[0013] Furthermore, the qPCR reaction solution includes SYBR Green (2×), dNTPs (0.2 mM), and Mg. 2+ (1.75mM), DNA polymerase (1 ng / μL), Tris-HCI (40 mM, pH 9.0).

[0014] Furthermore, the kit has a limit of quantification of 3.95 pg / mL for residual Pichia pastoris host cell DNA.

[0015] The third objective of this invention is to protect a method for quantitatively detecting residual DNA in Pichia pastoris host cells, the method comprising:

[0016] Prepare standards, and perform qPCR detection using the primer pairs or kits described above, with the standard concentration (Lg value) as the reference value. x The axis is based on the Cq value of the standard obtained from the test. y Use the axes to plot the standard curve and generate the linear regression equation;

[0017] Prepare the sample to be tested, extract DNA from the sample, use the extracted DNA as a detection template, and perform qPCR detection using the above-mentioned kit to obtain the Cq value of the sample to be tested.

[0018] The DNA content of the sample is calculated by substituting the Cq value of the sample obtained from the test into the linear regression equation.

[0019] Furthermore, the qPCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 30 sec, for 40 cycles.

[0020] Beneficial effects:

[0021] The novel primer pair protected by this invention can be effectively used for the quantitative detection of DNA residues in Pichia pastoris-derived recombinant human serum albumin preparations in biological products, thereby achieving strict quality control of host cell DNA residues in the production process.

[0022] The kit disclosed in this invention has been validated to demonstrate good accuracy and repeatability in the quantitative detection of DNA residues in Pichia pastoris-derived biological products. Furthermore, its calculated limit of quantification (LOQ) is 3.95 pg / mL, and the kit can meet the quantitative detection requirements for DNA residues in all Pichia pastoris-derived biological products. The novel primer pairs designed in this invention exhibit good specificity.

[0023] The DNA residue quantitative kit designed in this invention can form a kit capable of quantitatively detecting the amount of residual DNA in Pichia pastoris host cells through innovative primer pair design. This solves the problems of high probe synthesis cost and high design difficulty, shortens the research and development cycle, and its lowest limit of quantification can reach 3.95 pg / mL, enabling accurate and quantitative detection of residual host DNA in the production process of Pichia pastoris-derived recombinant biological products. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 The results are shown in the electrophoresis assay for DNA standards. The left lane contains the λHind III standard molecular weight marker, and the right lane contains the DNA standard sample.

[0026] Figure 2 The results of PCR electrophoresis for different primer pairs are shown. Lanes 1-6 represent annealing temperatures of 50℃, 52℃, 54℃, 56℃, 58℃, and 60℃, respectively. Lane M is the DNA molecular weight marker (from top to bottom: 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp).

[0027] Figure 3 The results of PCR electrophoresis for the Q26-2 primer pair are shown. Lanes 1-6 represent annealing temperatures of 50℃, 52℃, 54℃, 56℃, 58℃, and 60℃, respectively. Lane M is the DNA molecular weight marker (from top to bottom: 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp).

[0028] Figure 4 In the diagram, A represents the linear range amplification curve of Pichia pastoris DNA standard; B represents the linear range melting curve of Pichia pastoris DNA standard; and C represents the linear range standard curve of Pichia pastoris DNA standard.

[0029] Figure 5 The amplification curves for the accuracy experiment of this invention are shown. The arrows indicate the amplification curves of six parallel detections of the sample.

[0030] Figure 6 The standard curves for the repeatability experiment of this invention are: A is the amplification curve of 3 batches of standards, B is the standard curve corresponding to the amplification curve of standard 1, C is the standard curve corresponding to the amplification curve of standard 2, and D is the standard curve corresponding to the amplification curve of standard 3.

[0031] Figure 7 This is the standard curve for the limit of quantitation experiment of this invention. The curves between the arrows represent the amplification curves of the six blank test samples.

[0032] Figure 8The amplification curve is used to quantitatively detect the amount of residual DNA in the rHSA preparation solution using the kit of the present invention. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0034] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0035] Experimental materials:

[0036] 1. 2× qPCR Mix: Contains SYBR Green (2×), dNTPs (0.2 mM), Mg 2+ (1.75 mM), DNApolymerase (1 ng / μL), Tris-HCI (40 mM, pH 9.0).

[0037] 2. DNA standard (1 μg / mL).

[0038] 3. Amplification primers (10 μmol / L): Includes forward and reverse primers, store at -20℃.

[0039] 4. DNA extraction kit: Wako (Catalog No.: 295-50201).

[0040] 5. DNA lysis solution: EASY Dilution (Takara, catalog number 9451).

[0041] 6. Pichia pastoris ( Pichia pastoris GS115): (Invitrogen, C18100).

[0042] 7. Human serum albumin was purchased from Chengdu Rongsheng Company.

[0043] 8. The real-time PCR instrument was purchased from Bio-Rad CFX96.

[0044] 9. The yeast DNA extraction kit was purchased from Magen (D3147-02).

[0045] Experimental methods:

[0046] 1. Primer design and synthesis:

[0047] According to Pichia pastoris ( Pichia pastorisFour primer pairs were designed based on the 26S DNA sequence (EU011657.1) of GS115, resulting in an extended product fragment of approximately 150 bp. Information is as follows:

[0048] Q 26-1 SEQ ID NO: 1: F:5'-GCCCCGTAGCACGGTCAACCTT-3'

[0049] Q 26-1 SEQ ID NO: 2: R:5'-CAGGACCACTTGTCGTGGCCTT-3'

[0050] Q 26-2 SEQ ID NO: 3: F:5'- TACCCTGCCGGAGAACAGAAAGC-3'

[0051] Q 26-2 SEQ ID NO:4:R:5'-GCCGTCTCGTGTCACCACTCATT-3'

[0052] Q 26-3 SEQ ID NO:5:F:5'-TTGGTTTTATTTATGTTATTCCCCC-3'

[0053] Q 26-3 SEQ ID NO: 6: R:5'-CACTTTGACATTCAGAGCACTGG-3'

[0054] Q 26-4 SEQ ID NO:7:F:5'-TATAGGGGGGAGCCGTTTCGGC-3'

[0055] Q 26-4 SEQ ID NO:8:R:5'-GCTCGGCTGAAGATTTCTGTTC-3'

[0056] The above primers were synthesized by a third-party organization and delivered in 10 μmol / L solution form.

[0057] 2. Preparation of Standards:

[0058] Pichia pastoris GS115 was activated on YPD plates, and then the activated yeast was transferred to YPD liquid medium and cultured overnight on a shaker (28°C, 220 rpm). The cells were collected by centrifugation the following day, and genomic DNA was extracted (as shown in the kit instructions). The obtained DNA was dissolved in ddH2O and analyzed by UV and gel electrophoresis. The results are shown below. Figure 1 As shown. The A260 / A280 values ​​are between 1.8 and 2.0, and the gel electrophoresis imaging result is a single band (…). Figure 1Use Pichia pastoris genomic DNA as a control in this kit and store at -20°C.

[0059] 3. PCR system optimization:

[0060] Table 1 PCR reaction system:

[0061] ;

[0062] The forward and reverse primers involved are any pair of the primers mentioned above.

[0063] Each sample was tested three times using qPCR.

[0064] Table 2 PCR reaction procedure A:

[0065] ;

[0066] X℃ refers to a temperature gradient, including 50℃, 52℃, 54℃, 56℃, 58℃, and 60℃.

[0067] The PCR products were detected and verified by 1.5% agarose gel electrophoresis (results are shown in [link to results]). Figure 2 ), Figure 2 The results showed that the Q26-2 primer pair had the best amplification effect (relative to other primer pairs) at different annealing temperatures, but from Figure 2 Upon closer inspection, a few non-specific bands (approximately 300 bp) still exist. We will use Q26-2 as a candidate primer pair for methodology development.

[0068] 4. Primer optimization:

[0069] To address the issue of non-specific bands generated by the Q26-2 primer pair, we optimized the Q26-2 primer pair. The optimized primer sequences are as follows:

[0070] Q 26-2 SEQ ID NO: 9: F:5'-TACCCTGCCWGAGAACAGAAAGC-3'(W=A / T)

[0071] Q 26-2 SEQ ID NO: 10: R:5'-GCRGTCTCGTGTCACCACTCATT-3'(R=A / G)

[0072] The primers were purified by HPLC. The optimized primers were then validated by PCR, and the electrophoresis results are as follows: Figure 3 As shown. Using the Q26-2 primer pair as the detection primers, the PCR product size under different annealing temperatures was as expected, and the bands were single, demonstrating good stability. Figure 3The results showed that the amplification efficiency decreased slightly with increasing annealing temperature (50℃~60℃). Choosing 50℃ as the annealing temperature would risk reducing specificity; therefore, we selected 56℃ as the annealing temperature for the subsequent qPCR methodology development.

[0073] 5. Micro-DNA extraction method:

[0074] DNA was extracted from the sample using a DNA extraction kit (Wako, 295-50201), and 100 μL of LEAST Dilution (Takara, catalog number 9451) was added to dissolve the sample. Then, the three parallel samples were mixed into one sample and thoroughly mixed.

[0075] 6. Linearity and range confirmation:

[0076] Take an appropriate amount of DNA control, add EASY Dilution to dilute it to 1,000,000 pg / mL as control solution ①, and then dilute it according to Table 3 to prepare the control solution.

[0077] Table 3. Dilution data for the linear range of standards:

[0078] ;

[0079] The DNA control solution was tested by qPCR.

[0080] Table 4 Reaction Procedure B:

[0081] ;

[0082] qPCR test results as follows Figure 4 As shown in AC, through Figure 4 As shown in Figure A, the amplification curves of the control standard all exhibit a clear logarithmic growth phase, indicating good linearity of the sample within the range of 10–1,000,000 pg / mL. A standard curve (e.g., [example curve not provided]) is plotted based on the qPCR results. Figure 4 As shown in C), a linear regression equation is generated, and the linear regression equation is: y =-3.513 x +34.00, R 2 =0.998. For example... Figure 4 As shown in Figure B, the melting peak produced by qPCR is a single peak (indicating that the PCR product is a single band, unlike...). Figure 3 The results were consistent, indicating that the optimized Q26-2 primers have good specificity. The data analysis results are shown in Table 5 below.

[0083] Table 5. Linear range test data for standard samples:

[0084] ;

[0085] 7. Accuracy Confirmation:

[0086] DNA standards were diluted with EASY Dilution to concentrations of 500,000 pg / mL, 50,000 pg / mL, 5,000 pg / mL, 500 pg / mL, and 50 pg / mL, respectively. 16 μL of the 5,000 pg / mL standard was added to 4 mL of human serum albumin solution as a quality control. After mixing, DNA extraction was performed. The quality control was tested in six parallel qPCR assays, with an average Cq of 26.86. A standard curve was plotted using the standard test results (e.g., ...). Figure 5 (as shown) and linear equations: y =-3.588 x +34.36, R 2 =0.999. Analysis showed that the average DNA recovery rate of this kit was 125.1%. The relative standard deviation (RSD) was 16.75%. This indicates that the kit has good accuracy in the quantitative detection of DNA residues in Pichia pastoris-derived biological products.

[0087] 8. Repeatability verification:

[0088] In addition, three different batches of DNA standards were prepared, and three sets of DNA standard solutions were prepared respectively (500,000 pg / mL, 50,000 pg / mL, 5,000 pg / mL, 500 pg / mL, and 50 pg / mL). 16 μL of the 5,000 pg / mL standard from each set was added to 4 mL of human serum albumin solution as a quality control. qPCR detection was performed, and the results are shown in Table 6. A standard curve was plotted based on the qPCR results. Figure 6 As shown in AD. The generated linear regression equations are as follows: y =-3.5735 x +34.459, y =-3.5885 x +34.363, y =-3.5861 x +34.501. R 2 All values ​​were ≥ 0.999. The average recovery rate of the three quality control samples was 95.54%, and the RSD was 4.88%. This indicates that the kit in this invention can generate the same standard curve for different batches of DNA standards, demonstrating good reproducibility.

[0089] Table 6. Repeatability verification experiment data:

[0090] ;

[0091] 9. Limit of Quantitation (LOQ) Confirmation:

[0092] DNA standards were diluted with EASY Dilution to concentrations of 500,000 pg / mL, 50,000 pg / mL, 5,000 pg / mL, 500 pg / mL, and 50 pg / mL. qPCR was performed to generate a standard curve. DNA samples extracted from human serum albumin injection were used as blank samples for qPCR testing, with six parallel tests performed. The results are shown in Table 7. The standard deviation of the six Cq values ​​was calculated using the formula LOQ = 10δ / S (where LOQ: standard deviation; δ: standard deviation of the six Cq values; S: slope of the standard curve). The qPCR amplification curve and standard curve results are shown below. Figure 7 As shown, the generated linear regression equation is: y =-3.639 x +34.63, R 2 The value was 0.999, and the slope was -3.639. The standard deviation of the Cq value of the test sample was 1.44, and the calculated limit of quantitation was 3.95 pg / mL. This indicates that the kit in this invention can meet the quantitative detection requirements for DNA residues in all Pichia pastoris-derived biological products.

[0093] Table 7. Detection data for the limit of quantitation experiment:

[0094] ;

[0095] 10. Application of the reagent kit:

[0096] Take DNA standards and dilute them with EASY Dilution to 500,000 pg / mL, 50,000 pg / mL, 5,000 pg / mL, 500 pg / mL, and 50 pg / mL to obtain standards. Plot a standard curve using qPCR.

[0097] The average Cq value of three replicates was used as the final detection result, and the Lg value of the standard solution concentration was used as the final result. x The axis, with Cq value y Plot the standard curve on the axis and generate the linear regression equation as follows: y =-3.591 x +39.30.

[0098] Recombinant human serum albumin preparations derived from Pichia pastoris and process samples G2 and IFT were used as test samples, with EASY Dilution as a blank control. DNA was extracted from the test samples using a Wako kit, and the extracted DNA was used as a template for qPCR quantitative detection. The Cq value of the test sample was substituted into the linear regression equation to calculate the DNA content of the test sample. The amplification curves are shown below. Figure 8 As shown in Table 8, the results analysis is presented.

[0099] Table 8. Data on DNA residue detection using rHSA reagent:

[0100] ;

[0101] The results in Table 5 show that the residual amounts of G2 and IFT in the process samples were 30.33 pg / ml and 39.35 pg / ml, respectively. The negative values ​​for the formulation detection indicate that no DNA residue was detected in the recombinant human serum albumin samples.

[0102] The sequence of the Pichia pastoris host DNA residue mentioned above is shown in SEQ ID NO: 11:

[0103] TACCCTGCCGGAGAACAGAAAGCTCTCCGAGTAGGCAGGCGTGGGGGTGGTGTGGAAGGGTGCTTGTGAAGGGCCTGGAACCGCCCCTAGTGCAGATCTTGGTGGCAGTAGCAATATTCAACGGAGCCGTTGAAGACCG AAGTGGGGAAAGGTTCCACGGGAAGGGAGATCCTCCGTGGGTGAGACGGTCCTAAGGGCGCGCGTACGGTAGCGTCCGAAAGGGAAGACAGTCAAGATTCTGTCTCCGGGGGAATGAGTGGTGACACGAGACGGCCAAAG.

[0104] The present invention has demonstrated through the above experiments that the kit has good accuracy and repeatability in the quantitative detection of DNA residues in Pichia pastoris-derived biological products, and the calculated limit of quantification is 3.95 pg / mL. The kit can meet the requirements for the quantitative detection of DNA residues in all Pichia pastoris-derived biological products.

[0105] The above-described embodiments are merely preferred embodiments of the present invention, and the scope of protection of the present invention is not limited thereto. Any simple changes or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the scope of the technology disclosed in the present invention shall fall within the scope of protection of the present invention.

Claims

1. A kit for quantitatively detecting residual DNA in Pichia pastoris host cells using SYBR Green fluorescent dye, characterized in that, The kit includes primer pairs for detecting residual DNA in Pichia pastoris host cells. The primer pairs include a forward primer and a reverse primer, wherein the sequence of the forward primer is shown in SEQ ID NO: 9, and the sequence of the reverse primer is shown in SEQ ID NO:

10. The limit of quantification for detecting residual DNA in Pichia pastoris host cells using the kit is 3.95 pg / mL.

2. The kit for quantitative detection of residual DNA in Pichia pastoris host cells using SYBR Green fluorescent dye according to claim 1, characterized in that, The kit also includes DNA standards, DNA extraction reagents, DNA dissolving solution, and qPCR reaction solution.

3. The kit for quantitative detection of residual DNA in Pichia pastoris host cells using SYBR Green fluorescent dye according to claim 2, characterized in that, The qPCR reaction solution includes SYBR Green, dNTPs, and Mg. 2+ , DNApolymerase, Tris-HCI.

4. A method for quantitatively detecting residual DNA in Pichia pastoris host cells using SYBR Green fluorescent dye, characterized in that, The detection method includes: Prepare standards, perform qPCR detection using the kit described in any one of claims 1-3, plot a standard curve with Lg value of standard concentration on the x-axis and Cq value of detected standard on the y-axis, and generate a linear regression equation; Prepare the sample to be tested, extract DNA from the sample to be tested, use the extracted DNA as a detection template, and perform qPCR detection using the kit described in any one of claims 1-3 to obtain the Cq value of the sample to be tested. The DNA content of the sample is calculated by substituting the Cq value of the sample obtained from the test into the linear regression equation. The limit of quantification for detecting residual DNA in Pichia pastoris host cells using the kit is 3.95 pg / mL.

5. The method for quantitatively detecting residual DNA in Pichia pastoris host cells using SYBR Green fluorescent dye according to claim 4, characterized in that, The reaction procedure for qPCR detection is as follows: Pre-denaturation at 95℃ for 5 min; 95℃ for 30 seconds; 56℃ for 30 seconds; 72℃ for 30 seconds; 40 cycles.