Acid-resistant pasteuria pichia and application thereof in succinic acid fermentation
By overexpressing a specific gene in Pichia pastoris and subjecting it to gradient stress acclimatization, the acid tolerance problem of the strain in producing succinic acid under low pH conditions was solved, achieving efficient succinic acid synthesis and a simplified fermentation process.
Patent Information
- Application Number
- CN202610486048.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-14
- Publication Date
- 2026-06-26
Smart Images

Figure CN122278655A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to bioengineering and fermentation engineering, specifically to a method for improving the acid tolerance of Pichia pastoris through adaptive laboratory evolution, and its application in the efficient synthesis of succinic acid under low pH conditions. Background Technology
[0002] Succinic acid, also known as succinic acid, is a tetracarboxylic acid that is part of the tricarboxylic acid cycle. As an important platform chemical, it has attracted increasing attention due to its broad application prospects in food, medicine, chemical industry and biodegradable plastics.
[0003] Traditional succinic acid production primarily relies on petroleum-based chemical catalytic methods, such as the oxidation of paraffin or the hydrogenation of maleic anhydride. These processes typically require high temperatures and pressures, consuming enormous amounts of energy and using toxic catalysts, generating substantial environmental pollutants. Faced with the increasingly severe energy crisis and environmental pollution problems, biomanufacturing technologies that utilize microbial cell factories to convert renewable biomass resources such as glucose, glycerol, and cellulose hydrolysates into high-value-added chemicals have become a strategic high ground in global competition due to their green, sustainable, and environmentally friendly characteristics.
[0004] Early research on bio-based succinic acid production mainly focused on naturally occurring high-yielding strains, such as *Actinobacillus succinogenes* and *Mannheimia succiniciproducens*. These bacteria naturally possess high succinic acid production capabilities, but also have significant drawbacks: (1) they are mostly anaerobic or facultative anaerobic bacteria, requiring strict anaerobic control during fermentation, increasing operational complexity and cost; (2) they have poor acid tolerance, necessitating the addition of large amounts of neutralizing agents (such as CaCO3 and NaOH) to maintain a neutral pH during fermentation, leading to complex downstream extraction processes and high wastewater salinity; (3) the presence of endotoxins and other issues limit their application in the food and pharmaceutical fields. Subsequently, research shifted to model microorganisms, such as *Escherichia coli* and *Corynebacterium glutamicum*. Through systematic metabolic engineering, the succinic acid production of these hosts has been significantly improved. However, they also face challenges: the acid tolerance and aerobic / anaerobic switching issues of *E. coli*, and the relatively low glycolytic flux of *Corynebacterium*. Against this backdrop, *Pichia pastoris*, as an unconventional yeast, stands out as an ideal chassis cell for the production of organic acids such as succinic acid, thanks to its unique comprehensive advantages.
[0005] However, using metabolically modified Pichia pastoris strains to produce high levels of succinic acid leads to a sharp drop in the pH of the fermentation broth during the later stages of fermentation, causing a significant decrease in succinic acid production. Undomesticated wild-type or initially engineered strains may not be able to tolerate this acidic environment created by their own metabolism, resulting in growth inhibition, decreased cell activity, and even cell death, thus limiting yield and productivity. In industrial production, the method to address the low pH environment during fermentation is to adjust it by adding neutralizing agents. Therefore, breeding strains that can efficiently utilize glucose and produce high levels of succinic acid under low pH conditions is of great significance for reducing production costs. Summary of the Invention
[0006] This invention aims to address the problem of poor production performance of existing strains under low pH conditions. Using Pichia pastoris GS115 as the starting strain, the carbon metabolic pathway of Pichia pastoris was systematically reconstructed, making succinic acid the primary metabolic endpoint. Hydrochloric acid was used as the selection pressure, and directed evolution was employed to screen for domesticated Pichia pastoris strains tolerant to lower pH levels, resulting in acid-tolerant Pichia pastoris strains.
[0007] The technical solution adopted in this invention is as follows:
[0008] An acid-tolerant Pichia pastoris engineered strain, wherein the strain is based on Pichia pastoris, and overexpresses pyruvate carboxylase gene, malate dehydrogenase gene, fumarate enzyme gene and fumarate reductase gene to open up the TCA reduction pathway. At the same time, it overexpresses malate transport protein gene to solve the bottleneck of malate transmembrane transport from cytoplasm to mitochondria, and knocks out succinate dehydrogenase gene to block the further metabolic consumption of succinate.
[0009] The malate dehydrogenase gene is ScMdh from Saccharomyces cerevisiae, and its sequence is shown in SEQ ID NO:1; the fumarate reductase gene is ScFrd from Saccharomyces cerevisiae, and its sequence is shown in SEQ ID NO:2; the pyruvate carboxylase gene is RoPyc from Rhizopus oryzae, and its sequence is shown in SEQ ID NO:3; the malate transporter gene is SpMae from Schizosoma spp., and its sequence is shown in SEQ ID NO:4; the fumarate enzyme gene is PkFum from Klebsiella pneumoniae, and its sequence is shown in SEQ ID NO:5; the succinate dehydrogenase gene is SDH5, and its nucleotide sequence is shown in SEQ ID NO:6.
[0010] The strain was obtained through acid tolerance acclimatization, which involved: using hydrochloric acid to adjust the pH of the culture medium to create an acidic stress environment; setting the initial stress pH to 3.8 and gradually decreasing the pH of the culture medium by 0.3-0.5 units each time until the pH dropped to 3.0; after multiple acclimatizations, a high-yielding strain with significant growth advantages and acid tolerance was obtained through screening.
[0011] The construction of the engineered strain GS115-SH of *Pichia pastoris* producing succinic acid is carried out through the following steps:
[0012] 1) Selection and synthesis of target genes
[0013] To enhance the reductive tricarboxylic acid (rTCA) pathway in succinic acid synthesis, the following five key genes were selected and cloned:
[0014] Malate dehydrogenase gene (ScMdh): derived from Saccharomyces cerevisiae, catalyzes the conversion of oxaloacetate to malate, and its amino acid sequence is shown in SEQ ID NO:1.
[0015] Fumarate reductase gene (ScFrd): Derived from Saccharomyces cerevisiae, it catalyzes the conversion of fumarate to succinic acid, and its amino acid sequence is shown in SEQ ID NO:2.
[0016] Pyruvate carboxylase gene (RoPyc): derived from Rhizopus oryzae, catalyzes the conversion of pyruvate to oxaloacetic acid, and its amino acid sequence is shown in SEQ ID NO:3.
[0017] The malic acid transporter gene (SpMae) is derived from Schizosaccharomyces pombe and is used to transport malic acid from the cytoplasm to the mitochondria, thereby enhancing metabolic flux. Its amino acid sequence is shown in SEQ ID NO:4.
[0018] Fumarase gene (PkFum): Derived from Klebsiella pneumoniae, it catalyzes the conversion of malic acid to fumaric acid, and its amino acid sequence is shown in SEQ ID NO:5.
[0019] All genes were synthesized in an optimized manner based on the codon preference of Pichia pastoris.
[0020] 2) Construction and transformation of expression boxes
[0021] The five genes were ligated into the BB3aK_AF vector plasmid to construct recombinant plasmids for co-expression of RoPyc, ScFrd, Spmae, ScMdh, and PkFum. Each expression cassette was then sequentially integrated into the genome of *Pichia pastoris* GS115 via electroporation. Transformants were screened using G418 antibiotic.
[0022] 3) Knockout of succinate dehydrogenase subunit gene
[0023] To prevent further metabolic consumption of succinic acid, the succinate dehydrogenase subunit 5 gene (SDH5, whose nucleotide sequence is shown in SEQ ID NO:6) was knocked out using CRISPR / Cas9 technology. The knockout strategy was as follows: a targeting fragment containing upstream and downstream homologous arms of SDH5 and selection markers was constructed, and positive clones were screened after transformation. The knockout was verified by PCR and sequencing. The resulting engineered strain GS115-SH was thus obtained.
[0024] 4) Adaptation and domestication of acid-tolerant Pichia pastoris
[0025] S1 Basic Culture: The succinic acid-producing Pichia pastoris strain GS115-SH was inoculated into a liquid medium with glucose as the carbon source and cultured to the logarithmic growth phase to obtain the seed culture.
[0026] S2 Low pH gradient stress acclimatization: The pH of the culture medium was adjusted using hydrochloric acid to construct an acidic stress environment, and the initial stress pH was set to 3.8. The seed culture from step S1 was inoculated into the culture medium with the initial stress pH and cultured. After the cell growth reached the stationary phase, it was transferred to fresh culture medium of the same pH at an inoculation rate of 2% (v / v) and passaged 3-5 times.
[0027] S3 gradient downhill: Gradually decrease the pH of the culture medium by 0.3-0.5 units each time until the pH drops to 3.0.
[0028] S4 stabilization and selection: Continue continuous subculturing at pH 3.0 until the cell growth rate is ≥0.15 h. -1 The strain remained stable for three consecutive generations. The acclimatization solution was spread on a solid plate at pH 3.0, and single clones with significant growth advantages were screened to obtain acid-resistant and high-yielding strains.
[0029] In steps S1 and S2, the pH gradient is specifically set as follows: pH 3.8 → pH 3.5 → pH 3.0.
[0030] In this invention, the engineered strain GS115-SH was used as the starting strain, glucose was used as the carbon source, hydrochloric acid was used to adjust the environmental pH, and a gradient pH downward strategy was adopted for adaptive acclimatization.
[0031] The overexpressed pyruvate carboxylase, malate dehydrogenase, fumarate enzyme, fumarate reductase, malate transporter, and knockout succinate dehydrogenase in this invention are precisely matched with acid stress adaptation in terms of structure, catalysis, transport, and metabolic phenotype, thereby achieving the coupled enhancement of succinic acid synthesis flux and acid tolerance.
[0032] Specific pH stress window: Locking in the critical pH range of 3.8 to 3.0 is the core challenge for achieving industrial-scale low-pH fermentation. Many weak organic acids (such as lactic acid pKa≈3.86 and acetic acid pKa≈4.76) are at the critical point between dissociation and non-dissociation states near pH 3.8. When the pH drops from 3.8 to 3.0, the ambient pH is lower than the pKa of most organic acids. At this point, the proportion of non-dissociated organic acids increases sharply. These non-dissociated organic acids are lipid-soluble and can penetrate the cell membrane to enter the cell, where they dissociate and release H+ in the neutral intracellular environment. + This leads to intracellular acidification, which is a point of intense physiological stress.
[0033] The advantages of hydrochloric acid as a pH adjuster: The most crucial advantage is the absence of a carbon source and interference from organic acids. If citric acid or acetic acid is used to adjust the pH, these are themselves organic carbon sources, interfering with the carbon metabolic flow of fermentation. Microorganisms may preferentially consume the added organic acid adjuster, thus altering fermentation kinetics. HCl is a strong inorganic acid, contains no carbon, and will not be consumed as an additional carbon source, ensuring that glucose is the sole carbon source. In subsequent separation and purification stages, chloride ions are generally easier to remove than sulfate or organic acid ions through simple elution or displacement. If organic acids are used for adjustment, removing these organic acids in later purification stages increases process steps and costs.
[0034] Application of acid-tolerant Pichia pastoris engineered strains in succinic acid fermentation.
[0035] Application of acid-resistant Pichia pastoris engineered strains in high-density succinic acid production.
[0036] Fermentation was carried out using a fermentation medium with glucose as the main carbon source, and no neutralizing agent was added to control the pH of the fermentation broth during the process. At the end of fermentation, the succinic acid yield in the fermentation broth was more than 1.9 times higher than that of the starting strain GS115-SH.
[0037] A method for high-density biological synthesis of succinic acid, which synthesizes succinic acid by culturing the above-mentioned recombinant Pichia pastoris, specifically includes the following steps:
[0038] Take the strain from the preservation tube and inoculate it into a YPD test tube at an inoculation rate of 1-5%, and culture it at 25-30℃ for 24 hours to obtain the seed liquid;
[0039] Inoculate the seed culture into the fermentation medium at an inoculum of 1-10% and culture at 25-30℃ and 220 rpm for 3-5 days with shaking.
[0040] The optimal culture temperature is 30℃.
[0041] The fermentation medium consisted of 40 g / L glucose, 15 g / L yeast extract, 2.14 g / L K2HPO4, 11.93 g / L KH2PO4, and 0.7 g / L MgSO4·7H2O.
[0042] The fermentation culture uses glucose as the carbon source.
[0043] More preferably, a batch feeding fermentation is adopted, with an initial carbon source concentration of 40 g / L in the fermenter. When the carbon source is about to be exhausted, intermittent feeding is carried out, and the carbon source concentration is maintained below 40 g / L after each feeding.
[0044] In the fed-batch fermentation process, no neutralizing agent is added to adjust the pH.
[0045] During the batch feeding fermentation, the fermentation temperature was 30℃, the rotation speed was 500 rpm, and the dissolved oxygen was maintained at 40%.
[0046] Beneficial effects:
[0047] Significantly improved acid tolerance: A stable group of acid-tolerant strains were obtained after domestication. The domesticated strains were able to grow normally in the harsh environment of pH 3.0, while the growth of the original strains was severely inhibited under the same conditions. In addition, the domesticated strains did not impair their acid-producing ability at the optimal pH, which the original strains could not achieve.
[0048] Significantly Increased Yield: Experimental data shows that under shake-flask fermentation conditions, the acclimatized strain achieved a succinic acid yield of 15.2 g / L, approximately 97% higher than the starting strain, while maintaining high acid production capacity without the addition of a neutralizing agent. In a 5 L fermenter with continuous feeding fermentation and no pH adjustment, using glucose as the carbon source, a succinic acid yield of 34.4 g / L was achieved in 48 hours, laying the foundation for further industrial-scale production.
[0049] Process simplification: The application of this strain allows the fermentation process to be carried out at a lower pH, significantly reducing the use of neutralizing agents and simplifying subsequent extraction steps such as acidification and crystallization. Attached Figure Description
[0050] Figure 1 : Schematic diagram of the adaptation process (pH 3.8 -> 3.0).
[0051] Figure 2 Growth curves of strains at different pH stages during domestication.
[0052] Figure 3 HPLC analysis chromatograms of succinic acid standard sample and fermentation supernatant
[0053] Figure 4Succinic acid production and growth of domesticated strain SHT under different initial glucose concentrations.
[0054] Figure 5 Comparison of succinic acid production between the starting strain GS115-SH and the domesticated strain SHT under different pH control conditions.
[0055] Figure 6 : Production of succinic acid by engineered strain SHT in a 5 L bioreactor using glucose as the carbon source. Detailed Implementation
[0056] Example 1: Construction of Pichia pastoris strain GS115-SH producing succinic acid
[0057] Target gene amplification and expression cassette construction
[0058] (I) Preparation of target gene
[0059] Based on the coding gene sequences of malate dehydrogenase (ScMdh) and fumarate reductase (ScFrd) from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequences are shown in SEQ ID No:1-2.
[0060] The pyruvate carboxylase gene (RoPyc) from *Rhizopus oryzae* was synthesized by GenScript Biotech Co., Ltd., and its codons were optimized. The gene sequence is shown in SEQ ID No: 3. The malate transport protein gene (SpMae) from *Schizosaccharomyces cerevisiae* was synthesized by GenScript Biotech Co., Ltd., and its codons were optimized. The gene sequence is shown in SEQ ID No: 4. The fumarate enzyme gene (PkFum) from *Klebsiella pneumoniae* was synthesized by GenScript Biotech Co., Ltd., and its codons were optimized. The gene sequence is shown in SEQ ID No: 5.
[0061] (II) Construction and transformation of recombinant plasmids
[0062] 1. Using BB1-23 (Plasmid #98496) as the vector plasmid, each gene fragment was inserted into plasmid BB1-23 using the Golden Gate method, resulting in recombinant plasmids BB1-23-ScMdh, BB1-23-ScFrd, BB1-23-ScMdh, BB1-23-RoPyc, and BB1-23-PkFum, as detailed below:
[0063] Using Mdh-F and Mdh-R as primers and the Saccharomyces cerevisiae genome as a template, the Mdh fragment was amplified. The primer sequences are shown in Table 6.
[0064] Using Frd-F and Frd-R as primers and the Saccharomyces cerevisiae genome as a template, the Frd fragment was amplified. The primer sequences are shown in Table 6.
[0065] Using Pyc-F and Pyc-R as primers and the synthesized gene sequence as a template, the Pyc fragment was amplified. The primer sequences are shown in Table 6.
[0066] Using Mae-F and Mae-R as primers and the synthesized gene sequence as a template, the Mae fragment was amplified. The primer sequences are shown in Table 6.
[0067] Using Fum-F and Fum-R as primers and the synthesized gene sequence as a template, the Fum fragment was amplified. The primer sequences are shown in Table 6.
[0068] The amplified Fum, Pyc, Mdh, Frd, and Mae fragments were recovered and purified by agarose gel electrophoresis.
[0069] Golden Gate assembly was performed using Bsa1 enzyme and T4 ligase from Shanghai Beyotime Biotechnology Co., Ltd., and the reaction system is shown in Table 1.
[0070] Table 1
[0071] system 10 µL BB1-23 1 µL Fum / Pyc / Mdh / Frd / Mae 1 µL Bsa1 0.5µL BSA 1 µL T4 ligase 0.5µL T4buffer 1 µL distilled water 5 µL
[0072] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. Positive recombinant plasmids BB1-23-Mdh, BB1-23-Frd, BB1-23-Mdh, BB1-23-Pyc, and BB1-23-Fum were obtained by screening for kanamycin sulfate resistance on plates and verifying by colony PCR and sequencing.
[0073] 2. Construct representation boxes for Fum, Pyc, Mdh, Frd, and Mae.
[0074] Plasmids BB1-23-Mdh, BB1-12-pADH2, and BB1-34-RPS2tt were inserted into plasmid BB2-AB using the Golden Gate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-AB-pADH2-Mdh-RPS2tt.
[0075] Plasmids BB1-23-Pyc, BB1-12-pGAP, and BB1-34-RPP1Btt were inserted into plasmid BB2-BC using the Golden Gate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-BC-pGAP-Pyc-RPP1Btt.
[0076] Plasmids BB1-23-Mae, BB1-12-pPDC1, and BB1-34-CYC1tt were inserted into plasmid BB2-CD using the Golden Gate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-CD-pPDC1-Mae-CYC1tt.
[0077] Plasmid BB1-23-Frd, along with plasmid BB1-12-pGPM1 and plasmid BB1-34-IDP1tt, were inserted into plasmid BB2-DE using the Golden Gate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-DE-pGPM1-Frd-IDP1tt.
[0078] Plasmids BB1-23-Fum, BB1-12-pFBA1, and BB1-34-IDH3tt were inserted into plasmid BB2-EF using the Golden Gate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-EF-pFBA1-Fum-IDH3tt.
[0079] The construction process of the recombinant plasmid BB2-AB-pADH2-Mdh-RPS2tt is as follows:
[0080] Golden Gate assembly was performed using Bpi1 enzyme and T4 ligase from Nanjing Fomax Biotechnology Co., Ltd., and the reaction system is shown in Table 2.
[0081] Table 2
[0082] system 10µL BB2-AB 1 µL BB1-12-pADH2 1 µL BB1-23- Mdh 1 µL BB1-34-RPS2tt 1 µL Bpi1 0.5µL BSA 1 µL T4 ligase 0.5µL T4buffer 1 µL distilled water 3 µL
[0083] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-AB-pADH2-Mdh-RPS2tt was obtained by screening for ampicillin resistance plates and verifying by colony PCR and sequencing.
[0084] The construction process of recombinant plasmid BB2-BC-pGAP-Pyc-RPP1Btt is as follows:
[0085] The reaction system is basically the same as in Table 2, except that the plasmids are changed to BB2-BC, BB1-12-pGAP, BB1-23-Pyc and BB1-34-RPP1Btt.
[0086] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-BC-pGAP-Pyc-RPP1Btt was obtained by screening for ampicillin resistance on plates and verifying by colony PCR and sequencing.
[0087] The construction process of recombinant plasmid BB2-CD-pPDC1-Mae-CYC1tt is as follows:
[0088] The reaction system is basically the same as in Table 2, except that the plasmids are changed to BB2-CD, BB1-12-pPDC1, BB1-23-Mae and BB1-34-CYC1tt.
[0089] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-CD-pPDC1-Mae-CYC1tt was obtained by screening for ampicillin resistance plates and verifying by colony PCR and sequencing.
[0090] The construction process of recombinant plasmid BB2-DE-pGPM1-Frd-IDP1tt is as follows:
[0091] The reaction system is basically the same as in Table 2, except that the plasmids are changed to BB2-DE, BB1-12-PGPM1, BB1-23-Frd and BB1-34-IDP1tt.
[0092] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-DE-pGPM1-Frd-IDP1tt was obtained by screening for ampicillin resistance plates and verifying by colony PCR and sequencing.
[0093] The construction process of the recombinant plasmid BB2-EF-pFBA1-Fum-IDH3tt is as follows:
[0094] The system is basically the same as in Table 2, except that the plasmids are changed to BB2-EF, BB1-12-pFBA1, BB1-23-Fum and BB1-34-IDH3tt.
[0095] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-EF-pFBA1-Fum-IDH3tt was obtained by screening for ampicillin resistance plates and verifying by colony PCR and sequencing.
[0096] 3. Using BB3aK-AF (Plasmid#98533) as the vector, construct co-expression recombinant plasmids for Fum, Pyc, Mdh, Frd, and Mae:
[0097] The plasmids BB2-AB-pADH2-Mdh-RPS2tt, BB2-BC-pGAP-Pyc-RPP1Btt, BB2-CD-pPDC1-Mae-CYC1tt, BB2-DE-pGPM1-Frd-IDP1tt, and BB2-EF-pFBA1-Fum-IDH3tt were inserted into plasmid BB3aK-AF using the Golden Gate method with Bsa1 enzyme and T4 ligase to obtain the recombinant plasmid BB3aK-AF-Mdh-Pyc-Mae-Frd-Fum.
[0098] The structures of recombinant plasmids BB3aK-AF-Mdh, Pyc, Mae, Frd, and Fum are shown in the figure. Figure 1 The specific construction process is as follows:
[0099] Golden Gate assembly was performed using Bsa1 enzyme and T4 ligase, and the reaction system is shown in Table 3.
[0100] Table 3
[0101] system 10µL BB3aK-AF 1 µL BB2-AB-pADH2-Mdh-RPS2tt 1 µL BB2-BC-pGAP-Pyc-RPP1Btt 1 µL BB2-CD- pPDC1-Mae-CYC1tt 1 µL BB2-DE-pGPM1-Frd-IDP1tt 1 µL BB2-EF-pFBA1- Fum -IDH3tt 1 µL Bsa1 0.5µL BSA 1 µL T4 ligase 0.5µL T4buffer 1 µL <![CDATA[ddH2O]]> 1 µL
[0102] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells, and the positive recombinant plasmid BB3aK-AF-Mdh-Pyc-Mae-Frd-Fum was obtained by screening with G418 resistant plates and verifying by colony PCR and sequencing.
[0103] (ii) Knockout of the sdh5 gene
[0104] To prevent succinic acid from being further metabolized into fumarate and to block the consumption of succinic acid in the TCA cycle, the succinate dehydrogenase subunit 5 gene (sdh5) was knocked out using CRISPR / Cas9 technology. sgRNA targeting the sdh5 gene was designed, and a CRISPR / Cas9 targeting plasmid was constructed. Simultaneously, donor DNA containing upstream and downstream homologous arms of sdh5 and selection markers was constructed. Both were co-transformed into GS115 competent cells, and the transformation medium was plated on YPD plates containing bleomycin and cultured at 30°C. Positive clones with successfully knocked-out SDH5 gene were obtained, which became the engineered strain GS115-SH.
[0105] 1. sgRNA design
[0106] The nucleotide sequence of the *Pichia pastoris* sdh5 gene is shown in SEQ ID NO:6. The coding region of the sgRNA target was designed, and primers gSdhN20-F and gSdhN20-R were designed. The sgRNA expression cassette was cloned into a vector carrying Cas9.
[0107] 2. Construction of CRISPR / Cas9 expression plasmids
[0108] An sgRNA expression cassette was constructed using the pPICZ-Cas9 plasmid (containing a Cas9 expression cassette and a Zeocin resistance marker) as a backbone. Using the pPICZ-Cas9 plasmid as a template, PCR amplification was performed using gSdhN20-F and gSdhN20-R primers to obtain the pPICZ-Cas9-Zeocin linear plasmid. After purification of the PCR product, the plasmid was fused using overlap extension PCR.
[0109] (1) Primer design is as follows
[0110] Primer name: gSdhN20-F
[0111] Sequence (5'-3'): GACCCGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCTGGGCCGTGAAAAACTACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT
[0112] Primer name: gSdhN20-R
[0113] Sequence (5'-3'): GTTTCGTCTCACGGACTCATCAGCGGGTCTTTGATTTGTTTAGGTAACTTGAACTGGATGTATTAGTTTGG
[0114] (2) The amplification system (50 μL) is shown in Table 4.
[0115] Table 4
[0116] Components volume 2× Phanta Mix Buffer 25μL dNTP Mix 1μL upstream primer 1μL Downstream primer 1μL Template DNA (pPICZ-Cas9) 1μL Phanta Max Super-Fidelity DNA Polymerase 1μL <![CDATA[ddH2O]]> Add to 50 μL
[0117] (3) PCR amplification conditions are shown in Table 5.
[0118] Table 5
[0119] step temperature time Cycle number Pre-variation 95℃ 3 min 1 transsexual 95℃ 15 sec 30 annealing 56℃ 15 sec 30 extend 72℃ 8 min 30 Final extension 72℃ 10 min 1
[0120] 3. Donor DNA Construction
[0121] Donor DNA fragments containing upstream and downstream homologous arms (500 bp each) of sdh5 were constructed and named sdh5-up and sdh5-down for homologous recombination repair. (Sequences are shown in SEQ ID No. 7 and SEQ ID No. 8)
[0122] 4. Co-conversion and screening
[0123] CRISPR / Cas9 plasmid and donor DNA were co-transformed into GS115 competent cells, plated on YPD plates containing bleomycin, and cultured at 30°C for 2-3 days. Transformants were picked, genomic DNA was extracted, and bands of the expected size were amplified by positive clones. Further sequencing confirmed that the sdh5 gene was successfully knocked out.
[0124] 5. Obtaining integrative expression strains
[0125] The validated BB3aK-AF-Mdh-Pyc-Mae-Frd-Fum plasmid was linearized with the restriction endonuclease AscI and integrated into the genome of the sdh5 knockout strain via electroporation. Selection was performed using YPD selection plates supplemented with G418, and single colonies grew after incubation at 30°C for 2–3 days. The resulting engineered Pichia pastoris strain producing succinic acid was named GS115-SH.
[0126] Table 6 Primer sequences
[0127] Primer name Sequence (5'-3') Mdh -F cacaggtctcccatggtcaaagtcgcaattcttgg Mdh -R gatcggtctccaagctcatagcttggaagagtctaggatga Pyc -F cacaggtctcATGCCCGCGGCACCTGTT Pyc -R gatcggtctcTCAGGCTTCCTCCTTTACAACC Mae -F cacaggtctcccATGGGTGAACTTAAGGAAATCCTTA Mae -R gatcggtctccaagcTCAAACTGATTCATGCTCGCTG Frd -F cacaggtctcccatgtctctctctcccgttgttgtt Frd -R gatcggtctccaagctCacttgcggtcattggcaa Fum -F cacaggtctcccATGCTAGCAGCGCGTTCTTT Fum -R gatcggtctccaagcTCAATCCTTTGGGCCGATC
[0128] Example 2: Gradual domestication of acid-tolerant Pichia pastoris
[0129] Starting strain: A Pichia pastoris engineered strain with a succinic acid synthesis pathway was selected and named GS115-SH.
[0130] The method is as follows: (1) Take out the GS115-SH bacterial culture stored at -80℃ and thaw it, inoculate it on YPD solid plate (20g / L glucose, 20g / L peptone, 10g / L yeast powder, 20g / L agar, pH natural), and culture at 30℃ to isolate single colonies; (2) Pick single colonies and inoculate them into YPD seed culture medium, and culture at 30℃ and 180r / min for 72h to obtain seed liquid, and inoculate the seed liquid into fermentation medium to prepare succinic acid.
[0131] The seed culture medium consisted of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.
[0132] The fermentation medium used in the acclimatization process was: 40 g / L glucose, 15 g / L yeast extract, 2.14 g / L K2HPO4, 11.93 g / L KH2PO4, 0.7 g / L MgSO4·7H2O, with the pH adjusted to the target value using 3M hydrochloric acid.
[0133] Domestication process:
[0134] Phase 1 (pH 3.8): GS115-SH was inoculated into medium at pH 3.8 and cultured at 30°C and 180 rpm. Subcultured every 72 hours, for a total of 4 passages, until OD (Organic Discharge) was reached. 600 Stablize.
[0135] Phase Two (pH 3.5): The bacterial culture from the previous phase was transferred to pH 3.5 medium, and the passage process was repeated. An initial decrease in growth rate was observed, which recovered after approximately 10 generations.
[0136] Phase 3 (pH 3.0): Finally, high-intensity acclimatization is carried out under pH 3.0 conditions. At this time, the cell adaptation period is significantly extended. After 30 days of continuous subculturing, a stable population is obtained.
[0137] Screening: Diluted and spread on pH 3.0 plates, select fast-growing single clones to verify their acid tolerance and succinic acid yield. All clones showed high acid tolerance and succinic acid yield. One clone was randomly selected and named SHT.
[0138] During the acclimatization and cultivation of the strain, samples are taken at regular intervals to detect the growth status of the strain, i.e., OD. 600 The colorimetric method was used. 1 mL of fermentation broth was placed in a 1.5 mL centrifuge tube, diluted appropriately, and the absorbance was measured at 600 nm using a UV spectrophotometer with a 0.5 cm path length cuvette. The absorbance was then multiplied by the corresponding dilution factor to obtain the yeast OD. 600 OD during domestication 600 As shown in Figure 2.
[0139] Example 3: Tolerance and acid production at different initial sugar concentrations
[0140] To further evaluate the tolerance and acid production capacity of the domesticated strain SHT under different carbon source concentrations, this example sets different initial glucose concentrations (20 g / L, 40 g / L, 60 g / L, 80 g / L, 100 g / L) and examines their effects on strain growth and succinic acid synthesis at the shake flask level.
[0141] Experimental methods:
[0142] Seed culture preparation: The domesticated strain SHT was inoculated into YPD seed culture medium and cultured at 30℃ and 180 rpm for 18 h to obtain seed culture.
[0143] Fermentation medium: The composition of the basic medium is the same as in Example 1, with the initial glucose concentration adjusted to 20 g / L, 40 g / L, 60 g / L, 80 g / L, and 100 g / L respectively.
[0144] Fermentation conditions: The seed culture was transferred to 50 mL of fermentation medium (250 mL shake flask) at an inoculation rate of 2% (v / v), and cultured at 30℃ and 180 rpm for 6 days with shaking. The pH was not adjusted during the fermentation process.
[0145] Detection index: OD measured after fermentation. 600 To reflect the growth of the microorganisms, the concentration of succinic acid in the fermentation supernatant was determined by HPLC.
[0146] Experimental results:
[0147] like Figure 4 As shown, the domesticated strain SHT grew well and accumulated succinic acid under initial glucose concentrations of 40 g / L, 60 g / L, and 80 g / L. The highest succinic acid yield was observed at an initial sugar concentration of 40 g / L. While growth was slightly delayed at an initial sugar concentration of 80 g / L, the acid production capacity remained significantly higher than that of the starting strain. These results indicate that the domesticated strain SHT possesses good high-sugar tolerance and acid production stability, making it suitable for industrial fermentation scenarios with varying feedstock concentrations.
[0148] Example 4: Validation of the fermentation performance of the domesticated strain
[0149] Experimental groups: Experimental group (fermentation comparison of the starting strain GS115-SH and the domesticated strain SHT under uncontrolled pH conditions); Control group (fermentation comparison of the starting strain GS115-SH and the domesticated strain SHT under pH controlled at 6.5 conditions).
[0150] Fermentation conditions: 250mL shake flask, liquid volume 50mL, initial glucose concentration 40g / L.
[0151] Stress settings: The experimental group did not adjust the pH during fermentation to simulate low pH fermentation, while the control group used 3M HCl and 4M NaOH to control the pH at 6.5.
[0152] Results: OD was measured after 6 days of fermentation. 600 And succinic acid production.
[0153] Specific experimental steps:
[0154] (1) First, the engineered control strain GS115-SH and the domesticated strain SHT were inoculated into the seed culture medium and cultured at 30℃ and 180rpm for 18h to prepare the seed liquid.
[0155] The seed culture medium is YPD: 10 g / L yeast extract, 20 g / L glucose, and 20 g / L peptone;
[0156] (2) The seed culture obtained in step (1) was transferred to the fermentation medium at an inoculation rate of 2% (v / v). The inoculation was placed in a 250 mL shake flask with a volume of 50 mL. Three parallel inoculations were set up. The fermentation conditions were: 30℃ and 180 rpm for 6 days, with no pH adjustment during fermentation. The fermentation medium consisted of: 40 g / L glucose, 15 g / L yeast extract, 2.14 g / L K₂HPO₄, 11.93 g / L KH₂PO₄, and 0.7 g / L MgSO₄·7H₂O.
[0157] (3) In addition to verifying the acid tolerance of the domesticated strain SHT, another set of control experiments was set up to verify the succinic acid production capacity of the domesticated strain SHT. The control strain and the domesticated strain were transferred to the fermentation medium according to the method in step (2) and the pH was adjusted to the optimal growth pH of 6.5.
[0158] Indicator Testing:
[0159] Growth status: GS115-SH strain OD 600 Only 22.9, indicating a relatively high glucose residue; SHT strain OD 600 When the blood glucose level reaches 28.3, the glucose has been basically consumed.
[0160] Acid production: After fermentation, the succinic acid yield in the fermentation supernatant was determined by high-performance liquid chromatography (HPLC). 1-2 mL of fermentation broth was centrifuged at 12000 rpm for 5 min, and the supernatant was collected. The concentration of extracellular succinic acid was detected by HPLC. The detection conditions were: organic acid detection column, mobile phase: 0.25 mM dilute sulfuric acid, column temperature: 55℃, flow rate: 0.5 mL / min, UV detector: wavelength: 215 nm. The HPLC detection results of succinic acid in the fermentation broth are shown in Figure 5.
[0161] The above experiments were repeated three times, and the results showed a consistent trend, indicating that the domesticated strains possess stable acid tolerance and acid production capacity. The results showed that, under conditions where no neutralizing agent was added to adjust the pH, the succinic acid yields of the starting strains GS115-SH and SHT were 7.7 g / L and 15.2 g / L, respectively, an increase of approximately 97.4%. Under optimized conditions of pH 6.5, the succinic acid yields of the engineered strains GS115-SH and SHT were 10.2 g / L and 14.6 g / L, respectively. This indicates that the acid tolerance advantage brought about by domestication is particularly significant under low pH conditions, while at the optimal pH, domestication did not impair their acid production potential.
[0162] Example 6: High-density fermentation production of succinic acid using domesticated strain SHT
[0163] ① Seed culture:
[0164] a. Primary seed culture: Take 1% of the recombinant strain SHT bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 180 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.
[0165] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.
[0166] ② Batch feeding fermentation
[0167] The seed culture obtained from the seed culture was inoculated into a 5 L fermenter containing fermentation medium. The recombinant strain SHT underwent fed-batch fermentation in the 5 L fermenter at a fermentation temperature of 30℃, 500 rpm, and dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was about to be depleted, intermittent feeding was performed, and the carbon source concentration was maintained below 40 g / L after each feeding. Samples were taken every 12 h, centrifuged, and the supernatant was collected. After 48 h, the bacterial OD600 reached 46, and the succinic acid yield reached 34.4 g / L (Figure 6), with a production rate of 0.72 g / L / h.
[0168] In a 5L feed-batch fermentation tank, the pH of the acclimatized strain SHT naturally decreased from an initial 5.5 to 3.2 after 24 hours, and stabilized at 3.0 ± 0.1 after 48 hours. In contrast, the starting strain GS115-SH, under the same conditions, showed growth stagnation after 24 hours, ultimately producing only 12.5 g / L of succinic acid. This indicates that SHT maintains good acid tolerance and acid production capacity in large-scale fermentation.
[0169] The above embodiments demonstrate that this domestication strategy successfully constructed a functional strain that can tolerate acidic stress and efficiently produce succinic acid under acidic conditions. Its stable metabolic characteristics and high acid-producing capacity provide a novel chassis cell with application potential for industrial-grade succinic acid production systems. This invention enables the efficient production of the organic acid succinic acid without the need for neutralizing agents or other alkaline solutions.
Claims
1. An acid-resistant engineered strain of Pichia pastoris, characterized in that, The strain was obtained by overexpressing the pyruvate carboxylase gene, malate dehydrogenase gene, fumarate gene, fumarate reductase gene, and malate transport protein gene, and knocking out the succinate dehydrogenase gene, followed by acid tolerance domestication.
2. The acid-resistant Pichia pastoris engineered strain according to claim 1, characterized in that, The malate dehydrogenase gene is ScMdh from Saccharomyces cerevisiae, and its sequence is shown in SEQ ID NO:1; the fumarate reductase gene is ScFrd from Saccharomyces cerevisiae, and its sequence is shown in SEQ ID NO:2; the pyruvate carboxylase gene is RoPyc from Rhizopus oryzae, and its sequence is shown in SEQ ID NO:3; the malate transporter gene is SpMae from Schizosoma spp., and its sequence is shown in SEQ ID NO:4; the fumarate enzyme gene is PkFum from Klebsiella pneumoniae, and its sequence is shown in SEQ ID NO:5; the succinate dehydrogenase gene is SDH5, and its nucleotide sequence is shown in SEQ ID NO:
6.
3. The acid-resistant Pichia pastoris engineered strain according to claim 1, characterized in that, The acid tolerance acclimatization process involves: using hydrochloric acid to adjust the pH of the culture medium to create an acidic stress environment, setting the initial stress pH to 3.8, gradually reducing the pH of the culture medium by 0.3-0.5 units each time, until the pH drops to 3.
0. After multiple acclimatization processes, acid-tolerant and high-yielding strains with significant growth advantages are screened out.
4. The method for constructing an acid-resistant Pichia pastoris engineered strain according to claim 1, characterized in that, The pyruvate carboxylase gene, fumarate reductase gene, malate transport protein gene, malate dehydrogenase gene, and fumarate enzyme gene were respectively ligated into the BB3aK_AF vector plasmid to construct the RoPyc, ScFrd, Spmae, ScMdh, and PkFum co-expression recombinant plasmid. Each expression cassette was sequentially integrated into the genome of Pichia pastoris GS115 by electroporation. Transformants were screened with G418 antibiotic. The succinate dehydrogenase subunit 5 gene was knocked out using CRISPR / Cas9 technology. A targeting fragment containing upstream and downstream homologous arms of SDH5 and selection markers was constructed. Positive clones were screened after transformation, and the knockout was verified by PCR and sequencing.
5. The application of the acid-tolerant Pichia pastoris engineered strain as described in claim 1 in succinic acid fermentation.
6. The application according to claim 5, characterized in that, Includes the following steps: 1) Take the strain from the preservation tube and inoculate it into a YPD test tube at an inoculum of 1-5% and culture it at 25-30℃ for 24 hours to obtain the seed liquid; 2) Inoculate the seed culture into the fermentation medium at an inoculation rate of 1-10%, and culture at 25-30℃ and 220 rpm for 3-5 days with shaking.
7. The application according to claim 6, characterized in that, The fermentation medium consisted of 40 g / L glucose, 15 g / L yeast extract, 2.14 g / L K2HPO4, 11.93 g / L KH2PO4, and 0.7 g / L MgSO4·7H2O.
8. The application according to claim 6, characterized in that, Fermentation was carried out in batches. The initial carbon source concentration in the fermenter was 40 g / L. When the carbon source was about to be exhausted, intermittent feeding was carried out. After each feeding, the carbon source concentration was kept below 40 g / L.