Recombinant yeast engineering bacteria for producing levoborneol

By constructing a codon-optimized BbTPS3 yeast strain containing arugula monoterpene synthase, and combining protein modification with flexible linker peptide fusion protein, the biosynthetic pathway of levorotatory borneol was optimized, solving the problem of low levorotatory borneol yield and achieving high-efficiency production.

CN115232756BActive Publication Date: 2026-07-14SICHUAN HONGHE BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202110445318.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-04-23
Publication Date
2026-07-14
Estimated Expiration
2041-04-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the efficient production of L-borneol. Plant sources are limited and extraction rates are low. Synthetic borneol contains toxic components. Biosynthetic pathways need to be optimized to increase yield.

Method used

A yeast strain containing codon-optimized arugula monoterpene synthase BbTPS3 was constructed. Through protein modification and optimization of fusion proteins with flexible linker peptides, the supply of GPP precursor substances was enhanced, thereby increasing the yield of L-borneol.

Benefits of technology

The efficient biosynthesis of levorotatory borneol was achieved, with a significant increase in yield, reaching over 12.19 mg·L⁻¹, solving the problems of limited plant sources and the toxicity of synthetic borneol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115232756B_ABST
    Figure CN115232756B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant bacterium and a use thereof, the recombinant bacterium is a yeast containing or expressing aai-na-xiang monoterpene synthase BbTPS3 or an ai-na-xiang monoterpene synthase BbTPS3 fusion protein in vivo, and is used for producing levorotatory borneol; experiments prove that the recombinant bacterium after modification (such as codon optimization, protein truncation, Kozak increase or protein fusion) can improve the yield of levorotatory borneol, and is suitable for industrialized production of levorotatory borneol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and fermentation engineering, specifically to a genetically engineered bacterium for producing natural borneol, its construction method, and its application. Background Technology

[0002] Borneol, also known as camphor, is a bicyclic monoterpenoid compound. Based on optical rotation, it is classified into dextrorotatory (D-borne) and levorotatory (L-borne) borneol. Dextrorotatory borneol, also known as natural borneol, is primarily derived from plants such as *Cinnamomum camphora* (L.) presl. and *Cinnamomum burmanni* (Nees et T. Nees) Blume. Levorotatory borneol, also known as artemisia, is mainly derived from *Blumea blasamifera* (L.) DC., a plant in the Asteraceae family. Borneol is also found in lavender, frankincense, pine, fir, citronella oil, and frankincense.

[0003] Borneol is a precious traditional Chinese medicine and high-grade spice, widely used in medicine, food, daily chemicals, pesticides, and other fields. Currently, most pharmaceutical companies and drug manufacturers tend to use inexpensive and readily available synthetic borneol as a raw material and in their finished drug formulations. However, synthetic borneol contains toxic isoborneol in addition to borneol. Regarding the plant source of borneol, researchers have used plant extraction methods, but the low content of natural compounds in plants, low extraction rates, long plant growth cycles, and limited planting areas restrict the acquisition of natural borneol. Utilizing synthetic biology strategies to produce borneol and other monoterpenoid compounds and their derivatives is a feasible approach. Studies have found that the biosynthesis of monoterpenoids all originates from a common precursor, geranyl diphosphate (GPP). In plants, acetyl-CoA is converted into isopentenyl diphosphate (IPP) and its isomer, dimethylallyl diphosphate (DMAPP), via the mevalonate (MVA) and 2-C-methyl-D-erythritol-4-phosphate (MEP) pathways. Under the catalysis of geranyl diphosphate monoterpene synthase, IPP and DMAPP condense to form GPP, which is then converted into a wide variety of monoterpenoids by the action of monoterpene synthase (O'BRIEN TE, BERTOLANI SJ, ZHANG Y, et al. Predicting Productive Binding Modes for Substrates and Carbocation Intermediates in Terpene Synthases-Bornyl Diphosphate Synthase as a Representative Case[J].ACS). Catal, 2018, 8:3322.). Zhang Chao et al. (CN110669713A) disclosed a yeast engineered strain that produces high levels of monoterpenoids and reconstructed the limonene synthase biosynthetic pathway in Saccharomyces cerevisiae, enabling heterologous synthesis of D-limonene with a yield of 27.3 mg / L. Zhou Pingping et al. (CN111411101A) constructed a linalool biosynthetic pathway using the cis-linalool synthase t67OMcLIS, by overexpressing the entire MVA pathway and introducing an ERG20 enzyme that reduces FPP formation. F96W / N127W The variant enhanced the supply of precursor GPP, and the final strain produced 53.14 mg / L linalool culture in shake flasks. This demonstrates that the construction of monoterpene engineered bacteria can increase monoterpene production; however, engineered bacteria related to borneol have not yet been reported. Summary of the Invention

[0004] One aspect of this invention is to provide a yeast engineered strain (recombinant strain) for producing L-borneol, wherein the recombinant strain is a yeast strain containing or expressing the bromelablasamifera monoterpene synthase BbTPS3. The bromelablasamifera monoterpene synthase BbTPS3 described in this invention has been disclosed in the applicant's prior patent (CN201910775971.6), which is derived from bromelablasamifera (L.) DC. and can be used to synthesize or prepare L-borneol monoterpene synthases. The entire contents of that patent are incorporated herein by reference and form part of this application.

[0005] On the other hand, the yeast contains the codon-optimized *Saccharomyces cerevisiae* monoterpene synthase BbTPS3 gene. This invention is improved based on the codon preference of *Saccharomyces cerevisiae*. The improved method is a conventional technique in the art, for example, artificial synthesis based on the sequences of related genes known in the art and referring to the codon preference of *Saccharomyces cerevisiae* (the design of *Saccharomyces cerevisiae* codon preference can be found at http: / / www.kazusa.or.jp / codon / cgi-bin / showcodon.cgi?species=493). Any gene designed based on the codon preference of *Saccharomyces cerevisiae* can be used in this invention.

[0006] Preferably, the codon-optimized BbTPS3-encoded nucleic acid of the present invention is shown in SEQ ID NO:1.

[0007] On the other hand, this invention also includes protein modification of the key enzyme BbTPS3. The N-terminal amino acids of BbTPS3 were truncated to form three truncated proteins (hereinafter referred to as t14-BbTPS3, t18-BbTPS3, and t38-BbTPS3). It was found that the yield of L-carnitine was significantly increased in the t14-BbTPS3 and t18-BbTPS3 truncated proteins. The encoding nucleic acids of t14-BbTPS3, t18-BbTPS3, and t38-BbTPS3 described in this invention are shown in SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0008] On the other hand, adding a universal Kozak sequence (SEQ ID NO:5) before the start codon ATG of the truncated protein yielded three new truncated versions (hereinafter referred to as t14-BbTPS3K, t18-BbTPS3K, and t38-BbTPS3K), but this did not increase the yield of levorotatory borneol. Subsequently, a yeast-specific Kozak sequence (SEQ ID NO:6) was tried, resulting in one new truncated version (hereinafter referred to as t14-BbTPS3K2), which further increased the yield of dextrorotatory borneol.

[0009] On the other hand, based on the above experiments, this invention investigates the effect of flexible linker peptides on yield, selecting five flexible linker peptides for investigation: “GGGS”, “GSG”, “YRSQI”, “VIPFIS”, and “WRFSPKLQ”, and constructing ERG20. F96W-N127W (Also known as ERG20WW, sequence number SEQ ID NO:7) followed by BbTPS3-14, these are fusion proteins (hereinafter referred to as ERG20WW-GGGS-t14-BbTPS3K2 (SEQ ID NO:8), ERG20WW-GSG-t14-BbTPS3K2 (SEQ ID NO:9), ERG20WW-YRSQI-t14-BbTPS3K2 (SEQ ID NO:10), ERG20WW-VIPFIS-t14-BbTPS3K2 (SEQ ID NO:11), ERG20WW-WRFSPKLQ-t14-BbTPS3K2 (SEQ ID NO:12), ERG20 F96W , N127W -GGGS-t14-BbTPS3K2-2 (SEQ ID NO:13); or construct a fusion protein with ERG20WW at the end and BbTPS3-14 at the beginning (hereinafter referred to as t14-BbTPS3K2-GGGS-ERG20). F96W,N127W The fusion protein of -2 (SEQ ID NO:14) further enhances the production of L-carnitine.

[0010] In some embodiments, the present invention describes the in vivo presence or expression of *Artemisia monoterpene synthase* or *Artemisia monoterpene synthase BbTPS3* fusion protein by introducing the encoding nucleic acid of the *Artemisia monoterpene synthase* or the encoding nucleic acid of the *Artemisia monoterpene synthase BbTPS3* fusion protein into the yeast; and / or, the introduction of the encoding nucleic acid of the *Artemisia monoterpene synthase* into the yeast by introducing an expression cassette containing the encoding nucleic acid of the *Artemisia monoterpene synthase* into the yeast; the introduction of the encoding nucleic acid of the *Artemisia monoterpene synthase* fusion protein into the yeast by introducing an expression cassette containing the encoding nucleic acid of the *Artemisia monoterpene synthase* fusion protein into the yeast; and / or, the expression cassette containing the encoding nucleic acid of the *Artemisia monoterpene synthase* is introduced into the yeast via a vector expressing the encoding nucleic acid of the *Artemisia monoterpene synthase* expression cassette; preferably, it is introduced into the yeast in plasmid form.

[0011] In some embodiments, the present invention improves the supply of precursor GPP (hereinafter referred to as M / D) by optimizing the substrate bacteria. For example, the yeast strains described in this invention contain endogenous genes related to the yeast mevalonate pathway, such as the acetyl-CoA transferase gene ERG10, the HMG-CoA synthase gene ERG13, the HMG-CoA reductase gene tHMG1, the mevalonate phosphate kinase gene ERG8, the mevalonate pyrophosphate decarboxylase gene ERG19, the farnesyl pyrophosphate synthase gene ERG20, the mevalonate kinase gene ERG12, and the isopentenyl pyrophosphate isomerase gene IDI1. In some preferred embodiments, the ERG20 used in this invention is a mutant ERG20. F96W / N127W .

[0012] In some embodiments, the yeast of the present invention is Saccharomyces cerevisiae; and / or the Saccharomyces cerevisiae is CEN.PK2-1D with genotypes MATα, URA3-52, TRP1-289, LEU2-3112, HIS3Δ1, MAL2-8C, SUC2.

[0013] A fifth aspect of the present invention provides a method for producing levorotatory borneol, the method comprising:

[0014] The recombinant yeast strain for producing L-carnitine is inoculated into a culture medium and fermented. The fermented bacterial broth is extracted and separated to obtain the target product, L-carnitine. The recombinant yeast strain can ferment to produce GPP. Attached Figure Description

[0015] Figure 1 A schematic diagram of the biosynthetic pathways of GPP and L-borneol in Saccharomyces cerevisiae;

[0016] Figure 2 The graph shows the geraniol production in the modified *Bacillus subtilis* strain, where A is the growth curve of strain M / D; and B is the geraniol production of strain M / D.

[0017] Figure 3 The image shows the GC-MS qualitative detection results of levorotatory borneol, where A represents the gas chromatography detection results of levorotatory borneol; and B represents the mass spectrometry identification results of levorotatory borneol.

[0018] Figure 4 A represents the effect of different N-terminal truncation methods of arugula monoterpene synthase BbTPS3 on the yield of levorotatory borneol (MD-B3, MD-B5, and MD-B7), and the effect of different Kozak sequences on the yield of levorotatory borneol (MD-B4, MD-B6, MD-B8, and MD-B9).

[0019] Figure 4B represents the effect of fusion proteins with different linking peptides on the yield of L-carnitine. Detailed Implementation

[0020] Experimental materials

[0021] Table 1. Vector and strain information

[0022]

[0023] Table 2 Primer Information

[0024]

[0025]

[0026]

[0027] Eukaryotic plasmid construction (pESC-LEU)

[0028] BbTPS3-F' AGGAGAAAAAACCCCG ATGGTTGGTTTCCAGAAGCACTC

[0029] BbTPS3-R' GTGAGTCGTATTACGG GGTCTTTGGCTTCAACAACAAGGAG

[0030] Table 3. Primer information for protein modification

[0031]

[0032] Main reagents:

[0033] Gene JET Gel Extraction Kit (Thermo Scientific, USA); EZNATMplasmid mini kit I (Omega Bio-Tek, USA); pEASY-Uni Seamless Cloning and Assembly Kit (Beijing Quanjin Biotechnology Co., Ltd.); 2×EasyTaq PCR SuperMix(+dye) (Beijing Quanjin Biotechnology Co., Ltd.); EasyPure Genomic DNA Kit (Beijing Quanjin Biotechnology Co., Ltd.); Phusion high-fidelity Master Mix (NEB, USA); BsaI (NEB, USA); BamHI-HF (NEB, USA); T4 DNA Ligase (NEB, USA); SD-Ura yeast culture medium (Beijing Fanjinuo Technology Co., Ltd.); SD-LEU-Ura yeast culture medium (Beijing Fanjinuo Technology Co., Ltd.); Frozen-EZ Yeast Transformation II Kit TM Zymo Research, a biotechnology company;

[0034] YPD solid plates: 1% yeast extract + 2% peptone + 2% glucose + 1.5% agar; without agar, it becomes the corresponding liquid medium (YPD liquid medium);

[0035] YPL induction medium: 1% yeast extract + 2% peptone + 2% galactose;

[0036] SD-Ura solid plates: SD-Ura + 2% glucose + 2% agar; without agar, it becomes the corresponding liquid culture medium (SD-Ura liquid culture medium);

[0037] SD-Ura-LEU solid plates: SD-Ura-LEU + 2% glucose + 2% agar; without agar, it becomes the corresponding liquid culture medium (SD-Ura-LEU liquid culture medium).

[0038] Example 1: Construction of recombinant yeast chassis

[0039] Using the increase of GPP, a precursor of levorotatory borneol, as an indicator, the *Saccharomyces cerevisiae* CEN.PK2-1D strain was modified. The modification method is referenced in the following literature: (Jianga GZ, Yaoa MD, Wanga Y, et al. Manipulation of GES and ERG20 for geraniol overproduction in *Saccharomyces cerevisiae*[J]. Metabolic Engineering, 2017, 41: 57-66.)(Xiao-Jing G, Wen-Hai X, Ying W, et al. Metabolic engineering of *Saccharomyces cerevisiae* for 7-dehydrocholesterol overproduction[J]. Biotechnology for biofuels, 2018, 11(1): 192.). (Information on the recombinant yeast chassis strain of this invention is shown in Table 1.)

[0040] 1. Construction of yeast strains

[0041] The initial strain used in this study was CEN.PK2-1D from *Saccharomyces cerevisiae* (Table 1). All endogenous genes in the MVA pathway, ERG10, ERG13, tHMG1, ERG12, ERG8, ERG19, IDI1, and ERG20, were derived from the genomic DNA of CEN.PK2-1D. The ERG20 mutant used in this study was ERG20. F96W / N127WIt has been reported to have higher monoterpene production efficiency. The gene expression cassette was integrated into the yeast chromosome using the M2S integration method (Li S, Ding W, Zhang X, et al. Development of amodularized two-step (M2S) chromosome integration technique for integration of multiple transcription units in Saccharomyces cerevisiae[J]. Biotechnology for Biofuels,2016,30(1):232-243.). Simply put, ERG10 and ERG13 were amplified by adding BsaI restriction sites, and the head-to-head promoter (pGAL1-pGAL10) was ligated into the termination vector T1-(TPI1-PGI1) to generate plasmid T1-(ERG10-ERG13). Two terminators were inserted into the plasmid, and homologous arms L1 and L2 were designed in the terminators, respectively. Similarly, T2-(tHMG1-tHMG1), T3-(tHMG1-ERG12), T4-(ERG8-ERG19), and T5-(IDI1-ERG20) F96W-N127W They each have specific homologous arms L2 and L3, L3 and L4, L4 and L5, and L5 and L6, respectively.

[0042] Each expression module with a homologous arm was amplified separately. In this study, the exogenous gene was constructed at locus 15 (YPRCΔ15) in the *Saccharomyces cerevisiae* genome, using the Ura selection marker. The upstream homologous arm YPRCΔ15-UP was amplified from CEN.PK2-1D genomic DNA; the URA3 module containing the promoter was amplified from the pESC-URA vector; and L1 was amplified from the T1 vector. The three modules were assembled using overlap PCR to form the selection marker module YPRCΔ15up-ura3-L1. The downstream homologous arm YPRCΔ15DOWN was amplified from CEN.PK2-1D genomic DNA, and L6 was amplified from the T5 vector. These were then combined to generate the downstream homologous arm module L6-YPRCΔ15.

[0043] All modules were electroporated into CEN.PK2-1D for assembly and integration. The transformation product was dropped into the center of a defective SD-Ura solid plate and spread evenly using a spreader until the entire bacterial culture was absorbed. The plate was then incubated upside down at 30°C for 2-3 days. Single colonies were picked for sequencing verification, yielding a positive strain MD (see attached image). Figure 1 ).

[0044] 2. Fermentation

[0045] To determine the GPP production capacity of the MD strain, fermentation assays were performed. The detailed procedure is as follows:

[0046] (1) Pick a single colony of MD that has grown on the SD-Ura solid plate and place it in 10 mL of SD-Ura liquid culture medium, 30℃, 200 rpm for 48 h;

[0047] (2) Collect the cells by centrifugation at 5000g for 5 min at room temperature, transfer them to 10mL YPL induction medium, and induce culture at 30℃ and 200rpm for 48h to obtain the fermentation product.

[0048] 3. Extraction of fermentation products

[0049] The target component is a terpenoid compound, which is lipid-soluble and readily soluble in ethyl acetate. Therefore, ethyl acetate was selected as the solvent to extract the fermentation product and obtain the target compound. The extraction steps are as follows:

[0050] (1) After fermentation, take 5 ml of fermentation liquid, add an equal volume of ethyl acetate and sonicate for 1 h. During this time, mix by inverting the mixture every 10 minutes and add ice to keep the sonication temperature at 10°C to prevent product volatilization.

[0051] (2) Centrifuge at 13,000g for 10 minutes, remove the upper organic phase, add an appropriate amount of anhydrous sodium sulfate (dried at 120℃ for 30 minutes), and shake while adding to remove the water from the extract;

[0052] (3) Transfer to a liquid chromatography vial, seal, and use for GC-MS detection.

[0053] 4. GC-MS detection of fermentation products

[0054] GC-MS analysis conditions were as follows: column: TR-5ms (30m × 0.25mm); injection: 1 μL sample; splitless mode; incubation: 50℃ for 2 min; 5℃·min -1 Raise to 230℃, hold for 5 minutes, then increase by 10℃·min. -1 The temperature was raised to 300℃ and held for 2 minutes; the injection port temperature and transfer line temperature were both 280℃, and the electron energy was 70 eV. The sample was scanned in the range of 50-300 m / z. A standard curve was constructed using geraniol as a control, and the geraniol content in the sample was determined.

[0055] In the MD strain, the geraniol yield was detected to be 12.52 mg·L⁻¹. -1 (Appendix) Figure 2 ).

[0056] Example 2 Construction of BbTPS3 eukaryotic expression vector

[0057] The monoterpene synthase BbTPS3 cloned from *Artemisia annua* (see prior Chinese patent CN201910775971.6, all contents of which are incorporated herein by reference) was improved based on the codon bias of *Saccharomyces cerevisiae*. The improvement method is a conventional technique in the art. An exemplary improved codon sequence of the monoterpene synthase gene is shown in SEQ ID NO: 1. The improved monoterpene synthase gene was obtained, and homologous arm primers were designed to construct it into the BamHI site of the eukaryotic expression vector pESC-LEU via homologous recombination. The specific operation is as follows:

[0058] (1) Primers BbTPS3-F' and BbTPS3-R' with homologous arms containing the BamHI site were designed to amplify the monoterpene synthase BbTPS3 by PCR from the pET32a::BbTPS3 plasmid (Chinese Patent CN201910775971.6). The amplified product was recovered and purified. The primer sequences are shown in Table 2 (underlined sequences are vector homologous regions):

[0059] (2) Take the pESC-LEU vector (Agilent Technologies), digest it with the restriction endonuclease BamHI, and recover the linearized vector backbone.

[0060] (3) Take the purified PCR product obtained in step 1) and clone it into the linearized vector backbone of step 2) according to the instructions of Beijing TransGen Biotech Co., Ltd. pEASY-UniSeamless Cloning and Assembly Kit to obtain the recombinant plasmid pESC-LEU::BbTPS3.

[0061] The recombinant plasmid pESC-LEU::BbTPS3 was transformed into Escherichia coli Trans5α competent cells, plated on LB agar plates, and identified by positive clone PCR (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain the pESC-LEU::BbTPS3 recombinant bacteria. The pESC-LEU::BbTPS3 recombinant plasmid was extracted using the EZNATM plasmid mini kit I (Omega Bio-Tek).

[0062] Example 3: Fermentation of L-borneol

[0063] The constructed pESC-LEU::BbTPS3 recombinant plasmid was transformed into the MD strain, and the yield of L-carnitine was detected by fermentation. The specific operation is as follows:

[0064] 1. Preparation of MD yeast competent cells

[0065] Yeast competent cells were prepared using the ZYMO RESEARCH Frozen-EZ Yeast Transformation II kit:

[0066] (1) Pick a single colony of newly activated MD yeast from the SD-Ura solid plate, inoculate it into 10 mL of SD-Ura liquid medium, and culture it with shaking at 30 °C until the OD600 = 0.8-1.0;

[0067] (2) Centrifuge at 500g for 4 minutes at room temperature, and discard the supernatant;

[0068] (3) Add 10 mL of Frozen-EZ Solution 1 to suspend the bacterial cells, centrifuge at 500 g for 4 min at room temperature, and discard the supernatant;

[0069] (4) Add 1 mL of Frozen-EZ Solution 2 to suspend the bacterial cells to obtain BY-Mono yeast competent cells, and dispense 50 μL into sterile 1.5 mL EP tubes;

[0070] (5) Slowly cool to -70℃ (4℃, 1h; -20℃, 1h; -40℃, 1h; -70℃ for storage), and do not use liquid nitrogen to quickly freeze competent cells.

[0071] 2. Recombinant plasmid pESC-LEU::BbTPS3 was transformed into MD yeast competent cells.

[0072] (1) Take 0.2-1 μg of recombinant plasmid pESC-LEU::BbTPS3 (less than 5 μL) and mix it with 50 μL of BY-Mono yeast competent cells;

[0073] (2) Add 500 μL of Frozen-EZ Solution 3 and mix vigorously;

[0074] (3) Incubate at 30℃ for 1-2 hours, mixing 2-3 times during the process;

[0075] (4) Take 50-150 μL of the incubated bacterial solution, spread it on an SD-Ura-LEU solid plate, air-dry it, and then incubate it upside down at 30℃ for 48 h to obtain recombinant yeast transformed with the recombinant plasmid pESC-LEU::BbTPS3, which is named MD-B1. Fermentation is then carried out, and the detection of levorotatory borneol products is shown in Example 1. The initial strain obtained from fermentation contained 1.24 mg·L⁻¹. -1 Left-handed borneol (with) Figure 3 ).

[0076] Example 4: Protein structure optimization of the high-yield module for L-carnitine borneol

[0077] In this invention, the obtained yeast codon-optimized BbTPS3 was further modified. Based on the predictions from ChloroP1.1 (ChloroP(http: / / www.cbs.dtu.dk / services / ChloroP / )), which showed that BbTPS3 lacked a transport peptide but still had a predicted transport peptide length, we conducted a truncation experiment. We designed three truncation sites, E14, R18, and N38, and named them t14-BbTPS3, t18-BbTPS3, and t38-BbTPS3, respectively.

[0078] The protein-truncation plasmids pESC-Leu::t14-BbTPS3, pESC-Leu::t18-BbTPS3, and pESC-Leu::t38-BbTPS3 were transformed into competent yeast cells to obtain strains MD-B3, MD-B5, and MD-B7. Fermentation was then performed to determine the yield of borneol. Figure 3 On the other hand, based on the truncated protein, BbTPS3 was constructed using the commonly used Kozak sequence "GCCACC" in different truncated plasmid versions. Specific primers were designed for PCR amplification of BbTPS3 (Table 3), resulting in plasmids pESC-LEU::BbTPS3K, pESC-LEU::t14-BbTPS3K, pESC-LEU::t18-BbTPS3K, and pESC-LEU::t38-BbTPS3K with added Kozak sequences. The constructed truncated plasmids were transformed into competent yeast cells to obtain strains MD-B2, MD-B4, MD-B6, and MD-B8, and the yield of borneol was further determined.

[0079] Comparative analysis revealed that the yeast-specific Kozak sequence “AAAAAA” significantly increased borneol production. Therefore, a version with the yeast-specific Kozak sequence “AAAAAA” was constructed from the truncated plasmid pESC-LEU::t14-BbTPS3, which had the highest borneol production in BbTPS3, resulting in plasmid pESC-LEU::t14-BbTPS3K2, and strain MD-B9 was obtained.

[0080] The specific steps are as follows:

[0081] (1) Shortened primers were designed (see Table 3). The monoterpene synthase BbTPS3 was amplified by PCR from the pET32a::BbTPS3 plasmid, and the purified PCR product was recovered and purified. The primer sequences are shown in Table 3 (underlined sequences indicate vector homologous regions):

[0082] (2) Take the pESC-LEU vector (Agilent Technologies), digest it with the restriction endonuclease BamHI, and recover the linearized vector backbone.

[0083] (3) Take the purified PCR product obtained in step 1) and clone it into the linearized vector backbone of step 2) according to the instructions of Beijing TransGen Biotech Co., Ltd. pEASY-UniSeamless Cloning and Assembly Kit to obtain the recombinant plasmid pESC-LEU::BbTPS3.

[0084] The recombinant plasmids pESC-LEU::t14-BbTPS3, pESC-LEU::t18-BbTPS3, pESC-LEU::t38-BbTPS3, pESC-LEU::BbTPS3K, pESC-LEU::t14-BbTPS3K, pESC-LEU::t18-BbTPS3K, and pESC-LEU::t38-BbTPS3K were transformed into Escherichia coli Trans5α competent cells, plated on LB agar plates, and identified by positive clone PCR (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant bacteria. The recombinant plasmids were then extracted using the EZNATM plasmid mini kit I (Omega Bio-Tek).

[0085] The recombinant plasmid was transformed into MD strains according to the method in Example 3, resulting in new strains MD-B2, MD-B3, MD-B4, MD-B5, MD-B6, MD-B7, MD-B8, and MD-B9. These strains were then subjected to fermentation and extraction, and the yields are shown in the attached figure. Figure 4 As shown in Figure A. The results showed that the production of levorotatory borneol from the truncated MD-B3 and MD-B5 fusion proteins was increased, with the yields of MD-B3 and MD-B5 reaching 2.13 mg·L⁻¹. -1 and 1.39 mg·L -1 Furthermore, the yield of strain MD-B9, optimized with the yeast-specific Kozak sequence, was also increased to 4.87 mg·L⁻¹. -1 .

[0086] Example 5: Protein fusion enhances L-carnitine yield

[0087] To further increase the yield of borneol, we further constructed the mutant ERG20. F96W / N127W A fusion protein with BbTPS3 was developed, and different linker peptides were selected for linkage to optimize the structure of the fusion protein.

[0088] Five flexible linker peptides were selected for experiments: GGGS, GSG, WRFSPKLQ, VIPFIS, and YRSQI. BbTPS3 was used to construct pESC-LEU::ERG20. F96W / N127W -GGGS-BbTPS3,pESC-LEU::ERG20 F96W / N127W -GSG-BbTPS3, pESC-LEU::ERG20 F96W / N127W -WRFSPKLQ-BbTPS3,pESC-LEU::ERG20 F96W / N127W -VIPFIS-BbTPS3,pESC-LEU::ERG20 F96W / N127W -YRSQI-BbTPS3, a total of 5 fusion protein particles.

[0089] Simultaneously select pESC-LEU::ERG20 F96W / N127W -GGGS-t14-BbTPS3K2 was used to investigate the effects of linker peptide nucleic acid sequence and protein order, and pESC-LEU::ERG20 was constructed respectively. F96W / N127W -GGGS-t14-BbTPS3K2-2, pESC-LEU::t14-BbTPS3K2-GGGS-ERG20 F96W / N127W -2 Two fusion protein particles, as shown in the schematic diagram. Figure 4 B.

[0090] These seven plasmids were transformed into competent yeast cells to obtain strains MD-B10, MD-B11, MD-B12, MD-B13, MD-B14, MD-B15, and MD-B15. Fermentation was then performed to determine the yield of borneol. Figure 4 B).

[0091] To construct pESC-LEU::ERG20 F96W / N127W Taking the GGGS-BbTPS3 plasmid as an example, the mutant ERG20 F96W / N127W BbTPS3 was constructed into the BamHI site, and BbTPS3 was constructed into the SalI site, linked by the flexible linker peptide "GGGS". The experimental procedure is as follows:

[0092] 1) The plasmid pESC-LEU was double-digested with restriction endonucleases BamHI and SalI, and incubated in a 37°C metal bath for 1 h. The reaction product was run on an agarose gel to obtain a single target band, which was then excised and recovered to obtain the linearized vector.

[0093] 2) ERG20 was amplified by PCR using specific primers (Table 3) containing homologous arm sequences of the BamHI and SalI sites in pESC-LEU. F96W / N127WSequence analysis was performed, and the reaction product was run on an agarose gel to obtain a single target band. This band was then excised and recovered to obtain ERG20. F96W / N127W DNA purified fragments;

[0094] 3) The linearized vector was combined with ERG20 F96W / N127W The purified DNA fragments were seamlessly assembled using the pEASY-Uni Seamless Cloning and Assembly Kit. The reaction product was transformed into Trans1-T1 competent cells, identified as positive bacteria by PCR, and sequenced to obtain the plasmid pESC-LEU::ERG20. F96W / N127W ;

[0095] 4) The positive plasmid pESC-LEU::ERG20 obtained in 3) F96W / N127W Using the template, the restriction endonuclease SalI was used for single digestion. The mixture was incubated in a 37°C metal bath for 1 hour. The reaction product was run on an agarose gel to obtain a single target band. The gel was then cut and recovered to obtain the linearized vector.

[0096] 5) The BbTPS3 sequence was amplified by PCR using specific primers (Table 3) containing the homologous arm sequence of the SalI site in pESC-LEU and the flexible linker peptide “GGGS” sequence. The reaction product was run on an agarose gel to obtain a single target band, which was then excised and recovered to obtain the purified DNA fragment of BbTPS3.

[0097] 6) The linearized vector and the purified DNA fragment of BbTPS3 containing the flexible linker peptide "GGGS" were seamlessly spliced ​​using the pEASY-Uni Seamless Cloning and Assembly Kit. The reaction product was transformed into Trans1-T1 competent cells, and positive bacteria were identified by PCR and sequenced to obtain the plasmid pESC-LEU::ERG20. F96W / N127W -GGGS-BbTPS3.

[0098] BbTPS3 fusion protein particles pESC-LEU::ERG20 were constructed using this method. F96W / N127W -GGGS-BbTPS3,pESC-LEU::ERG20 F96W / N127W -GSG-BbTPS3, pESC-LEU::ERG20 F96W / N127W -WRFSPKLQ-BbTPS3,pESC-LEU::ERG20 F96W / N127W -VIPFIS-BbTPS3,pESC-LEU::ERG20 F96W / N127W-YRSQI-BbTPS3, primers are shown in Table 3.

[0099] Following the method described in Example 3, paragraph 2, the seven constructed fusion protein particles were transformed into competent yeast cells to obtain L-borneol-producing yeast strains MD-B10, MD-B11, MD-B12, MD-B13, MD-B14, MD-B15, and MD-B16. The borneol yield was further determined to be 12.41 mg·L⁻¹. -1 10.52 mg·L -1 12.68 mg·L -1 10.81 mg·L -1 9.10 mg·L -1 12.19 mg·L -1 9.16 mg·L -1 .

[0100] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Sichuan Hongda Pharmaceutical Co., Ltd. <120> A recombinant yeast strain for producing L-borneol <130> KH20210323 <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1671 <212> DNA <213> Artificial Sequence <400> 1 atggttggtt tccagaagca ctcttgctcc acccaagtta ccgaaccaat catcaggagg 60 tcagctaact acccaccaag taggtggtct tacgaggtct tgcaatccgt caccaacaac 120 tacgttggcg agaagtacaa gatcacctcc aacaacttga aggagagggt caggatgatg 180 atctccaagg ataccgccat gaagaaccca ttgtccatgt tggagttggt cgacgacttg 240 cagagattgg gcgtttccta ccacttcaag gacgagatct ccaacgtctt gaagatgatc 300 tactcctacc actacgaggc ccacaacaat tggaacacct tggacttgaa cctaaaggcc 360 ttgggcttca ggttgttgag acaacacggt taccacatcc cacaggagat cttcaaggac 420 atcaccgacg aatccggtaa catcaaggct tccgttcaag acgacttcgt tgccatgttg 480 aacttgtacg aggcttcctt ctacgccgtt gacgacgaaa acatcatgga cgaagccaga 540 gagttcacca ggaagtgctt gaaggagaag ttggagaaga acaacatcgt caacaagtcc 600 atcatgatgt tgatctccca cgccttggaa cacccattgt tgttcaggat cccaaggttc 660 gagtccgttt ggttcatcga ggcttacaag accagggacg acatgatccc attgttgcta 720 gagttcgccg tcttggacta caacatcttg caaggtattc accaggagga cttgaagcac 780 gttagtaagt ggtgggtcgg tttgcattgg atcaagaact tggagttcgc cagggatagc 840 atggtcgagt gtttcagttg gtccgtagga gctaacccag aaccatcttt cagcgtcttg aggaggaca tgaccaagga cttgaccttc acttccgtct tggacgacgt ttacgacgtt tacggtacct tggacgagtt ggaacagttc accgaagcag ttaggaggtg ggatatgaac gcagctgaag gtttgccaga ctacatgaga atttgcttca tgggcttgta caacaccatc aacgagatgg cctacaacac cttcatcaac cacaagtcct tcgtcatccc atacttgagg aaggtctgga cagagttttg cgaagccaac ctacaagaag ctaggtggta ctactccggt 1260. tacatcccaa ccttcgagga gtacctaaag acttccgtta tcaccgttgc cgttccagtt atcgtcttgg ccgcttactt cttggaagct aacgacttgt ccaacgaggc tttcgacaac gttatccact cctccgctat catcttgagg ttgaccgacg atcaaggtac ttccgaagca gaattggcta gaggagacgt tccaaagtcc gttcagtgct acatgaacga aacaggcgct tccagaaacg aagccatcgc ctacatgaag aggttgatca tcaacgccca caagaccatc aacaaggaga ggatggcttg caagtcccca acattgcaga tcttcatgga gtgcgctacc 1560 aacttgggta gaatcggtca cgtcacctac gatcacggag atatgttcgg cgttccagat 1620 gattcccatc aatcccacca caactccttg ttgttgaagc caaagacctg a 1671 <210> 2 <211> 1632 <212> DNA <213> Artificial Sequence <400> 2 atggaaccaa tcatcaggag gtcagctaac tacccaccaa gtaggtggtc ttacgaggtc 60 ttgcaatccg tcaccaacaa ctacgttggc gagaagtaca agatcacctc caacaacttg 120 aaggagaggg tcaggatgat gatctccaag gataccgcca tgaagaaccc attgtccatg 180 ttggagttgg tcgacgactt gcagagattg ggcgtttcct accacttcaa ggacgagatc 240 tccaacgtct tgaagatgat ctactcctac cactacgagg cccacaacaa ttggaacacc 300 ttggacttga acctaaaggc cttgggcttc aggttgttga gacaacacgg ttaccacatc 360 ccacaggaga tcttcaagga catcaccgac gaatccggta acatcaaggc ttccgttcaa 420 gacgacttcg ttgccatgtt gaacttgtac gaggcttcct tctacgccgt tgacgacgaa 480 aacatcatgg acgaagccag agagttcacc aggaagtgct tgaaggagaa gttggagaag 540 aacaacatcg tcaacaagtc catcatgatg ttgatctccc acgccttgga acacccattg 600 ttgttcagga tcccaaggtt cgagtccgtt tggttcatcg aggcttacaa gaccagggac 660 gacatgatcc cattgttgct agagttcgcc gtcttggact acaacatctt gcaaggtatt 720 caccaggagg acttgaagca cgttagtaag tggtgggtcg gtttgcattg gatcaagaac 780 ttggagttcg ccagggatag catggtcgag tgtttcagtt ggtccgtagg agctaaccca 840 gaaccatctt tcagcgtctt gaggaggaac atgaccaaga acttgacctt cacttccgtc 900 ttggacgacg tttacgacgt ttacggtacc ttggacgagt tggaacagtt caccgaagca 960 gttaggaggt gggatatgaa cgcagctgaa ggtttgccag actacatgag aatttgcttc 1020 atgggcttgt acaacaccat caacgagatg gcctacaaca ccttcatcaa ccacaagtcc 1080 ttcgtcatcc catacttgag gaaggtctgg acagagtttt gcgaagccaa cctacaagaa 1140 gctaggtggt actactccgg ttacatccca accttcgagg agtacctaaa gacttccgtt 1200 atcaccgttg ccgttccagt tatcgtcttg gccgcttact tcttggaagc taacgacttg 1260 tccaacgagg ctttcgacaa cgttatccac tcctccgcta tcatcttgag gttgaccgac 1320 gatcaaggta cttccgaagc agaattggct agaggagacg ttccaaagtc cgttcagtgc 1380 tacatgaacg aaacaggcgc ttccagaaac gaagccatcg cctacatgaa gaggttgatc 1440 atcaacgccc acaagaccat caacaaggag aggatggctt gcaagtcccc aacattgcag 1500 atcttcatgg agtgcgctac caacttgggt agaatcggtc acgtcaccta cgatcacgga 1560 gatatgttcg gcgttccaga tgattcccat caatcccacc acaactcctt gttgttgaag 1620 ccaaagacct ga 1632 <210> 3 <211> 1620 <212> DNA <213> Artificial Sequence <400> 3 atgaggaggt cagctaacta cccaccaagt aggtggtctt acgaggtctt gcaatccgtc 60 accaacaact acgttggcga gaagtacaag atcacctcca acaacttgaa ggagagggtc 120 aggatgatga tctccaagga taccgccatg aagaacccat tgtccatgtt ggagttggtc 180 gacgacttgc agagattggg cgtttcctac cacttcaagg acgagatctc caacgtcttg 240 aagatgatct actcctacca ctacgaggcc cacaacaatt ggaacacctt ggacttgaac 300 ctaaaggcct tgggcttcag gttgttgaga caacacggtt accacatccc acaggagatc 360 ttcaaggaca tcaccgacga atccggtaac atcaaggctt ccgttcaaga cgacttcgtt 420 gccatgttga acttgtacga ggcttccttc tacgccgttg acgacgaaaa catcatggac 480 gaagccagag agttcaccag gaagtgcttg aaggagaagt tggagaagaa caacatcgtc 540 aacaagtcca tcatgatgtt gatctcccac gccttggaac acccattgtt gttcaggatc 600 ccaaggttcg agtccgtttg gttcatcgag gcttacaaga ccagggacga catgatccca 660 ttgttgctag agttcgccgt cttggactac aacatcttgc aaggtattca ccaggaggac 720 ttgaagcacg ttagtaagtg gtgggtcggt ttgcattgga tcaagaactt ggagttcgcc 780 agggatagca tggtcgagtg tttcagttgg tccgtaggag ctaacccaga accatctttc 840 agcgtcttga ggaggaacat gaccaagaac ttgaccttca cttccgtctt ggacgacgtt 900 tacgacgttt acggtacctt ggacgagttg gaacagttca ccgaagcagt taggaggtgg 960 gatatgaacg cagctgaagg tttgccagac tacatgagaa tttgcttcat gggcttgtac 1020 aacaccatca acgagatggc ctacaacacc ttcatcaacc acaagtcctt cgtcatccca 1080 tacttgagga aggtctggac agagttttgc gaagccaacc tacaagaagc taggtggtac 1140 tactccggtt acatcccaac cttcgaggag tacctaaaga cttccgttat caccgttgcc 1200 gttccagtta tcgtcttggc cgcttacttc ttggaagcta acgacttgtc caacgaggct 1260 ttcgacaacg ttatccactc ctccgctatc atcttgaggt tgaccgacga tcaaggtact 1320 tccgaagcag aattggctag aggagacgtt ccaaagtccg ttcagtgcta catgaacgaa 1380 acaggcgctt ccagaaacga agccatcgcc tacatgaaga ggttgatcat caacgcccac 1440 aagaccatca acaaggagag gatggcttgc aagtccccaa cattgcagat cttcatggag 1500 tgcgctacca acttgggtag aatcggtcac gtcacctacg atcacggaga tatgttcggc 1560 gttccagatg attcccatca atcccaccac aactccttgt tgttgaagcc aaagacctga 1620 <210> 4 <211> 1560 <212> DNA <213> Artificial Sequence <400> 4 atgaacaact acgttggcga gaagtacaag atcacctcca acaacttgaa ggagagggtc 60 aggatgatga tctccaagga taccgccatg aagaacccat tgtccatgtt ggagttggtc 120 gacgacttgc agagattggg cgtttcctac cacttcaagg acgagatctc caacgtcttg 180 aagatgatct actcctacca ctacgaggcc cacaacaatt ggaacacctt ggacttgaac 240 ctaaaggcct tgggcttcag gttgttgaga caacacggtt accacatccc acaggagatc 300 ttcaaggaca tcaccgacga atccggtaac atcaaggctt ccgttcaaga cgacttcgtt 360 gccatgttga acttgtacga ggcttccttc tacgccgttg acgacgaaaa catcatggac 420 gaagccagag agttcaccag gaagtgcttg aaggagaagt tggagaagaa caacatcgtc 480 aacaagtcca tcatgatgtt gatctcccac gccttggaac acccattgtt gttcaggatc 540 ccaaggttcg agtccgtttg gttcatcgag gcttacaaga ccagggacga catgatccca 600 ttgttgctag agttcgccgt cttggactac aacatcttgc aaggtattca ccaggaggac 660 ttgaagcacg ttagtaagtg gtgggtcggt ttgcattgga tcaagaactt ggagttcgcc 720 agggatagca tggtcgagtg tttcagttgg tccgtaggag ctaacccaga accatctttc 780 agcgtcttga ggaggaacat gaccaagaac ttgaccttca cttccgtctt ggacgacgtt 840 tacgacgttt acggtacctt ggacgagttg gaacagttca ccgaagcagt taggaggtgg 900 gatatgaacg cagctgaagg tttgccagac tacatgagaa tttgcttcat gggcttgtac 960 aacaccatca acgagatggc ctacaacacc ttcatcaacc acaagtcctt cgtcatccca 1020 tacttgagga aggtctggac agagttttgc gaagccaacc tacaagaagc taggtggtac 1080 tactccggtt acatcccaac cttcgaggag tacctaaaga cttccgttat caccgttgcc 1140 gttccagtta tcgtcttggc cgcttacttc ttggaagcta acgacttgtc caacgaggct 1200 ttcgacaacg ttatccactc ctccgctatc atcttgaggt tgaccgacga tcaaggtact 1260 tccgaagcag aattggctag aggagacgtt ccaaagtccg ttcagtgcta catgaacgaa acaggcgctt ccagaaacga agccatcgcc tacatgaaga ggttgatcat caacgcccac aagaccatca acaaggagag gatggcttgc aagtccccaa cattgcagat cttcatggag tgcgctacca acttgggtag aatcggtcac gtcacctacg atcacggaga tatgttcggc gttccagatg attcccatca atcccaccac aactccttgt tgttgaagcc aaagacctga 1560 <210> 5 <211> 6 <212> DNA <213> Artificial Sequence <400> 5 gccacc <210> 6 <211> 6 <212> DNA <213> Artificial Sequence <400> 6 aaaaaa <210> 7 <211> 1056 <212> DNA <213> Artificial Sequence <400> 7 atggcttcag aaaaagaaat taggagag agattcttga acgttttccc taaattagta gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540 gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720 gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780 gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840 aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900 attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960 gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaa 1056 <210> 8 <211> 2706 <212> DNA <213> Artificial Sequence <400> 8 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540 gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720 gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780 gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840 aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900 atttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960 gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaaggtg gaggtagtaa aaaaatggaa 1080 ccaatcatca ggaggtcagc taactaccca ccaagtaggt ggtcttacga ggtcttgcaa 1140 1200 agggtcagga tgatgatctc caaggatacc gccatgaaga acccattgtc catgttggag 1260 ttggtcgacg acttgcagag attgggcgtt tcctaccact tcaaggacga gatctccaac 1320 gtcttgaga tgatctactc ctaccactac gaggcccaca aaattggaa caccttggac 1380 ttgaacctaa aggccttggg cttcaggttg ttgagacaac acggttacca catcccacag 1440 gagatcttca aggacatcac cgacgaatcc ggtaacatca aggcttccgt tcaagacgac 1500 ttcgttgcca tgttgaactt gtacgaggct tccttctacg ccgttgacga cgaaaacatc 1560 atggacgaag ccagagagtt caccaggaag tgcttgaagg agaagttgga gaacaac 1620 atcgtcaaca agtccatcat gatgttgatc tcccacgcct tggaaaccc attgttgttc 1680 aggatcccaa ggttcgagtc cgtttggttc atcgaggctt aaagaccag ggacgacatg 1740 atcccattgt tgctagagtt cgccgtcttg gactacaaca tcttgcaagg tattcaccag 1800 1860 ttcgccaggg atagcatggt cgagtgtttc agttggtccg taggagctaa cccagaacca 1920 tctttcagcg tcttgaggag gaacatgacc aagaacttga ccttcacttc cgtcttggac 1980 gacgtttacg acgtttacgg taccttggac gagttggaac agttcaccga agcagttagg 2040 aggtgggata tgaacgcagc tgaaggtttg ccagactaca tgagaatttg cttcatgggc 2100 ttgtacaaca ccatcaacga gatggcctac aacaccttca tcaaccacaa gtccttcgtc 2160 atcccatact tgaggaaggt ctggacagag ttttgcgaag ccaacctaca agaagctagg 2220 tggtactact ccggttacat cccaaccttc gaggagtacc taaagacttc cgttatcacc 2280 gttgccgttc cagttatcgt cttggccgct tacttcttgg aagctaacga cttgtccaac 2340 gaggctttcg acaacgttat ccactcctcc gctatcatct tgaggttgac cgacgatcaa 2400 ggtacttccg aagcagaatt ggctagagga gacgttccaa agtccgttca gtgctacatg 2460 aacgaaacag gcgcttccag aaacgaagcc atcgcctaca tgaagaggtt gatcatcaac 2520 gcccacaaga ccatcaacaa ggagaggatg gcttgcaagt ccccaacatt gcagatcttc 2580 atggagtgcg ctaccaactt gggtagaatc ggtcacgtca cctacgatca cggagatatg 2640 ttcggcgttc cagatgattc ccatcaatcc caccacaact ccttgttgtt gaagccaaag 2700 acctga 2706 <210> 9 <211> 2703 <212> DNA <213> Artificial Sequence <400> 9 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 540. ccttccaaa ccgaattggg ccttgatg gacttaatca ctgcacctga agacaaagtc gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat gactacttag actgcttcgg actcccaga cagatcggta agatcggtac agatatccaa throwing gttcttgggt throwing gcattggac ttgcttccgc 840 aagactttag acgaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaaggta gcggaaaaaa aatggaacca atcatcagga ggtcagctaa ctacccacca agtaggtggt cttacgaggt cttgcaatcc gtcaccaaca actacgttgg cgagaagtac aagatcacct ccaacaactt gaaggagagg gtcaggatga tgatctccaa ggataccgcc atgaagaacc cattgtccat gttggagttg 1260 gtcgacgact tgcagagatt gggcgtttcc taccacttca aggacgagat ctccaacgtc 1320 ttgaagatga tctactccta ccactacgag gcccacaaca attggaacac cttggacttg 1380 aacctaaagg ccttgggctt caggttgttg agacaacacg gttaccacat cccacaggag 1440 atcttcaagg acatcaccga cgaatccggt aacatcaagg cttccgttca agacgacttc 1500 gttgccatgt tgaacttgta cgaggcttcc ttctacgccg ttgacgacga aaacatcatg 1560 gacgaagcca gagagttcac caggaagtgc ttgaaggaga agttggagaa gaacaacatc 1620 gtcaacaagt ccatcatgat gttgatctcc cacgccttgg aacacccatt gttgttcagg 1680 atcccaaggt tcgagtccgt ttggttcatc gaggcttaca agaccaggga cgacatgatc 1740 ccattgttgc tagagttcgc cgtcttggac tacaacatct tgcaaggtat tcaccaggag 1800 gacttgaagc acgttagtaa gtggtgggtc ggtttgcatt ggatcaagaa cttggagttc 1860 gccagggata gcatggtcga gtgtttcagt tggtccgtag gagctaaccc agaaccatct 1920 ttcagcgtct tgaggagga catgaccaag aacttgacct tcacttccgt cttggacgac gtttacgacg tttacggtac cttggacgag ttggaacagt tcaccgaagc agttaggagg tgggatatga acgcagctga aggtttgcca gactacatga gaatttgctt catgggcttg 2160. 2160. ggcctacac accttcatc cttcgtcatc ccatacttga ggaaggtctg gacagagttt tgcgaagcca acctacaaga agctaggtgg tactactccg gttacatccc aaccttcgag gagtacctaa agacttccgt tatcaccgtt 2280 gccgttccag ttatcgtctt ggccgcttac ttcttggaag ctaacgactt gtccaacgag 2340 gctttcgaca acgttatcca ctcctccgct atcatcttga ggttgaccga cgatcaaggt acttccgaag cagaattggc tagaggagac gttccaaagt ccgttcagtg ctacatgaac gaaacaggcg cttccagaaa cgaagccatc gcctacatga agaggttgat catcaacgcc cacaagacca tcaacaagga gaggatggct tgcaagtccc cacattgca gatcttcatg gagtgcgcta ccaacttggg tagaatcggt cacgtcacct acgatcacgg agatatgttc ggcgttccag atgattccca tcaatcccac cacaactcct tgttgttgaa gccaaagacc 2700 tga 2703 <210> 10 <211> 2709 <212> DNA <213> Artificial Sequence <400> 10 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180​​​​​​​​​​​​​gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720 gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780 gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840 aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900 attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960 gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaatata gaagtcaaat caaaaaaatg 1080 gaaccaatca tcaggaggtc agctaactac ccaccaagta ggtggtctta cgaggtcttg 1140 caatccgtca ccaacaacta cgttggcgag aagtacaaga tcacctccaa caacttgaag 1200 gagagggtca ggatgatgat ctccaaggat accgccatga agaacccatt gtccatgttg 1260 gagttggtcg acgacttgca gagattgggc gtttcctacc acttcaagga cgagatctcc 1320 aacgtcttga agatgatcta ctcctaccac tacgaggccc acaacaattg gaacaccttg 1380 gacttgaacc taaaggcctt gggcttcagg ttgttgagac aacacggtta ccacatccca 1440 caggagatct tcaaggacat caccgacgaa tccggtaaca tcaaggcttc cgttcaagac 1500 gacttcgttg ccatgttgaa cttgtacgag gcttccttct acgccgttga cgacgaaaac 1560 atcatggacg aagccagaga gttcaccagg aagtgcttga aggagaagtt ggagaagaac 1620 aacatcgtca acaagtccat catgatgttg atctcccacg ccttggaaca cccattgttg 1680 ttcaggatcc caaggttcga gtccgtttgg ttcatcgagg cttacaagac cagggacgac 1740 atgatcccat tgttgctaga gttcgccgtc ttggactaca acatcttgca aggtattcac 1800 caggaggact tgaagcacgt tagtaagtgg tgggtcggtt tgcattggat caagaacttg 1860 gagttcgcca gggatagcat ggtcgagtgt ttcagttggt ccgtaggagc taacccagaa 1920 ccatctttca gcgtcttgag gaggaacatg accaagaact tgaccttcac ttccgtcttg 1980 gacgacgttt acgacgttta cggtaccttg gacgagttgg aacagttcac cgaagcagtt aggaggtggg atatgaacgc agctgaaggt ttgccagact acatgagaat ttgcttcatg ggcttgtaca acaccatcaa cgagatggcc tacaacacct tcatcaacca caagtccttc gtcatcccat acttgagga ggtctggaca gagttttgcg aagccaacct acaagaagct aggtggtact actccggtta catcccaacc ttcgaggagt acctaaagac ttccgttatc accgttgccg ttccagttat cgtcttggcc gcttacttct tggaagctaa cgacttgtcc 2340 aacgaggctt tcgacaacgt tatccactcc tccgctatca tcttgaggtt gaccgacgat caaggtactt ccgaagcaga attggctaga ggagacgttc caaagtccgt tcagtgctac atgaacgaa caggcgcttc cagaaacgaa gccatcgcct acatgaagag gttgatcatc 2580. aacgcccaca aaccccaca aaggagagg atggcttgca agtccccaac attgcagatc ttcatggagt gcgctaccaa cttgggtaga atcggtcacg tcacctacga tcacggagat 2640 atgttcggcg ttccagatga ttcccatcaa tcccaccaca actccttgtt gttgaagcca aagacctga 2709 <210> 11 <211> 2712 <212> DNA <213> Artificial Sequence <400> 11 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540 gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720 gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780 gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840 aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900 atttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960 gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaagtga taccttttat ttcaaaaaaa 1080 atggaaccaa tcatcaggag gtcagctaac tacccaccaa gtaggtggtc ttacgaggtc 1140 ttgcaatccg tcaccaacaa ctacgttggc gagaagtaca agatcacctc caacaacttg 1200 aaggagaggg tcaggatgat gatctccaag gataccgcca tgaagaaccc attgtccatg 1260 ttggagttgg tcgacgactt gcagagattg ggcgtttcct accacttcaa ggacgagatc 1320 tccaacgtct tgaagatgat ctactcctac cactacgagg cccacaacaa ttggaacacc 1380 ttggacttga acctaaaggc cttgggcttc aggttgttga gacaacacgg ttaccacatc 1440 ccacaggaga tcttcaagga catcaccgac gaatccggta acatcaaggc ttccgttcaa 1500 gacgacttcg ttgccatgtt gaacttgtac gaggcttcct tctacgccgt tgacgacgaa 1560 aacatcatgg acgaagccag agagttcacc aggaagtgct tgaaggagaa gttggagaag 1620 aacaacatcg tcaacaagtc catcatgatg ttgatctccc acgccttgga acacccattg 1680 ttgttcagga tcccaaggtt cgagtccgtt tggttcatcg aggcttacaa gaccagggac 1740 gacatgatcc cattgttgct agagttcgcc gtcttggact acaacatctt gcaaggtatt 1800 caccaggagg acttgaagca cgttagtaag tggtgggtcg gtttgcattg gatcaagaac 1860 ttggagttcg ccagggatag catggtcgag tgtttcagtt ggtccgtagg agctaaccca 1920 gaaccatctt tcagcgtctt gaggaggaac atgaccaaga acttgacctt cacttccgtc 1980 ttggacgacg tttacgacgt ttacggtacc ttggacgagt tggaacagtt caccgaagca 2040 gttaggaggt gggatatgaa cgcagctgaa gttttgccag actacatgag aatttgcttc 2100 atgggcttgt acacacat caacgagatg gcctacaaca ccttcatca caccagtcc 2160 ttcgtcatcc catacttgag gaaggtctgg acagagtttt gcgaagccaa cctacaagaa 2220 gctaggtggt actactccgg ttacatccca accttcgagg agtacctaa gactccgtt 2280 atcaccgttg ccgttccagt tatcgtcttg gccgcttact tcttggaagc taacgacttg 2340 tccaacgagg ctttcgacaa cgttatccac tcctccgcta tcatcttgag gttgaccgac 2400 gatcaagta cttccgaagc agaattggct agaggagacg ttccaagtc cgttcagtgc 2460 tacatgaacg aacaggcgc ttccagaac gaagccatcg cctacatgaa gaggttgatc 2520 atcaacgccc acaagaccat acagaggag aggatggctt gcaagtcccc aacattgcag 2580 atcttcatgg agtgcgctac caactgggt agaatcggtc acgtcaccta cgatcacgga 2640 gatatgttcg gcgttccaga tgatcccat caatcccacc acaactcctt gttgttgaag 2700 on 2712 <210> 12 <211> 2718 <212> DNA <213> Artificial Sequence <400> 12 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540 gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat gactacttag actgcttcgg actcccaga cagatcggta agatcggtac agatatccaa throwing gttcttgggt throwing gcattggac ttgcttccgc 840 aagactttag acgaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaatggc ggttctcgcc gaagcttcag aaaaaaatgg aaccaatcat caggaggtca gctaactacc caccaagtag gtggtcttac gaggtcttgc aatccgtcac to be alone gttggcgaga to be alone aacttgaagg agagggtcag gatgatgatc tccaaggata ccgccatga gacccattg tccatgttgg agttggtcga cgacttgcag agttgggcg tttcctacca cttcaaggac 1320 gagatctcca acgtcttgaa gatgatctac tcctaccact acgaggccca caacaattgg aacaccttgg acttgaacct aaaggccttg ggcttcaggt tgttgagaca acacggttac 1440 cacatcccac aggagatctt caaggacatc accgacgaat ccggtaacat caaggcttcc 1500 gttcaagacg acttcgttgc catgttgaac ttgtacgagg cttccttcta cgccgttgac 1560 gacgaaaaca tcatggacga agccagagag ttcaccagga agtgcttgaa ggagaagttg 1620 gagaagaaca acatcgtcaa caagtccatc atgatgttga tctcccacgc cttggaacac 1680 ccattgttgt tcaggatccc aaggttcgag tccgtttggt tcatcgaggc ttacaagacc 1740 agggacgaca tgatcccatt gttgctagag ttcgccgtct tggactacaa catcttgcaa 1800 ggtattcacc aggaggactt gaagcacgtt agtaagtggt gggtcggttt gcattggatc 1860 aagaacttgg agttcgccag ggatagcatg gtcgagtgtt tcagttggtc cgtaggagct 1920 aacccagaac catctttcag cgtcttgagg aggaacatga ccaagaactt gaccttcact 1980 tccgtcttgg acgacgttta cgacgtttac ggtaccttgg acgagttgga acagttcacc 2040 gaagcagtta ggaggtggga tatgaacgca gctgaaggtt tgccagacta catgagaatt 2100 tgcttcatgg gcttgtacaa caccatcaac gagatggcct acaacacctt catcaaccac 2160 aagtccttcg tcatcccata cttgaggaag gtctggacag agttttgcga agccaaccta 2220 caagaagcta ggtggtacta ctccggttac atcccaacct tcgaggagta cctaaagact 2280 tccgttatca ccgttgccgt tccagttatc gtcttggccg cttacttctt ggaagctaac 2340 gacttgtcca acgaggcttt cgacaacgtt atccactcct ccgctatcat cttgaggttg 2400 accgacgatc aaggtacttc cgaagcagaa ttggctagag gagacgttcc aaagtccgtt 2460 cagtgctaca tgaacgaaac aggcgcttcc agaaacgaag ccatcgccta catgaagagg 2520 ttgatcatca acgcccacaa gaccatcaac aaggagagga tggcttgcaa gtccccaaca 2580 ttgcagatct tcatggagtg cgctaccaac ttgggtagaa tcggtcacgt cacctacgat 2640 cacggagata tgttcggcgt tccagatgat tcccatcaat cccaccacaa ctccttgttg 2700 ttgaagccaa agacctga 2718 <210> 13 <211> 2706 <212> DNA <213> Artificial Sequence <400> 13 atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60 gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120 gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180 gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240 aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300 gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360 gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420 aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480 accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540 gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600 tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660 gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720 gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780 gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840 aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900 atttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960 gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020 actgcgttct tgaacaaagt ttacaagaga agcaaaggtg gtggttctaa aaaaatggaa 1080 ccaatcatca ggaggtcagc taactaccca ccaagtaggt ggtcttacga ggtcttgcaa 1140 tccgtcacca acaactacgt tggcgagaag tacaagatca cctccaacaa cttgaaggag 1200 agggtcagga tgatgatctc caaggatacc gccatgaaga acccattgtc catgttggag 1260 ttggtcgacg acttgcagag attgggcgtt tcctaccact tcaaggacga gatctccaac 1320 gtcttgaaga tgatctactc ctaccactac gaggcccaca acaattggaa caccttggac 1380 ttgaacctaa aggccttggg cttcaggttg ttgagacaac acggttacca catcccacag 1440 gagatcttca aggacatcac cgacgaatcc ggtaacatca aggcttccgt tcaagacgac 1500 ttcgttgcca tgttgaactt gtacgaggct tccttctacg ccgttgacga cgaaaacatc 1560 atggacgaag ccagagagtt caccaggaag tgcttgaagg agaagttgga gaacaac 1620 atcgtcaaca agtccatcat gatgttgatc tcccacgcct tggaaaccc attgttgttc 1680 aggatcccaa ggttcgagtc cgtttggttc atcgaggctt aaagaccag ggacgacatg 1740 atcccattgt tgctagagtt cgccgtcttg gactacaaca tcttgcaagg tattcaccag 1800 1860 ttcgccaggg atagcatggt cgagtgtttc agttggtccg taggagctaa cccagaacca 1920 tctttcagcg tcttgaggag gaacatgacc aagaacttga ccttcacttc cgtcttggac 1980 2040 aggtgggata tgaacgcagc tgaaggtttg ccagactaca tgagaatttg cttcatgggc 2100 2160 atcccatact tgaggaaggt ctggacagag ttttgcgaag ccaacctaca agaagctagg 2220 tggtactact ccggttacat cccaaccttc gaggagtacc taaagacttc cgttatcacc 2280 gttgccgttc cagttatcgt cttggccgct tacttcttgg aagctaacga cttgtccaac 2340 gaggctttcg acaacgttat ccactcctcc gctatcatct tgaggttgac cgacgatcaa 2400 ggtacttccg aagcagaatt ggctagagga gacgttccaa agtccgttca gtgctacatg 2460 aacgaaacag gcgcttccag aaacgaagcc atcgcctaca tgaagaggtt gatcatcaac 2520 gcccacaaga ccatcaacaa ggagaggatg gcttgcaagt ccccaacatt gcagatcttc 2580 atggagtgcg ctaccaactt gggtagaatc ggtcacgtca cctacgatca cggagatatg 2640 ttcggcgttc cagatgattc ccatcaatcc caccacaact ccttgttgtt gaagccaaag 2700 acctga 2706 <210> 14 <211> 2706 <212> DNA <213> Artificial Sequence <400> 14 ggtggtggtt ctaaaaaaat ggaaccaatc atcaggaggt cagctaacta cccaccaagt 60 aggtggtctt acgaggtctt gcaatccgtc accaacaact acgttggcga gaagtacaag 120 atcacctcca acaacttgaa ggagagggtc aggatgatga tctccaagga taccgccatg 180 aagaacccat tgtccatgtt ggagttggtc gacgacttgc agagattggg cgtttcctac 240 cacttcaagg acgagatctc caacgtcttg aagatgatct actcctacca ctacgaggcc 300 cacaacaatt ggaacacctt ggacttgaac ctaaaggcct tgggcttcag gttgttgaga 360 caacacggtt accacatccc acaggagatc ttcaaggaca tcaccgacga atccggtaac 420 atcaaggctt ccgttcaaga cgacttcgtt gccatgttga acttgtacga ggcttccttc 480 tacgccgttg acgacgaaaa catcatggac gaagccagag agttcaccag gaagtgcttg 540 aaggagaagt tggagaagaa caacatcgtc aacaagtcca tcatgatgtt gatctcccac 600 gccttggaac acccattgtt gttcaggatc ccaaggttcg agtccgtttg gttcatcgag 660 gcttacaaga ccagggacga catgatccca ttgttgctag agttcgccgt cttggactac 720 aacatcttgc aaggtattca ccaggaggac ttgaagcacg ttagtaagtg gtgggtcggt 780 ttgcattgga tcaagaactt ggagttcgcc agggatagca tggtcgagtg tttcagttgg 840 tccgtaggag ctaacccaga accatctttc agcgtcttga ggaggaacat gaccaagaac 900 ttgaccttca cttccgtctt ggacgacgtt tacgacgttt acggtacctt ggacgagttg 960 gaacagttca ccgaagcagt taggaggtgg gatatgaacg cagctgaagg tttgccagac 1020 tacatgagaa tttgcttcat gggcttgtac aacaccatca acgagatggc ctacaacacc 1080 ttcatcaacc acaagtcctt cgtcatccca tacttgagga aggtctggac agagttttgc 1140 gaagccaacc tacaagaagc taggtggtac tactccggtt acatcccaac cttcgaggag 1200 tacctaaaga cttccgttat caccgttgcc gttccagtta tcgtcttggc cgcttacttc 1260 ttggaagcta acgacttgtc caacgaggct ttcgacaacg ttatccactc ctccgctatc 1320 atcttgaggt tgaccgacga tcaaggtact tccgaagcag aattggctag aggagacgtt 1380 ccaaagtccg ttcagtgcta catgaacgaa acaggcgctt ccagaaacga agccatcgcc 1440 tacatgaaga ggttgatcat caacgcccac aagaccatca acaaggagag gatggcttgc 1500 aagtccccaa cattgcagat cttcatggag tgcgctacca acttgggtag aatcggtcac 1560 gtcacctacg atcacggaga tatgttcggc gttccagatg attcccatca atcccaccac 1620 aactccttgt tgttgaagcc aaagaccatg gcttcagaaa aagaaattag gagagagaga 1680 ttcttgaacg ttttccctaa attagtagag gaattgaacg catcgctttt ggcttacggt 1740 atgcctaagg aagcatgtga ctggtatgcc cactcattga actacaacac tccaggcggt 1800 aagctaaata gaggtttgtc cgttgtggac acgtatgcta ttctctccaa caagaccgtt 1860 gaacaattgg ggcaagaaga atacgaaaag gttgccattc taggttggtg cattgagttg 1920 ttgcaggctt actggttggt cgccgatgat atgatggaca agtccattac cagaagaggc 1980 caaccatgtt ggtacaaggt tcctgaagtt ggggaaattg ccatctggga cgcattcatg 2040 ttagaggctg ctatctacaa gcttttgaaa tctcacttca gaaacgaaaa atactacata 2100 gatatcaccg aattgttcca tgaggtcacc ttccaaaccg aattgggcca attgatggac 2160 ttaatcactg cacctgaaga caaagtcgac ttgagtaagt tctccctaaa gaagcactcc 2220 ttcatagtta ctttcaagac tgcttactat tctttctact tgcctgtcgc attggccatg 2280 tacgttgccg gtatcacgga tgaaaggat ttgaaacaag ccagagatgt cttgattcca 2340 ttgggtgaat acttccaaat tcaagatgac tacttagact gcttcggtac cccagaacag 2400 atcggtaaga tcggtacaga tatccaagat aacaaatgtt cttgggtaat caacaaggca 2460 ttggaacttg cttccgcaga acaaagaaag actttagacg aaaattacgg taagaaggac 2520 tcagtcgcag aagccaaatg caaaaagatt ttcaatgact tgaaaattga acagctatac 2580 cacgaatatg aagagtctat tgccaaggat ttgaaggcca aaatttctca ggtcgatgag 2640 tctcgtggct tcaaagctga tgtcttaact gcgttcttga acaaagttta caagagaagc 2700 aaatag 2706

Claims

1. A recombinant bacterium, wherein the recombinant bacterium is a yeast containing or expressing argyrone monoterpene synthase BbTPS3 or an argyrone monoterpene synthase BbTPS3 fusion protein; wherein the argyrone monoterpene synthase BbTPS3 fusion protein comprises argyrone monoterpene synthase BbTPS3 and farnesyl pyrophosphate synthase, wherein the N-terminus of the argyrone monoterpene synthase BbTPS3 is truncated by 14 or 18 amino acids, and its encoded nucleic acid is the nucleic acid shown in SEQ ID NO:2 or SEQ ID NO:3, and the encoded nucleic acid of the argyrone monoterpene synthase BbTPS3 fusion protein is selected from any one of the nucleic acids shown in SEQ ID NO:8-14.

2. The recombinant bacteria according to claim 1, characterized in that... The recombinant bacteria further includes the Kozak sequence, whose nucleic acid sequence is shown in SEQ ID NO:

6.

3. The recombinant bacteria according to claim 1, characterized in that, The presence or expression of *Artemisia argyi* monoterpene synthase BbTPS3 or *Artemisia argyi* monoterpene synthase BbTPS3 fusion protein in vivo is achieved by introducing the encoding nucleic acid of *Artemisia argyi* monoterpene synthase BbTPS3 or the encoding nucleic acid of the *Artemisia argyi* monoterpene synthase BbTPS3 fusion protein into the yeast.

4. The recombinant bacteria according to claim 3, characterized in that, Introducing the coding nucleic acid of argyi monoterpene synthase BbTPS3 into the yeast involves introducing an expression cassette containing the coding nucleic acid of argyi monoterpene synthase BbTPS3 into the yeast; introducing the coding nucleic acid of argyi monoterpene synthase BbTPS3 fusion protein into the yeast involves introducing an expression cassette containing the coding nucleic acid of argyi monoterpene synthase BbTPS3 fusion protein into the yeast.

5. The recombinant bacteria according to claim 4, characterized in that, The nucleic acid expression cassette containing the enzyme BbTPS3 encoding argyrope monoterpene synthase was introduced into the yeast by introducing a vector expressing the nucleic acid expression cassette of the enzyme BbTPS3 encoding argyrope monoterpene synthase.

6. The recombinant bacteria according to claim 5, characterized in that, The yeast was introduced in plasmid form.

7. The recombinant bacteria according to claim 1, characterized in that, The yeast mentioned is brewer's yeast.

8. The recombinant bacteria according to claim 7, characterized in that, The yeast is CEN.PK2-1D.

9. The use of the recombinant bacteria according to any one of claims 1-8 in the production of levorotatory borneol.

Citation Information

Patent Citations

  • Genetically engineered bacterium for synthesizing D-limonene, and construction method and application of genetically engineered bacterium

    CN110669713A

  • Linalool synthetase mutant, recombinant vector and linalool production engineering bacterium

    CN111411101A

  • Artemisia monoterpene synthase BbTPS3 and its related biomaterials and applications

    CN112409491B

  • Recombinant bacterium and use thereof

    CN108060092A

  • Blumea balsamifera monoterpene synthase BbTPS3 as well as related biological material and application thereof

    CN112409491A