Application of ginsenoside Rg1 in preparation of medicine for improving cisplatin-induced renal injury

Ginsenoside Rg1 resolved cisplatin-induced kidney damage by reversing the inhibition of autophagy markers and the JAK2-STAT3 signaling pathway induced by cisplatin, demonstrating significant kidney damage repair effects both in vitro and in vivo.

CN121360128APending Publication Date: 2026-01-20HANGZHOU FIRST PEOPLES HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511949027.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

There is a lack of effective treatments for cisplatin-induced nephrotoxicity during chemotherapy. Existing methods can only provide short-term relief from kidney damage without any repair effect. It is urgent to clarify the mechanism of action and find intervention strategies.

Method used

Ginsenoside Rg1 improves cisplatin-induced kidney injury, including acute kidney injury, by reversing the upregulation of cisplatin-induced autophagy markers LC3II and Beclin1 and inhibiting autolysosome formation, as well as reversing the inhibition of the JAK2-STAT3 signaling pathway.

Benefits of technology

Ginsenoside Rg1 significantly reversed the inhibitory effect of cisplatin on renal tubular epithelial cells in vitro and in vivo, reduced the expression of apoptotic proteins, improved renal tubular epithelial cell damage, restored renal function, and alleviated acute kidney injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121360128A_ABST
    Figure CN121360128A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of medicine application, in particular to application of ginsenoside Rg1 in preparation of a medicine for improving cisplatin-induced renal injury. The invention discloses application of ginsenoside Rg1 in preparation of a medicine for improving cisplatin-induced renal injury. It is proved for the first time that ginsenoside Rg1 has prevention and protection effects on cisplatin-induced acute kidney injury; it is proved that the ginsenoside Rg1 is related to cell autophagy in relieving the cisplatin-induced acute kidney injury; the JAK2-STAT3 pathway is proposed to be possibly an action pathway of the ginsenoside Rg1 for relieving the acute kidney injury induced by the cis-platinum; the LCP1 is proposed to be possibly an action target of the ginsenoside Rg1 for relieving the cisplatin-induced acute kidney injury.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of drug use, in particular to the application of ginsenoside Rg1 in preparing drugs for improving cisplatin-induced kidney injury. BACKGROUND

[0002] Cisplatin is one of the most commonly used drugs in current combination chemotherapy, and is widely used in the treatment of ovarian cancer, testicular cancer, lung cancer, breast cancer, etc. According to statistics, 70%~80% of chemotherapy regimens in China are based on cisplatin combined with other drugs with different mechanisms of action. However, due to its side effects and drug resistance, the clinical application of cisplatin is greatly limited. The main toxic side effects of cisplatin include nephrotoxicity, ototoxicity, neurotoxicity, cardiotoxicity, etc., among which nephrotoxicity is the most important dose-limiting toxicity of cisplatin, with an incidence of about 1 / 3. Different doses and different administration methods of cisplatin can cause different degrees of nephrotoxicity. Low-dose cisplatin can cause reversible kidney injury, while high-dose cisplatin can cause irreversible kidney failure, and even death. However, due to the lack of research on the mechanism of cisplatin nephrotoxicity, the current clinical treatment can only reduce the nephrotoxicity of cisplatin through intravenous infusion of physiological saline or the addition of mannitol diuresis in a short period of time to delay disease progression, but it has no repair effect on kidney tubular damage. Therefore, it is urgent to clarify the mechanism of cisplatin nephrotoxicity and to find effective treatment and intervention strategies.

[0003] Ginseng is a traditional herbal medicine, and its traditional functions are to enhance the body's immunity, relieve nerves, replenish vital energy and promote blood circulation, and it has excellent regulating effects on the nervous system, cardiovascular system, immune system, etc. Due to its rich medicinal value, it has a history of thousands of years of use and is widely used as an adjunctive treatment for various diseases. Ginsenoside Rg1 is one of the most important active components in ginseng, and has pharmacological effects such as antioxidant, anti-aging, anti-inflammatory and memory improvement. There is no report in the prior art about ginsenoside Rg1 reversing cisplatin nephrotoxicity. SUMMARY

[0004] In order to solve the above problems, the present application provides the application of ginsenoside Rg1 in preparing drugs for improving cisplatin-induced kidney injury, and ginsenoside Rg1 can improve cisplatin-induced kidney injury.

[0005] In order to achieve the above purpose, the present application provides the following technical scheme:

[0006] The present application provides the application of ginsenoside Rg1 in preparing drugs for improving cisplatin-induced kidney injury.

[0007] Preferably, ginsenoside Rg1 improves cisplatin-induced kidney injury by reversing the up-regulation of autophagy markers LC3II and Beclin1 and inhibiting the formation of autophagic lysosomes caused by cisplatin.

[0008] Preferably, the ginsenoside Rg1 improves the kidney injury by reversing the down-regulation of JAK2, p-JAK2, p-STAT3 expression and up-regulation of LCP1 expression induced by cisplatin.

[0009] Preferably, the ginsenoside Rg1 improves the kidney injury by reversing the down-regulation of JAK2, p-JAK2, p-STAT3 expression and up-regulation of LCP1 expression induced by cisplatin.

[0010] Preferably, the kidney injury comprises acute kidney injury.

[0011] The application also provides a use of ginsenoside Rg1 in the preparation of a drug for relieving cisplatin-induced kidney toxicity in vitro.

[0012] Preferably, the ginsenoside Rg1 reverses the inhibition of cisplatin on the proliferation of renal tubular epithelial cells.

[0013] Preferably, the ginsenoside Rg1 has a use concentration of 50 μmol / L.

[0014] The application also provides a use of ginsenoside Rg1 in the preparation of a drug for relieving cisplatin-induced acute kidney injury in vivo.

[0015] Preferably, the ginsenoside Rg1 has a use concentration of 25-50 mg / kg.

[0016] Beneficial effects:

[0017] 1. A cisplatin in vitro injury model is constructed by using human renal tubular epithelial cells (HK2), CCK8 method and Western blot method are used to detect the effects of ginsenoside Rg1 and cisplatin on the activity of HK2 cells, and the effect of ginsenoside Rg1 on the activity of HK2 cells damaged by cisplatin. The results show that cisplatin induces the decrease of HK2 cell proliferation activity and the up-regulation of apoptosis protein in a time- and dose-dependent manner, and ginsenoside Rg1 (50 μM) can significantly reverse the inhibition of cisplatin on the proliferation ability of HK2 cells and the up-regulation of apoptosis protein without affecting the activity of HK2 cells. This part shows that ginsenoside Rg1 can relieve cisplatin-induced kidney toxicity in vitro.

[0018] 2. Construct cisplatin-induced acute kidney injury mouse model (intraperitoneal injection of cisplatin 20 mg / kg), start giving ginsenoside Rg1 of different doses by gavage every day 3 days before injection of cisplatin, and continue to the third day after injection of cisplatin. Through methods such as mouse blood biochemical indicators, tissue H&E staining, PAS staining, Western blot, RT-qPCR, etc., the effect of ginsenoside Rg1 on cisplatin-induced acute kidney injury is evaluated. The results show that cisplatin can cause the increase of mouse kidney injury markers, the up-regulation of apoptosis proteins and kidney tissue lesions, and ginsenoside Rg1 combined with cisplatin improves cisplatin-induced mouse kidney injury, and has a dose-dependent effect. This part shows that ginsenoside Rg1 can alleviate cisplatin-induced acute kidney injury in vivo.

[0019] 3. By using methods such as flow cytometry analysis, Western blot, RT-qPCR, immunofluorescence staining, transmission electron microscopy, etc., the relationship between ginsenoside Rg1 alleviating cisplatin-induced kidney injury and inflammatory response, macrophage polarization, cellular ferroptosis and autophagy is studied. The results show that ginsenoside Rg1 can alleviate cisplatin-induced inflammatory response, reverse the up-regulation of autophagy markers LC3II and Beclin1 caused by cisplatin, and inhibit the formation of autophagic lysosomes, but does not affect macrophage polarization and cannot reduce cisplatin-induced cellular ferroptosis. This part is an exploration of the mechanism of ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury.

[0020] 4. RNA-seq sequencing technology, Western blot, RT-qPCR, etc. are used to detect the changes and target points of possible signal pathway proteins in ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury. The results of this part show that ginsenoside Rg1 can reverse the down-regulation of JAK2, p-JAK2 and p-STAT3 expression and the up-regulation of LCP1 expression induced by cisplatin. Combined with the previous content, this part can show that ginsenoside Rg1 may inhibit cisplatin-induced cellular autophagy by reversing the inhibition of JAK2-STAT3 signaling pathway induced by cisplatin, and thus improve cisplatin-induced acute kidney injury. In addition, LCP1 may be involved.

[0021] The present application first proves that ginsenoside Rg1 has a preventive and protective effect on cisplatin-induced acute kidney injury; proves that ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury is related to cellular autophagy; proposes that the JAK2-STAT3 pathway may be the action pathway of ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury; and proposes that LCP1 may be the action target of ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below.

[0023] Figure 1 Effect of cisplatin on HK2 cell survival rate;

[0024] Figure 2 Effect of ginsenoside Rg1 on HK2 cell survival rate;

[0025] Figure 3 Effect of ginsenoside Rg1 on cisplatin-induced HK2 cell survival rate;

[0026] Figure 4 Effect of ginsenoside Rg1 on cisplatin-induced HK2 cell kidney injury markers detected by Western blot and RT-PCR;

[0027] Figure 5 Ginsenoside Rg1 reduces HK2 cell apoptosis caused by cisplatin;

[0028] Figure 6 Construction of cisplatin-induced acute kidney injury mouse model;

[0029] Figure 7 Ginsenoside Rg1 reverses cisplatin-induced reduction in kidney weight of mice;

[0030] Figure 8 Ginsenoside Rg1 reduces kidney damage caused by cisplatin in mice;

[0031] Figure 9 Effect of ginsenoside Rg1 on serum biochemical indicators of cisplatin-induced acute kidney injury mice;

[0032] Figure 10 Ginsenoside Rg1 reduces cisplatin-induced acute kidney injury in mice;

[0033] Figure 11 Expression of kidney injury markers KIM1 and NGAL;

[0034] Figure 12 Ginsenoside Rg1 reduces kidney cell apoptosis of cisplatin-induced acute kidney injury mice

[0035] Note: Brown particles represent apoptotic cells;

[0036] Figure 13 Ginsenoside Rg1 reverses the expression of apoptotic proteins in cisplatin-induced mice;

[0037] Figure 14To reduce the inflammation of HK2 cells caused by cisplatin by ginsenoside Rg1;

[0038] Figure 15 To reduce the inflammation of kidney cells in cisplatin-induced acute kidney injury mice by ginsenoside Rg1;

[0039] Figure 16 To induce macrophage polarization by IFN-γ and IL-13;

[0040] Figure 17 To not affect macrophage polarization by ginsenoside Rg1;

[0041] Figure 18 To change the ferroptosis in cisplatin-damaged HK2 cells;

[0042] Figure 19 To change the autophagy protein in cisplatin-damaged HK2 cells;

[0043] Figure 20 To detect the changes of autophagy genes in cisplatin-damaged HK2 cells by immunofluorescence staining;

[0044] Figure 21 To detect cisplatin-damaged HK2 cells by transmission electron microscopy, note: M is mitochondria, RER is rough endoplasmic reticulum, and ASS is autophagy lysosome;

[0045] Figure 22 To detect the changes of autophagy proteins in cisplatin-damaged mice by Western blot;

[0046] Figure 23 To detect the changes of autophagy genes in cisplatin-damaged mice by immunofluorescence staining;

[0047] Figure 24 To detect the effects of autophagy inhibitor / activator intervention on cisplatin-damaged HK2 cells by CCK8;

[0048] Figure 25 To detect the effects of autophagy inhibitor / activator intervention on cisplatin-damaged HK2 cells by Western blot;

[0049] Figure 26 To detect the changes of common pathways in cisplatin-damaged HK2 cells by Western blot;

[0050] Figure 27 RNA-seq sequencing analysis; A. GSEA analysis of changes in JAK-STAT signaling axis in cisplatin group (DDP) vs. control group (Control); B. KEGG analysis of the top 20 most significantly enriched pathways in the combination group (DDP+Rg1) vs. cisplatin group (DDP);

[0051] Figure 28 The effect of STAT3 overexpression on HK2 cell apoptosis is: A. STAT3 overexpression; B. STAT3 overexpression reverses the expression of apoptotic proteins; C. STAT3 overexpression increases HK2 cell viability.

[0052] Figure 29 This is a map showing the distribution of differentially expressed genes.

[0053] Figure 30 The mRNA expression of differentially expressed genes in cisplatin-damaged HK2 cells;

[0054] Figure 31 The protein expression of differentially expressed genes in cisplatin-damaged HK2 cells;

[0055] Figure 32 The expression of LCP1 in cisplatin-damaged HK2 cells was detected by fluorescent staining.

[0056] Figure 33 The diagram shows the 3D and 2D results of the docking of ginsenoside Rg1 with LCP1 protein molecules. Detailed Implementation

[0057] This invention provides the application of ginsenoside Rg1 in the preparation of a drug to improve cisplatin-induced kidney injury. In this invention, ginsenoside Rg1 preferably improves cisplatin-induced kidney injury by reversing the upregulation of cisplatin-induced autophagy markers LC3II and Beclin1 and inhibiting the formation of autolysosomes. In this invention, ginsenoside Rg1 preferably improves kidney injury by reversing the inhibition of the cisplatin-induced JAK2-STAT3 signaling pathway. In this invention, ginsenoside Rg1 preferably improves kidney injury by reversing the downregulation of cisplatin-induced JAK2, p-JAK2, and p-STAT3 expression and the upregulation of LCP1 expression. In this invention, the kidney injury preferably includes acute kidney injury. This invention does not impose any particular limitations on the dosage form and preparation method of the drug; conventional methods can be used by those skilled in the art.

[0058] This invention also provides the application of ginsenoside Rg1 in the preparation of a drug to alleviate cisplatin-induced nephrotoxicity in vitro. In this invention, ginsenoside Rg1 preferably reverses the inhibition of renal tubular epithelial cell proliferation by cisplatin. In this invention, the preferred concentration of ginsenoside Rg1 is 50 µmol / L. This invention does not impose any particular limitations on the dosage form or preparation method of the drug; conventional methods can be used by those skilled in the art.

[0059] This invention also provides the application of ginsenoside Rg1 in the preparation of a drug for alleviating cisplatin-induced acute kidney injury in vivo. In this invention, the preferred concentration of ginsenoside Rg1 is 25-50 mg / kg.

[0060] To further illustrate the present application, the present application is described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the present application.

[0061] Example 1

[0062] Effect of ginsenoside Rg1 on cisplatin-induced nephrotoxicity of normal kidney cells (HK2)

[0063] 1.1 Materials and methods

[0064] 1.1.1 Experimental cell lines

[0065] Human renal tubular epithelial cells HK2 were purchased from Guangzhou Yoxin Biotechnology Co., Ltd.

[0066] 1.1.2 Experimental reagents

[0067] Cisplatin was purchased from Shanghai Yuan Ye Biotechnology Co., Ltd. with the product code B24462 and purity ≥98%; ginsenoside Rg1 was purchased from Shanghai Yuan Ye Biotechnology Co., Ltd. with the product code B21057 and HPLC ≥98%; DMEM / F12 medium was purchased from Zhejiang Senrui Biotechnology Co., Ltd.; CCK8 kit was purchased from MCE company; KIM1 (product code ab213477), NGAL (product code ab125075) were purchased from Shanghai Abbi Trade Co., Ltd.; RNA extraction kit, reverse transcription kit were purchased from Nanjing Novozyme Biotech Co., Ltd.; GAPDH (product code 2118S), cleaved-parp (product code 9541S), cleaved-caspase3 (product code 9661S), cleaved-caspase7 (product code 9491S) were purchased from the United States CST; reagents for Western blot were purchased from Beijing Solaybao Technology Co., Ltd.; other reagents and materials (analytical pure and chemical pure) were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.

[0068] 1.1.3 Experimental instruments

[0069] Table 1 Experimental instrument table

[0070] Instrument name Company Vortex mixer Tianyue Electronics Water bath Tianli Medical Instrument Co., Ltd. Cell incubator Thermo Fisher Biosafety cabinet Thermo Fisher Bio-Rad Electrophoresis instrument Bio-Rad Imaging system Nikon, Japan Inverted fluorescence microscope Nikon, Japan Pipette Eppendorf Centrifuge Bio-Rad

[0071] 1.2 Experimental methods

[0072] 1.2.1 Cell culture

[0073] 1) Cell recovery

[0074] Take the cryopreservation tube from the -80°C refrigerator, quickly put it into the 37°C water bath, shake it until it is completely melted, sterilize the cryopreservation tube with 75% ethanol, and add 7 times the volume of complete medium (DMEM / F12 medium containing 10% fetal bovine serum, 1% penicillin-streptomycin) in advance in a 15 mL centrifuge tube, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cells with an appropriate amount of complete medium, transfer them into a T25 culture flask, and culture them in a cell incubator. Replace the medium after the cells adhere, and perform routine culture. The culture conditions are 37°C and 5% carbon dioxide.

[0075] 2) Cell passage

[0076] Perform cell passage every 2-3 days. Absorb the original culture medium in the T25 culture flask, rinse with an appropriate amount of PBS for 2-3 times. After discarding the PBS, trypsinize for 3-5 min, add complete medium to inhibit trypsin activity, collect by repeatedly blowing gently into a 15 mL centrifuge tube, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cells with complete medium, blow gently to disperse them into a single cell suspension, and inoculate the cell suspension into a new culture flask at a ratio of 1:3. Continue to culture.

[0077] 3) Cell cryopreservation

[0078] Take the logarithmic growth phase cells and perform the above operations. After centrifugation, discard the supernatant and add 1 ml of cryopreservation solution to the cells. Resuspend them by pipetting and transfer the cell solution to a cryopreservation tube. Record the cryopreservation time, cell name, cryopreservation method, and cryopreservation solution type. Then, place the cryopreservation tube in a -80°C refrigerator.

[0079] 1.2.2 CCK8 method for detecting HK2 cell survival rate

[0080] After culturing HK2 cells in a 37°C, 5% carbon dioxide incubator for 24 h, trypsinize and count the cells, and inoculate them into a 96-well plate at a cell density of 5000 cells / well. Set up control groups, cisplatin groups (1.25, 2.5, 5, 10, 20 μM), ginsenoside Rg1 groups (6.25, 12.5, 25, 50, 100 μM), and cisplatin + ginsenoside Rg1 combined groups. Each drug concentration is set up in triplicate. After administration, continue to culture in a constant temperature incubator, discard the drug solution and the original culture medium after 24 / 48 / 72 h of action, and add 100 μl of CCK8 working solution (1640 medium:CCK-8=10:1) to each well. Incubate at 37°C for 3-4 h, and then measure the absorbance (OD) value of each well at a wavelength of 450 nm using a microplate reader. Take the average value of each group, and calculate the cell inhibition rate according to the following formula. The experiment is repeated 3 times.

[0081] Cell survival rate (%) = (OD of experimental group - OD of blank group) / (OD of control group - OD of blank group) x 100%

[0082] 1.2.3 Western blot analysis of HK2 cell kidney injury markers and apoptosis-related protein expression

[0083] HK2 cells in the logarithmic growth phase were seeded in a six-well plate at a cell density of 150,000 cells per well and adherently cultured for 24 h. After 24 h of pretreatment with ginsenoside Rg1, cisplatin was added and allowed to act for 48 h. The culture medium was discarded, and the cells were washed with pre-cooled 1x PBS buffer for 3 times. Then, 100-200 μL of lysate diluted 1.5x loading was added to cover the bottom of the six-well plate, mixed, lysed on ice, and carefully scraped off with a cell scraper. The cells were collected in a 1.5 mL EP tube, denatured at 100℃ for 10 min, and stored in a -20℃ refrigerator. The loading gel was prepared according to the molecular weight of the target protein, and then subjected to loading, electrophoresis, membrane transfer, blocking, and antibody incubation. Subsequently, it was exposed to a gel imaging system.

[0084] 1.2.4 RT-qPCR analysis of HK2 cell kidney injury marker mRNA expression

[0085] RNA was extracted according to the RNA extraction kit instructions of Nanjing Nuowezan Company. The reverse transcription reaction solution was prepared in an ice water bath according to the following components: 5x HiScript® II Q RT SuperMix 2 μL; Total RNA 1 μL; RNase free ddH2O 7 μL, and the total system was 10 μL. The reverse transcription reaction program was set as follows: Step 1: 37℃ incubation for 15 min; Step 2: 85℃ incubation for 5 s; Step 3: 4℃ cooling. -20℃ storage for standby. The PCR reaction solution was prepared in an ice water bath according to the following components. 2x ChamQ SYBR qPCR Master Mix 7.5 μL; PCR Forward Primer (10 μM) 1.0 μL; PCR Reverse Primer (10 μM) 1.0 μL; Template cDNA 1.0 μL; RNase Free ddH2O 4.5 μL, and the total system was 15 μL. The real-time fluorescence quantitative PCR was set as follows: Step 1: 95℃ pre-denaturation for 1 min; Step 2: PCR reaction. 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s; 40 Cycles; Step 3: Melting curve analysis from 65-95℃. The experimental results were analyzed by relative quantification 2 -△△Ct method.

[0086] Table 2 primer sequences

[0087] Primer name Sequence GAPDH (human) Forward (SEQ ID No. 1): AATGGACAACTGGTCGTGGAC Reverse (SEQ ID No. 2): CCCTCCAGGGGATCTGTTTG KIM1 (human) Forward (SEQ ID No. 3): CTGCAGGGAGCAATAAGGAG Reverse (SEQ ID No. 4): TCCAAAGGCCATCTGAAGAC NGAL (human) Forward (SEQ ID No. 5): TTGGGACAGGGAAGACGA Reverse (SEQ ID No. 6): TCACGCTGGGCAACATTA

[0088] 1.3 Statistical analysis

[0089] Statistical analysis of experimental data was performed using GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA) software, and the results were expressed as mean ± SD. Normality test was performed first, and t-test was used, P<0.05 was considered statistically significant.

[0090] 1.4 Results

[0091] 1.4.1 Establishment of cisplatin-induced HK2 cell acute kidney injury model

[0092] To determine whether ginsenoside Rg1 alleviates cisplatin-induced kidney injury, a cisplatin-induced in vitro HK2 cell injury model was first constructed. The 24, 48, and 72 h, 1.25, 2.5, 5, 10, and 20 μM cisplatin concentration gradients were selected to act on HK2 cells, and CCK8 experiment was used to determine the optimal modeling conditions of cisplatin-induced kidney cell injury. The experimental results are shown in Figure 1 cisplatin significantly inhibited the proliferation of HK2 cells in a time- and dose-dependent manner, and the IC 50 The results are shown in Table 3, in which the IC 50 of cisplatin after 48 h was 5 μM.

[0093] Table 3 IC values of cisplatin at different action times 50

[0094] Cisplatin action time (h) IC 50 (μM) 24 >20 48 5 72 3

[0095] 1.4.2 Effect of ginsenoside Rg1 on HK2 cell survival rate

[0096] The effect of ginsenoside Rg1 on HK2 cell survival rate was detected by CCK8 method. The experimental results are shown in Figure 2 Ginsenoside Rg1 alone had no significant effect on the proliferation of HK2 cells.

[0097] 1.4.3 Effect of ginsenoside Rg1 on cisplatin-damaged HK2 cell survival rate

[0098] The effect of ginsenoside Rg1 on cisplatin-damaged HK2 cell survival rate was determined by CCK8 method. The experimental results are shown in Figure 3 ​The results showed that different concentrations of ginsenoside Rg1 (12.5, 25, 50, 100 μM) could improve the survival rate of cisplatin-damaged HK2 cells, and the protective effect of ginsenoside Rg1 at a concentration of 50 μM on cisplatin-damaged HK2 cells was the strongest (P < 0.001), proving that ginsenoside Rg1 has a protective effect against cisplatin-induced HK2 cell damage in vitro.

[0099] 1.4.4 Effect of Ginsenoside Rg1 on Markers of Renal Injury in Cisplatin-Induced HK2 Cells

[0100] KIM-1 and NGAL are important in the diagnosis and monitoring of acute kidney injury. Their levels are closely related to the degree of kidney function impairment, and their expression is upregulated when kidney damage occurs.

[0101] First, the expression of KIM-1 and NGAL proteins in an HK2 cell model following cisplatin injury was detected by Western blot. The experimental results are as follows: Figure 4 As shown in Figure A, cisplatin treatment significantly upregulated the expression of KIM1 and NGAL, indicating that cisplatin caused damage to HK2 renal tubular epithelial cells. Ginsenoside Rg1 intervention significantly reduced cisplatin-induced KIM-1 and NGAL protein expression, demonstrating that ginsenoside Rg1 can reverse cisplatin-induced HK2 cell damage. Furthermore, RT-qPCR detection of mRNA gene changes in KIM1 and NGAL in cisplatin-damaged HK2 cells also confirmed that ginsenoside Rg1 can inhibit the significant expression of KIM1 and NGAL in cisplatin-treated HK2 cells (P < 0.001). Figure 4 (B)

[0102] 1.4.5 Effect of ginsenoside Rg1 on cisplatin-induced apoptosis in HK2 cells

[0103] The expression of apoptosis-related proteins cleaved-parp, cleaved-caspase 7, and cleaved-caspase 3 was detected by Western blot. The experimental results are as follows: Figure 5 As shown, the protein expression levels of cleaved-parp, cleaved-caspase7, and cleaved-caspase3 were significantly upregulated in the cisplatin monotherapy group. Simultaneous administration of cisplatin and ginsenoside Rg1 could significantly reverse the upregulation of cleaved-parp, cleaved-caspase7, and cleaved-caspase3 induced by cisplatin monotherapy, indicating that ginsenoside Rg1 can alleviate cisplatin-induced HK2 cell apoptosis.

[0104] Example 2

[0105] Effects of ginsenoside Rg1 on cisplatin-induced acute kidney injury in mice

[0106] 2.1 Materials and methods

[0107] 2.1.1 Experimental animals

[0108] C57BL / 6J male mice (6-8 weeks old, body weight 20-25 g) were purchased from Jiangsu Jizhuangkang Biotechnology Co., Ltd., with license number B202406030368. Animal experiments were strictly conducted in accordance with the requirements of animal ethics.

[0109] 2.1.2 Experimental reagents

[0110] Cisplatin was purchased from Shanghai Yuanye Bio-Technology Co., Ltd. with item number B24462 and purity ≥98%. Ginsenoside Rg1 was purchased from Shanghai Yuanye Bio-Technology Co., Ltd. with item number B21057 and HPLC ≥98%. H&E staining solution kit, PAS staining reagent, and TUNEL kit were purchased from Pinofly Biotech Co., Ltd. Western blot reagents were purchased from Solabio Technology Co., Ltd. GAPDH (item number 2118S), cleaved-parp (item number 9541S), and cleaved-caspase3 (item number 9661S) were purchased from CST, USA. KIM1 (item number ab213477) and NGAL (item number ab125075) were purchased from Shanghai Aibocold Biotech Co., Ltd. RNA extraction kit and reverse transcription kit were purchased from Nanjing Norgen Biotek Corporation. Other reagents and materials (analytical pure and chemical pure) were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0111] 2.1.3 Drug preparation

[0112] Accurately weigh ginsenoside Rg1 powder and prepare a suspension with a concentration of 2.5 mg / mL using 0.5% CMC-Na: 25 mg / kg of ginsenoside Rg1 for the administration group, 5 mg / mL (50 mg / kg of ginsenoside Rg1 for the administration group).

[0113] 2.1.4 Experimental instruments

[0114] Table 4 Experimental instrument table

[0115] Instrument name Company Vortex mixer Tianyue Electronics Water bath Tianli Medical Instrument Co., Ltd. Pathological microtome LEICA Freeze table Wuhan Junjie Electronics Co., Ltd. Tissue flattening machine Zhejiang Jinhua Kodie Equipment Co., Ltd. Photographic microscope Nikon, Japan Embedding machine Wuhan Junjie Electronics Co., Ltd. Decolorization shaker Beijing Liuyi Instrument Factory Electric heating air drying oven Shanghai Guangdi Instrument and Equipment Co., Ltd. Inverted fluorescence microscope Nikon, Japan Centrifuge Bio-Rad

[0116] 2.2 Experimental methods

[0117] The mice were randomly divided into 4 groups according to body weight: control group, cisplatin group-20 mg / kg, cisplatin-20 mg / kg+ginsenoside Rg1-25 mg / kg group, cisplatin-20 mg / kg+ginsenoside Rg1-50 mg / kg group, 6 mice in each group. According to the above grouping, ginsenoside Rg1 was administered by gavage (the control group and cisplatin group were given the corresponding solvent) for 3 consecutive days, once a day. After 3 days, cisplatin 20 mg / kg was injected intraperitoneally (the control group was injected with normal saline of the corresponding volume), and then the corresponding dose of ginsenoside Rg1 was continuously administered for 3 days. The body weight of the mice was recorded every day. On the 7th day, the mice were killed by cervical dislocation, and the changes in the kidneys were observed. The kidneys were divided into two parts, one part was fixed with 4% paraformaldehyde and stored at room temperature for later use. The other part was stored at -80°C for later use. Figure 6 ).

[0118] 2.2.1 Determination of serum renal function indicators

[0119] The divided serum was taken out from the -80°C refrigerator in advance, and after the serum and the detection kit were restored to room temperature, the serum creatinine (CREA) and blood urea nitrogen (Urea) were detected according to the kit instructions.

[0120] 2.2.2 Kidney tissue section

[0121] After the kidney tissue was fixed in 4% paraformaldehyde for 24 h, the tissue was trimmed, dehydrated, embedded and sectioned, stained with H&E, PAS and TUNEL, and observed and photographed under an optical microscope.

[0122] 2.2.3 Western blot analysis of tissue kidney injury markers and apoptosis protein expression

[0123] After the mouse kidney tissue samples were taken out from the -80°C refrigerator, the samples were cut into small pieces with forceps and scissors, and the tissue pieces were transferred to tissue homogenization tubes. Four grinding balls and 1 mL of tissue lysis solution were added to each homogenization tube, and the tissue grinder was set to a homogenization intensity of 100 Hz and a working time of 30 s. After grinding until no tissue debris was left, the samples were lysed on ice for 30 min, centrifuged at 12000 rpm / min at 4°C for 20 min, and the supernatant was collected. The samples were prepared into equal concentration and equal volume protein solutions using a BCA kit, 5xLoading Buffer was added, and the mixture was centrifuged at low speed and denatured on a thermostat at 100°C for 10 min. The resulting protein sample was loaded onto a gel according to the molecular weight of the target protein. The sample was loaded, electrophoresed, transferred to a membrane, blocked, and incubated with antibodies, and then exposed to a gel imaging system.

[0124] 2.2.4 RT-qPCR analysis of tissue renal injury markers and inflammatory factor expression

[0125] RNA was extracted according to the instructions of the RNA extraction kit from Nanjing Novizan Pharmaceutical Co., Ltd. The reverse transcription reaction mixture was prepared in an ice-water bath according to the following composition: 5×HiScript® IIQ RT SuperMix 2 μL; Total RNA 1 μL; RNase-free ddH2O 7 μL, total volume 10 μL. The reverse transcription reaction program was set as follows: Step 1: Incubate at 37℃ for 15 min; Step 2: Incubate at 85℃ for 5 s; Step 3: Cool at 4℃. Store at -20℃ for later use. The PCR reaction mixture was prepared in an ice-water bath according to the following composition: 2×ChamQ SYBR qPCR Master Mix 7.5 μL; PCR Forward Primer (10 μM) 1.0 μL; PCR Reverse Primer (10 μM) 1.0 μL; Template cDNA 1.0 μL; RNase-free ddH2O 4.5 μL, total volume 15 μL. The following parameters were set for real-time quantitative PCR: Step 1: 95℃ pre-denaturation for 1 min; Step 2: PCR reaction. 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s; 40 cycles; Step 3: Melting curve analysis at 65-95℃. Using relative quantitation... -△△Ct The experimental results were analyzed using the method.

[0126] Table 5 Primer sequences

[0127] Primer name Sequence GAPDH (mouse) Forward (SEQ ID No. 7): TGGATTTGGACGCATTGGTC Reverse (SEQ ID No. 8): TTTGCACTGGTACGTGTTGAT KIM1 (mouse) Forward (SEQ ID No. 9): CGACACACAGAACATCGACTCG Reverse (SEQ ID No. 10): AGACCTGCATGTAGCTGTTACG NGAL (mouse) Forward (SEQ ID No. 11): GCAGGTGGTACGTTGTGGG Reverse (SEQ ID No. 12): CTCTTGTAGCTCATAGATGGTGC

[0128] 2.2.5 Statistical Analysis

[0129] The experimental data were statistically analyzed using GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA). The results are expressed as mean ± SD. The normality test was performed first, followed by the t-test. P < 0.05 was considered statistically significant.

[0130] 2.3 Results

[0131] 2.3.1 Effect of ginsenoside Rg1 on body weight in mice with cisplatin-induced acute kidney injury

[0132] like Figure 7As shown, compared with the control group, the body weight of cisplatin-induced acute kidney injury mice showed a significant decrease after receiving cisplatin treatment, and the body weight of mice treated with ginsenoside Rg1 was recovered compared with the cisplatin group (P<0.001).

[0133] 2.3.2 Effect of ginsenoside Rg1 on cisplatin-induced acute kidney injury

[0134] The appearance and morphological changes of the kidney can well reflect the damage and pathological process of the kidney. For example, Figure 8 As shown, the kidneys of the cisplatin single modeling group of mice were shrunk, deformed, and whitish in color, and the degree of whitish color of the kidneys of the cisplatin and ginsenoside Rg1 combined group of mice was significantly alleviated compared with the cisplatin single injection modeling group of mice, and the kidney morphology was more complete and good.

[0135] 2.3.3 Effect of ginsenoside Rg1 on serum biochemical indicators of cisplatin-induced acute kidney injury mice

[0136] Serum creatinine (CREA) and blood urea nitrogen (Urea) are two commonly used indicators for evaluating kidney function in clinical practice. As shown in Table 6, compared with the CREA value of 29.08±5.94 μmol / L and the UREA value of 8.03±0.65 mmol / L of the control group, the CREA and blood urea nitrogen UREA values of the cisplatin single administration group were significantly increased, with a CREA concentration of 144.30±22.41 μmol / L and a UREA concentration of 65.87±7.30 mmol / L. Ginsenoside Rg1 significantly reduced the serum creatinine and blood urea nitrogen levels of cisplatin-injured mice, and the degree of improvement was positively correlated with the ginsenoside Rg1 administration dose. The CREA concentration of the cisplatin+ginsenoside Rg1-25 mg / kg group of mice was 96.23±14.72 μmol / L, and the UREA concentration was 42.45±12.27 mmol / L. The CREA concentration of the cisplatin+ginsenoside Rg1-50 mg / kg group of mice was 75.15±14.24 μmol / L, and the UREA concentration was 35.37±10.88 mmol / L. This indicates that ginsenoside Rg1 significantly reversed the increase in blood biochemical indicators of cisplatin-induced acute kidney injury mice, and significantly alleviated the cisplatin-induced kidney injury in mice (P<0.001). Figure 9 ).

[0137] Table 6 Serum biochemical indicators

[0138] Group CREA (μmol / L) UREA (mmol / L) Ctrl 29.08±5.94 8.03±0.65 DDP 144.30±22.41 65.87±7.30 DDP+Rg1-25mg / kg 96.23±14.72 42.45±12.27 DDP + Rg1-50 mg / kg 75.15±14.24 35.37±10.88

[0139] 2.3.4 Effect of ginsenoside Rg1 on cisplatin-induced acute kidney injury in mice

[0140] AsFigure 10 As shown in FIG. 6, H&E staining results showed that the kidney tissue of the control group presented normal state, and the renal tubular epithelial cells were in good shape and arranged in order. However, the renal tubular epithelial cells of the cisplatin group showed irregular shape, and the cells were shed, accompanied by a series of pathological changes such as renal tubular vacuolar degeneration, renal tubular dilation and necrosis. The PAS staining results showed that the structure of the kidney tissue of the control group was relatively complete, while the complete structure area of the kidney of the model group mice was significantly reduced, and there were slightly dilated renal tubules and swollen renal tubular cells. Therefore, the H&E staining and PAS staining results both showed that the kidney injury of the mice in the cisplatin and ginsenoside Rg1 combined use group was significantly alleviated compared with the cisplatin group.

[0141] 2.3.5 Effect of ginsenoside Rg1 on expression of kidney injury markers KIM1 and NGAL

[0142] Further, the protein level and mRNA gene level expression of kidney injury markers KIM-1 and NGAL were detected by Western blot and RT-PCR, respectively, and the results showed that (FIG. 7) cisplatin caused the expression of mouse kidney injury markers KIM1 and NGAL to increase, and the protein level and mRNA level of kidney injury factors KIM-1 and NGAL in the ginsenoside Rg1 and cisplatin combined use group were significantly lower than those in the cisplatin group, indicating that ginsenoside Rg1 significantly reduced cisplatin-induced acute kidney injury in mice (P<0.001). Figure 11

[0143] 2.3.6 Effect of ginsenoside Rg1 on apoptosis of kidney cells of cisplatin-induced acute kidney injury mice

[0144] TUNEL staining was used to detect the effect of ginsenoside Rg1 on apoptosis of kidney cells of cisplatin-induced acute kidney injury mice. As shown in FIG. 8, compared with the normal control group, the number of TUNEL positive cells in the cisplatin group increased significantly, and the number of positive apoptotic cells in the group of combined use of ginsenoside Rg1 and cisplatin was significantly reduced. This result clearly showed that ginsenoside Rg1 could significantly reduce the apoptosis of kidney cells of cisplatin-induced acute kidney injury mice, suggesting that it might have a kidney protection effect. Figure 12

[0145] ​​And, the expression of cleaved-parp and cleaved-caspase3 was detected by Western blot, the results showed that the expression of cleaved-parp and cleaved-caspase3 was up-regulated in cisplatin model group, and the expression of cleaved-parp and cleaved-caspase3 was inhibited in ginsenoside Rg1 combined with cisplatin group, which indicated that ginsenoside Rg1 could reverse the expression of apoptosis protein in cisplatin injured mice, and could reduce the apoptosis of kidney cells in cisplatin injured mice. Figure 13 ).

[0146] Example 3

[0147] Mechanism exploration of ginsenoside Rg1 improving cisplatin renal injury

[0148] 3.1 Materials and methods

[0149] 3.1.1 Experimental cell lines

[0150] Human renal tubular epithelial cells HK2 were purchased from Guangzhou Yoxin Biotechnology Co., Ltd., and mouse macrophage RAW264.7 were purchased from Shanghai Fuheng Cell Bank.

[0151] 3.1.2 Experimental animals

[0152] C57BL / 6J male mice (6-8 weeks old, body weight 20-25 g) were purchased from Jiangsu Jizhuangong Biotechnology Co., Ltd., and the qualified certificate number was B202406030368. Animal experiments were strictly carried out in accordance with the requirements of animal ethics.

[0153] 3.1.3 Experimental reagents

[0154] Cisplatin was purchased from Shanghai Yuyebio Biotechnology Co., Ltd. with the product code B24462 and purity ≥98%; Ginsenoside Rg1 was purchased from Shanghai Yuyebio Biotechnology Co., Ltd. with the product code B21057 and HPLC ≥98%; DMEM medium and DMEM / F12 medium were purchased from Zhejiang Senrui Biological Technology Co., Ltd.; RNA extraction kit and reverse transcription kit were purchased from Nanjing Novogene Bioinformatics Technology Co., Ltd.; Autophagy inhibitor 3-methyladenine (3-MA), chloroquine (CQ), autophagy activator rapamycin (Rapa), and C11 kit were purchased from Selleck Company; GAPDH (product code 2118S), LC3A / B (product code 12741S), p62 (product code 39749S), Beclin1 (product code 3495S), GPX4 (product code 59735S), and Xct (product code 12691S) were purchased from CST, USA; reagents for Western blot were purchased from Beijing Solabio Science and Technology Co., Ltd.; other reagents and materials (analytical pure and chemical pure) were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.

[0155] 3.1.4 Experimental instruments

[0156] Table 7 Experimental instrument table

[0157] Instrument name Company Vortex mixer Tianyue Electronics Water bath Tianli Medical Instrument Co., Ltd. Cell incubator Thermo Fisher Biosafety cabinet Thermo Fisher Bio-Rad Electrophoresis apparatus Bio-Rad Imaging system Nikon, Japan Inverted fluorescence microscope Nikon, Japan Pipette gun Eppendorf Flow cytometer Bio-Rad Pathological microtome LEICA Freeze table Wuhan Junjie Electronics Co., Ltd. Tissue slice machine Kedi Equipment Co., Ltd., Jinhua, Zhejiang Province Grouping pen Pinofly Biological Decolorization shaker Beijing Liuyi Instrument Factory Centrifuge Bio-Rad

[0158] 3.2 Experimental methods

[0159] 3.2.1 Animal experiment grouping and administration

[0160] The mice were randomly divided into 4 groups according to body weight: control group, cisplatin-20 mg / kg group, cisplatin-20 mg / kg+ginsenoside Rg1-25 mg / kg group, and cisplatin-20 mg / kg+ginsenoside Rg1-50 mg / kg group, with 6 mice in each group. According to the above grouping, ginsenoside Rg1 was administered by gavage for 3 consecutive days once a day (the control group and cisplatin group were given the corresponding solvent). After 3 days, 20 mg / kg of cisplatin was injected intraperitoneally in one dose (the control group was injected intraperitoneally with the corresponding volume of normal saline), and after the injection of cisplatin, the corresponding dose of ginsenoside Rg1 was continued to be administered for 3 consecutive days. The body weight change of the mice was recorded every day. On the 7th day, the mice were taken blood from the eye orbit, the serum was separated and stored at -80 ℃ for use. After the mice were executed by decapitation, the mice were dissected and the changes in the kidneys were observed, and the kidneys were divided into two parts, one part was fixed with 4% paraformaldehyde and stored at room temperature for later use. One part was stored at -80 ℃ for later use.

[0161] 3.2.2 Cell culture

[0162] 1) Cell recovery

[0163] Take out the cryopreservation tube from the -80°C refrigerator, quickly put it into a 37°C water bath, shake it until it is completely melted, sterilize the cryopreservation tube with 75% ethanol, and add 7 times the volume of complete medium (containing 10% fetal bovine serum, 1% penicillin-streptomycin medium) in advance in a 15 mL centrifuge tube. Centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cells with an appropriate amount of complete medium, transfer to a T25 culture flask, and culture in a cell incubator. Replace the medium after the cells adhere, and perform routine culture. The culture conditions are 37°C and 5% carbon dioxide.

[0164] 2) Cell passage

[0165] Perform cell passage every 2-3 days. Absorb the original culture medium in the T25 culture flask, and rinse with an appropriate amount of PBS for 2-3 times. After discarding the PBS, trypsinize for 3-5 min, add complete medium to inhibit trypsin activity, collect by repeatedly blowing gently into a 15 mL centrifuge tube, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cells with complete medium, and blow gently to disperse into a single cell suspension. Then, inoculate the cell suspension into a new culture flask at a ratio of 1:3, and continue to culture.

[0166] 3) Cell cryopreservation

[0167] Take the logarithmic growth phase cells and perform the above operation. After centrifugation, discard the supernatant and add 1 ml of cryopreservation solution to the cells. Resuspend by pipetting gun blowing, transfer the cell solution to a cryopreservation tube, record the cryopreservation time, cell name, cryopreservation method, and cryopreservation solution type. Then, place the cryopreservation tube in a -80°C refrigerator.

[0168] 3.2.3 Western blot

[0169] Take the HK2 cells in the logarithmic growth phase and inoculate them in a six-well plate at a cell density of 150,000 cells per well. After 24 hours of adhesion culture, add cisplatin after 24 hours of pretreatment with ginsenoside Rg1. Discard the culture medium, wash the cells with pre-cooled 1x PBS buffer for 3 times, and then add 100-200 μL of 1.5x loading diluted with lysis buffer to cover the bottom of the six-well plate. Mix well, lyse on ice, and carefully scrape the cells with a cell scraper. Collect them in a 1.5 mL EP tube, denature at 100°C metal bath for 10 min, and store in a -20°C refrigerator. Prepare the loading gel with the corresponding concentration according to the molecular weight of the target protein, load, electrophorese, transfer, block, and incubate with antibodies. Then, expose it in the gel imaging system.

[0170] After the mouse kidney tissue samples were taken out from the refrigerator at-80℃, the samples were cut into small pieces with forceps and scissors, and the tissue pieces were transferred to tissue homogenization tubes. Four grinding balls and 1 mL of tissue lysis solution were added to each homogenization tube, and the tissue grinder was placed in the tissue grinder (programmed at homogenization strength 100 Hz, working time 30 s). After grinding until no tissue fragments were left, the samples were lysed on ice for 30 min, centrifuged at 12000 rpm / min at 4℃ for 20 min, and the supernatant was aspirated. The samples were prepared into protein solutions of equal concentration and equal volume using a BCA kit, 5xLoading Buffer was added, and after mixing, low-speed centrifugation and denaturation at 100℃ on a thermostat for 10 min, the sample proteins were obtained. The sample gel was prepared according to the molecular weight of the target protein, and then the sample was loaded, electrophoresed, transferred, blocked, and incubated with the antibody. Subsequently, the gel imaging system was exposed.

[0171] 3.2.4 RT-qPCR

[0172] HK2 cells and kidney tissue RNA were extracted according to the RNA extraction kit instructions of Nanjing Nuowezan Company. In an ice water bath, the reverse transcription reaction solution was prepared according to the following components: 5xHiScript®ⅡQ RT SuperMix 2 μL; Total RNA 1 μL; RNase free ddH2O 7 μL, total system 10 μL. The reverse transcription reaction program was set as follows: Step 1: 37℃ incubation for 15 min; Step 2: 85℃ incubation for 5 s; Step 3: 4℃ cooling. Store at-20℃ for standby. In an ice water bath, the PCR reaction solution was prepared according to the following components. 2xChamQ SYBR qPCR Master Mix 7.5 μL; PCR Forward Primer (10 μM) 1.0 μL; PCR Reverse Primer (10 μM) 1.0 μL; Template cDNA 1.0 μL; RNase Free ddH2O 4.5 μL, total system 15 μL. The real-time fluorescence quantitative PCR was set as follows: Step 1: 95℃ pre-denaturation for 1 min; Step 2: PCR reaction. 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s; 40 Cycles; Step 3: Melting curve analysis 65-95℃. The experimental results were analyzed by relative quantification 2 -△△Ct method.

[0173] Table 8 primer sequence list

[0174] Primer name Sequence GAPDH Forward (SEQ ID No. 13): AATGGACAACTGGTCGTGGAC Reverse (SEQ ID No. 14): CCCTCCAGGGGATCTGTTTG IL-6 Forward (SEQ ID No. 15): AAGCCAGAGCTGTGCAGATGAGTA Reverse (SEQ ID No. 16): TGTCCTGCAGCCACTGGTTC IL-10 Forward (SEQ ID No. 17): TAAGGCTGGCCACACTTGAG Reverse (SEQ ID No. 18): GTTTTCAGGGATGAAGCGGC TNF-α Forward (SEQ ID No. 19): GGCAGGTTCTGTCCCTTTCA Reverse (SEQ ID No. 20): GGTGGTTTGTGAGTGTGAG iNOS Forward (SEQ ID No. 21): CAGGGAGAACAGTACATGAACAC Reverse (SEQ ID No. 22): TTGGATACACTGCTACAGGGA YM1 Forward (SEQ ID No. 23): CAAAGAACAGTAGATCCTGGCAA Reverse (SEQ ID No. 24): ATACCGTGTCCAGACCTTGGT

[0175] 3.2.5 Effect of ginsenoside Rg1 on polarization of RAW264.7 macrophages

[0176] First, IFN-γ was used to induce RAW264.7 macrophages to polarize to M1 type and IL-13 was used to induce RAW264.7 macrophages to polarize to M2 type, and 24 hours later, the macrophage RNA was collected for RT-qPCR detection of the mRNA gene expression levels of M1 macrophage marker iNOS and M2 marker YM1, to verify whether the macrophage polarization was successful. Subsequently, in the system in which the macrophages were confirmed to have been successfully polarized after the addition of IFN-γ and IL-13 for 24 hours, ginsenoside Rg1 was added to study the effect of ginsenoside Rg1 on the M1 or M2 polarization of macrophages.

[0177] 3.2.6 Effect of ginsenoside Rg1 on cisplatin-induced ferroptosis of HK2 cells

[0178] HK2 cells in the logarithmic growth phase were seeded in a six-well plate at a cell density of 150,000 cells per well, adherent culture for 24 hours, and then ginsenoside Rg1 was added for 24 hours of pretreatment, followed by the addition of cisplatin for 48 hours of action. The culture medium was discarded, and the cells were washed with pre-cooled 1×PBS buffer for 3 times, and then trypsin was added to dissociate the cells to prepare a single cell suspension. Centrifugation was performed at 4°C for 3-5 minutes at 1000 g, and then the supernatant was discarded. PBS was used for washing for 2 times, each for 5 minutes. 1 mL of BODIPY 581 / 591 C11 working solution was added, and incubation was performed at room temperature for 30 minutes. Centrifugation was performed at 4°C for 3-4 minutes at 400 g, and then the supernatant was discarded. PBS was used for washing for 2 times, each for 5 minutes. The cells were resuspended in PBS, and the results of C11 dye staining of HK2 cells were analyzed by flow cytometry.

[0179] 3.2.7 Effect of ginsenoside Rg1 on cisplatin-induced autophagy by immunofluorescence method

[0180] HK2 cells in the logarithmic growth phase were seeded in a six-well plate at a cell density of 150,000 cells per well, adherent culture for 24 hours, and then ginsenoside Rg1 was added for 24 hours of pretreatment, followed by the addition of cisplatin for 48 hours of action. The culture medium was discarded, and the cells were washed with pre-cooled 1×PBS buffer for 3 times, and then the immunofluorescence was detected according to the following steps:

[0181] 1) Cell fixation: add 1 mL of 4% paraformaldehyde to each dish, and stand at room temperature for 30 minutes, and then wash with PBS for 3 times, each for 10 minutes;

[0182] 2) Cell membrane permeation: add 1 mL of 0.5% Triton-X100 to each dish, and stand at room temperature for 15 minutes of membrane permeation, and then wash with PBS for 3 times, each for 10 minutes;

[0183] 3) Protein blocking: add 1 mL of 5% BSA to each dish, and block on a shaker at room temperature for 1 hour;

[0184] 4) Primary antibody incubation: dilute primary antibody at 1:2000, add 400 μL per dish, incubate at room temperature for 1 h on a shaker, wash with PBS for 3 times, 10 min per time;

[0185] 5) Secondary antibody incubation: dilute fluorescent secondary antibody at 1:400, add 1 mL per dish, incubate at room temperature for 1 h on a shaker in the dark, wash with PBS for 3 times, 10 min per time;

[0186] 6) DAPI staining: add 400 μL DAPI staining solution per dish, stain at room temperature for 15 min on a shaker in the dark, wash with PBS for 3 times, 10 min per time;

[0187] 7) Laser confocal observation.

[0188] After the kidney tissue was fixed in 4% paraformaldehyde for 24 h, the tissue was smoothed, dehydrated, embedded and sectioned, immunofluorescence staining was performed, and optical microscope observation was performed for photographing.

[0189] 3.2.8 Plasmid transfection

[0190] pCMV-mCherry-GFP-LC3B (D2816 purchased from Shanghai Biyun Tian, strictly according to the manufacturer's transfection instructions, use lip8000 (product number C0533; Biyun Tian Biotechnology) to transfect pCMV-mCherry-GFP-LC3B (20 MOI / mL) into cells, then give the corresponding concentration of ginsenoside Rg1 / cisplatin to treat the cells. The cells were fixed with 4% paraformaldehyde, then washed with PBS and permeabilized with 0.3% Triton X-100. After the cells were stained with DAPI, they were mounted with nail polish, and photographed with a laser confocal fluorescence microscope. One yellow spot represents an autophagosome, and a red spot (mCherry) represents an autolysosome.

[0191] 3.2.9 Effect of autophagy inhibitor / activator on ginsenoside Rg1 improving cisplatin damage to HK2 cells

[0192] Take HK2 cells in the logarithmic growth phase, adhere to culture for 24 h, and seed in a 96-well plate at a cell density of 5000 cells per well and in a 6-well plate at a cell density of 150000 cells per well. After 24 h of pretreatment with 10 μM of 3-MA, CQ, Rapa, and ginsenoside Rg1, respectively, cisplatin was added for 48 h. CCK8 method was used to detect the cell proliferation rate in the 96-well plate; the cell proteins in the 6-well plate were collected and Western blot was used to detect protein expression.

[0193] 3.3 Statistical analysis

[0194] Statistical analysis of experimental data was performed using GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA) software, and the results were expressed as mean ± SD. Normality test was performed first, and t-test was used. P < 0.05 was considered statistically significant.

[0195] 3.4 Results

[0196] 3.4.1 Effect of ginsenoside Rg1 on inflammation response of HK2 cells induced by cisplatin

[0197] As shown in Fig. 3A, the mRNA expression levels of inflammatory factors IL-6, IL-10 and TNF-a were up-regulated in the cisplatin group, while ginsenoside Rg1 significantly reversed the up-regulation induced by cisplatin (P < 0.01), indicating that ginsenoside Rg1 can alleviate the inflammation response of HK2 cells induced by cisplatin. Figure 14 3.4.2 Effect of ginsenoside Rg1 on inflammation response of kidney in cisplatin-induced acute kidney injury mice

[0198] As shown in Fig. 3B, cisplatin caused the expression of inflammatory factors IL-6, IL-10 and TNF-a in the kidney tissue of mice to increase, and ginsenoside Rg1 can inhibit the expression of inflammatory factors in cisplatin-induced acute kidney injury mice, and alleviate the inflammation response of the kidney (P < 0.001).

[0199] Figure 15 3.4.3 Ginsenoside Rg1 alleviates cisplatin-induced acute kidney injury is not related to macrophage polarization

[0200] As shown in Fig. 3C, after IFN-γ and IL-13 were used for 24 h, the expressions of iNOS and YM1 in HK2 cells were increased, indicating that the M1 and M2 type polarization models of macrophages induced by IFN-γ and IL-13 were successful.

[0201] Figure 16 As shown in Fig. 3D, compared with the IFN-γ or IL-13 alone group, the expression of the combined group did not change significantly, indicating that ginsenoside did not show the effect of promoting or inhibiting the polarization of macrophages whether M1 type or M2 type, that is, ginsenoside Rg1 does not affect the polarization process of macrophages.

[0202] Figure 17 As shown in Fig. 3E, the expression of ferritin in the kidney tissue of cisplatin-induced acute kidney injury mice was increased, and ginsenoside Rg1 can inhibit the expression of ferritin in cisplatin-induced acute kidney injury mice, indicating that ginsenoside Rg1 can alleviate the acute kidney injury induced by cisplatin, and this effect is not related to cell ferroptosis.

[0203] 3.4.4 Ginsenoside Rg1 alleviates cisplatin-induced acute kidney injury is not related to cell ferroptosis

[0204] As shown in Fig. 3E, the expression of ferritin in the kidney tissue of cisplatin-induced acute kidney injury mice was increased, and ginsenoside Rg1 can inhibit the expression of ferritin in cisplatin-induced acute kidney injury mice, indicating that ginsenoside Rg1 can alleviate the acute kidney injury induced by cisplatin, and this effect is not related to cell ferroptosis. Figure 18 ​​The results showed that the lipid peroxidation reaction of the cisplatin single-drug group cells was more than 80% higher than that of the control group, indicating that the ferroptosis phenomenon occurred in HK2 cells after cisplatin treatment. However, the reduction of lipid peroxidation reaction after the intervention of ginsenoside Rg1 was only about 6% compared with the cisplatin group, indicating that ginsenoside Rg1 did not alleviate the ferroptosis phenomenon of HK2 cells after cisplatin damage. Western blot detection of ferroptosis markers GPX4 and xct protein expression also showed that GPX4 and xct protein were significantly up-regulated in the cisplatin group and the combined group, but ginsenoside Rg1 combined with cisplatin did not reverse the up-regulation of GPX4 and xct protein expression in the cisplatin single-drug group. In summary, ginsenoside Rg1 cannot inhibit cisplatin-induced ferroptosis in HK2 cells, and the alleviation of cisplatin-induced acute kidney injury by ginsenoside Rg1 is not related to cell ferroptosis.

[0205] 3.4.5 Ginsenoside Rg1 inhibits cisplatin-induced autophagy in HK2 cells

[0206] As Figure 19 The results showed that LC3II and Beclin1 were significantly up-regulated in the cisplatin administration group, suggesting that cisplatin induced autophagy in HK2 cells, and their expression was significantly inhibited after ginsenoside Rg1 administration. The expression of p62 was significantly down-regulated in the cisplatin administration group, and was up-regulated after ginsenoside Rg1 administration. The above results showed that the administration of ginsenoside Rg1 can significantly inhibit cisplatin-induced autophagy in HK2 cells.

[0207] The results of immunofluorescence staining were consistent with western blot, LC3II was up-regulated in the cisplatin group, and ginsenoside Rg1 could reverse the cisplatin-induced LC3II ( Figure 20 ), suggesting that ginsenoside Rg1 can inhibit cisplatin-induced autophagy in HK2 cells. In order to further observe the autophagy flow, we used Ad-mCherry-GFP-LC3B for immunofluorescence detection. The cisplatin single-drug group increased the number of autophagosomes and autolysosomes, and ginsenoside Rg1 significantly reduced this phenomenon ( Figure 21 ). In addition, transmission electron microscopy was used to observe the cell structure of HK2 cells damaged by cisplatin, and the results showed that ( Figure 22 ) autolysosomes appeared in the cisplatin single-drug group, and the structure of mitochondria was damaged, while in the cisplatin and ginsenoside Rg1 combined group, autolysosomes (ASS) were reduced, and the damage to mitochondria was recovered, proving that autophagy occurred in HK2 cells after cisplatin-induced damage, and ginsenoside Rg1 can effectively inhibit cisplatin-induced autophagy in HK2 cells.

[0208] 3.4.6 Ginsenoside Rg1 inhibits autophagy in cisplatin-induced acute kidney injury mice

[0209] As Figure 23As shown, Western blot analysis was performed on the expression levels of autophagy-related proteins LC3, p62, and Beclin1 in a cisplatin-induced acute kidney injury mouse model. The results were consistent with in vitro cell experiments. LC3II and Beclin1 expression was significantly upregulated in the cisplatin-only model group, while the expression of LC3II and Beclin1 was reversed under ginsenoside Rg1 intervention. Simultaneously, p62 expression was downregulated in the cisplatin group, but upregulated under ginsenoside Rg1 intervention. These results indicate that ginsenoside Rg1 can significantly inhibit autophagy in cisplatin-induced acute kidney injury mice.

[0210] 3.4.7 Autophagy Inhibitor / Activator Effect: Ginsenoside Rg1 Reduces the Effect of Cisplatin on HK2 Cell Damage

[0211] The results show that ( Figure 24 The proliferation inhibition of cisplatin-induced HK2 cells was improved under the induction of autophagy inhibitors 3-MA and CQ; simultaneously, the proliferation rate of HK2 cells was further reduced under the induction of the autophagy activator Rapa, suggesting that the proliferation inhibition of cisplatin-induced HK2 cells is related to autophagy. Furthermore, the improvement of the proliferation inhibition of HK2 cells by autophagy inhibitors and the proliferation inhibition effect of autophagy activators were further enhanced under the action of ginsenoside Rg1, indicating that the improvement of cisplatin-induced HK2 cell damage by ginsenoside Rg1 is related to the inhibition of cisplatin-induced autophagy.

[0212] Furthermore, Western blot analysis was used to detect the expression level of the autophagy marker LC3 protein in cisplatin-damaged HK2 cells under the involvement of autophagy inhibitors / autophagy activators. The results showed that ( Figure 25 LC3II protein was upregulated in the cisplatin group. Comparing LC3II expression in the cisplatin group, LC3II expression was downregulated under autophagy inhibitor induction and upregulated under autophagy activator induction. However, LC3II expression was reversed under ginsenoside Rg1 intervention. In summary, combined with CCK8 and WB results, this indicates that ginsenoside Rg1 can restore autophagy in cisplatin-damaged HK2 cells induced by autophagy inhibitors / activators, and that ginsenoside Rg1 can alleviate cisplatin damage by acting on HK2 cells through autophagy.

[0213] In conclusion, it can be shown that ginsenoside Rg1 alleviates cisplatin-induced acute kidney injury through autophagy.

[0214] Example 4

[0215] Research on the signaling pathway and target of ginsenoside Rg1 in improving cisplatin-induced kidney injury

[0216] 4.1 Materials and Methods

[0217] 4.1.1 Experimental cell lines

[0218] Human renal tubular epithelial cells HK2 were purchased from Guangzhou Yoxin Biotechnology Co., Ltd.

[0219] 4.1.2 Experimental reagents

[0220] Cisplatin was purchased from Shanghai Yuan Ye Biotechnology Co., Ltd. with the item number B24462 and purity ≥98%; Ginsenoside Rg1 was purchased from Shanghai Yuan Ye Biotechnology Co., Ltd. with the item number B21057 and HPLC ≥98%; DMEM / F12 culture medium was purchased from Zhejiang Senrui Biotechnology Co., Ltd.; CCK8 kit was purchased from MCE company; RNA extraction kit and reverse transcription kit were purchased from Nanjing Novozyme Biotech Co., Ltd.; GAPDH (item number 2118S), p-mTOR (item number 5536S), mTOR (item number 2983S), p-stat6 (item number 56554S), stat6 (item number 5397S), p-Akt (item number 4060S), Akt (item number 9272S), PI3K (item number 4249S), Nrf2 (item number 12721S), Keap1 (item number 8047S), Arg2 (item number 40503S), p-STAT3 (item number 4113), STAT3 (item number 9139S), p-JAK2 (item number 3776S), LC3A / B (item number 12741S), p62 (item number 39749S), Beclin1 (item number 3495S), cleaved-PARP (item number 9541S), LCP1 (item number 9541S) were all purchased from CST, USA; JAK2 (item number ab32101), MAP2 (item number ab183830), CRLF2 (item number ab109626), IL7R (item number ab314106) were all purchased from Shanghai Abbiotec Trading Co., Ltd.; Western blot reagents were purchased from Beijing Solabio Science and Technology Co., Ltd.; Other reagents and materials (analytical pure and chemical pure) were all purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.

[0221] 4.1.3 Experimental instruments

[0222] Table 9 Experimental instrument table

[0223] Instrument name Company Vortex mixer Tianyue Electronics Water bath Tianli Medical Instrument Co., Ltd. Cell incubator Thermo Fisher Biosafety cabinet Thermo Fisher Bio-Rad Electrophoresis apparatus Bio-Rad Imaging system Nikon, Japan Inverted fluorescence microscope Nikon, Japan Pipette gun Eppendorf Centrifuge Bio-Rad

[0224] 4.2 Experimental methods

[0225] 4.2.1 Cell culture

[0226] 1) Cell recovery

[0227] Take the cryopreservation tube from the -80°C refrigerator, quickly put it into the 37°C water bath, shake it until it is completely melted, sterilize the cryopreservation tube with 75% ethanol, and add 7 times the volume of complete medium (containing 10% fetal bovine serum, 1% penicillin-streptomycin medium) in a 15 mL centrifuge tube in advance, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cells with an appropriate amount of complete medium, and then transfer them into a T25 culture bottle, which is cultured in a cell incubator. After adhering, change the liquid and carry out routine culture. The culture conditions are 37°C and 5% carbon dioxide.

[0228] 2) Cell passage

[0229] Cell passage is performed every 2-3 days. The original culture medium in the T25 culture bottle is aspirated and washed with an appropriate amount of PBS for 2-3 times. After discarding the PBS, trypsin digestion is performed for 3-5 min, complete medium is added to inhibit trypsin activity, and the cells are collected by repeatedly blowing and collecting into a 15 mL centrifuge tube, which is centrifuged at 1000 rpm / min for 5 min. The supernatant is discarded, and the cells are resuspended with complete medium. The cells are dispersed into a single cell suspension by gently blowing, and then the cell suspension is inoculated into a new culture bottle at a ratio of 1:3 for continuous culture.

[0230] 3) Cell cryopreservation

[0231] Take the log phase cells and operate as above. After centrifugation, 1 ml of cryopreservation solution is added to the cells with discarded supernatant, and the cells are resuspended by pipette blowing. The cell solution is transferred to a cryopreservation tube, and the cryopreservation time, cell name, cryopreservation method, and cryopreservation solution type are recorded. Then, the cryopreservation tube is placed in a -80°C refrigerator.

[0232] 4.2.2 Western blot

[0233] HK2 cells in the log phase were inoculated in a six-well plate at a cell density of 150,000 cells per well, and adherent culture was performed for 24 h. After 24 h of pretreatment with ginsenoside Rg1, cisplatin was added for 48 h. The culture medium was discarded, the cells were washed with pre-cooled 1x PBS buffer for 3 times, 100-200 μL of 1.5x loading diluted with lysis buffer was added to cover the bottom of the six-well plate, and the mixture was mixed, lysed on ice, and carefully scraped off with a cell scraper. The cells were collected in a 1.5 mL EP tube, denatured at 100°C for 10 min, and stored in a -20°C refrigerator. The loading gel was prepared according to the molecular weight of the target protein, and then the sample was loaded, electrophoresed, transferred, blocked, and incubated with the antibody. Subsequently, the gel imaging system was exposed.

[0234] 4.2.3 RT-qPCR

[0235] RNA was extracted according to the instructions of the RNA extraction kit of Nanjing Nuo Weizan Company. The reverse transcription reaction solution was prepared by dispensing the following components in an ice water bath: 5x HiScript® II Q RT SuperMix 2 μL; Total RNA 1 μL; RNase free ddH2O 7 μL, and the total system was 10 μL. The reverse transcription reaction program was set as follows: Step 1: incubation at 37°C for 15 min; Step 2: incubation at 85°C for 5 s; Step 3: cooling at 4°C. Store at -20°C for standby. The PCR reaction solution was prepared by dispensing the following components in an ice water bath. 2x ChamQ SYBR qPCR Master Mix 7.5 μL; PCR Forward Primer (10 μM) 1.0 μL; PCR Reverse Primer (10 μM) 1.0 μL; Template cDNA 1.0 μL; RNase Free ddH2O 4.5 μL, and the total system was 15 μL. The following parameters were set for real-time fluorescent quantitative PCR: Step 1: pre-denaturation at 95°C for 1 min; Step 2: PCR reaction. Denaturation at 95°C for 15 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; 40 cycles; Step 3: melting curve analysis at 65-95°C. The experimental results were analyzed by relative quantification 2 -△△Ct method.

[0236] Table 10 primer sequence list

[0237] Primer name Sequence GAPDH Forward (SEQ ID No. 25): AATGGACAACTGGTCGTGGAC Reverse (SEQ ID No. 26): CCCTCCAGGGGATCTGTTTG LCP1 Forward (SEQ ID No. 27): GATCAGTGTCCGATGAGGAAATG Reverse (SEQ ID No. 28): CCAGATCACCTGTAGCCATCA MAP2 Forward (SEQ ID No. 29): CTCAGCACCGCTAACAGAGG Reverse (SEQ ID No. 30): CATTGGCGCTTCGGACAAG CRLF2 Forward (SEQ ID No. 31): AGTGACGGTGACGTGTTCTG Reverse (SEQ ID No. 32): CTATGGTGACGTTGCAGGTATT IL7R Forward (SEQ ID No. 33): CCCTCGTGGAGGTAAAGTGC Reverse (SEQ ID No. 34): CCTTCCCGATAGACGACACTC NEBL Forward (SEQ ID No. 35): AGAGGCTTTACTCCCGTCGT Reverse (SEQ ID No. 36): ACCCCTTTATAGGCAGCATCG AOX1 Forward (SEQ ID No. 37): TGTCGATCCTGAAACAATGCTG Reverse (SEQ ID No. 38): GGTGATGGGGTTGTATCGTGA POSTN Forward (SEQ ID No. 39): CTCATAGTCGTATCAGGGGTCG Reverse (SEQ ID No. 40): ACACAGTCGTTTTCTGTCCAC CSF2 Forward (SEQ ID No. 41): GCTGTCTACGTCGGGATGC Reverse (SEQ ID No. 42): GACCATGCGATCCACCTCTC

[0238] 4.2.4 Immunofluorescence detection

[0239] HK2 cells in the logarithmic growth phase were seeded in a six-well plate at a cell density of 150,000 cells per well, and adherent culture was performed for 24 h. After 24 h of pretreatment with ginsenoside Rg1, cisplatin was added and acted for 48 h. The culture medium was discarded, and the cells were washed with pre-cooled 1x PBS buffer solution for 3 times, 10 min each time, and the immunofluorescence was detected according to the following steps:

[0240] 1) Cell fixation: add 1 mL of 4% paraformaldehyde to each dish, stand at room temperature for 30 min, and wash with PBS for 3 times, 10 min each time;

[0241] 2) Cell membrane permeation: add 1 mL of 0.5% Triton-X100 to each dish, stand at room temperature for 15 min, and wash with PBS for 3 times, 10 min each time;

[0242] 3) Protein blocking: add 1 mL of 5% BSA to each dish, and block on a shaker at room temperature for 1 h;

[0243] 4) Primary antibody incubation: dilute the primary antibody at 1:2000, add 400 μL per dish, incubate on a shaker at room temperature for 1 h, wash with PBS for 3 times, 10 min per time;

[0244] 5) Secondary antibody incubation: dilute the fluorescent secondary antibody at 1:400, add 1 mL per dish, incubate on a shaker at room temperature for 1 h, avoid light, wash with PBS for 3 times, 10 min per time;

[0245] 6) DAPI staining: add 400 μL DAPI staining solution per dish, stain on a shaker at room temperature for 15 min, avoid light, wash with PBS for 3 times, 10 min per time;

[0246] 7) Laser confocal observation.

[0247] 4.2.5 Plasmid transfection

[0248] STAT3 plasmid was purchased from Weizhen Biotechnology Co., Ltd. After transfection into cells according to the manufacturer's instructions, the corresponding concentration of ginsenoside Rg1 / cisplatin was administered for treatment, and the samples were extracted for detection.

[0249] 4.2.6 Differential gene analysis

[0250] Logarithmic growth HK2 cells were seeded in a six-well plate at a cell density of 150,000 cells per well, and adherent culture was performed for 24 h. After 24 h of pretreatment with ginsenoside Rg1, cisplatin was added for 48 h. The culture medium was discarded, and the cells were washed with pre-cooled 1xPBS buffer for 3 times. 500 μL of TRIZOL reagent was added, and the TRIZOL reagent was allowed to fully contact the cells by grinding every 4 min at room temperature for 8 min. When a jelly-like solution appeared, the TRIZOL lysate was collected into a 1.5 mL sterile centrifuge tube, which was stored at -80 °C for RNA-seq transcriptome sequence determination and differential gene analysis.

[0251] 4.2.7 Molecular docking

[0252] The PDB of the best protein structure of the target point was screened for molecular docking using the Uniport database, the molecular structure of ginsenoside Rg1 was searched using the PubChem25 database, the MOL2 format was downloaded, and molecular docking was performed using PyMOL.

[0253] 4.3 Experimental results

[0254] 4.3.1 Ginsenoside Rg1 reverses the changes in the JAK2-STAT3 signaling pathway caused by cisplatin

[0255] To clarify the effect of ginsenoside Rg1 on the related pathway proteins of cisplatin-induced acute kidney injury, according to the previous mechanism exploration results, the conventional related signaling pathways were first detected, and the Western blot technique was used to detect the protein expression changes of JAK-STAT, PI3K-AKT and other related classical signaling pathways in HK2 cells under the action of ginsenoside Rg1 and cisplatin. The results showed that mTOR, STAT6, Akt, PI3K, Nrf2, etc. had no obvious change in cisplatin-induced acute kidney injury, JAK2-STAT3 was significantly down-regulated in the cisplatin administration group, and ginsenoside Rg1 could reverse its down-regulation Figure 26 ).

[0256] 4.3.2 RNA-seq sequencing analysis of HK2 cells under the action of ginsenoside Rg1 and cisplatin

[0257] According to the RNA-seq sequencing result analysis of cisplatin-damaged HK2 cells, the GSEA analysis and KEGG enrichment results also confirmed the results of “4.3.1.” ( Figure 27 ). In summary, ginsenoside Rg1 can significantly reverse the down-regulation of the JAK2-STAT3 signaling pathway induced by cisplatin.

[0258] 4.3.3 Effect of STAT3 overexpression on the reversal of ginsenoside Rg1 on cisplatin-induced HK2 cell apoptosis

[0259] Next, the role of the JAK2-STAT3 signaling pathway in cisplatin-induced acute kidney injury was further explored. First, STAT3 was overexpressed in the cisplatin-damaged HK2 cell model, and then Western blot was used to observe the effect of STAT3 overexpression on the apoptosis-related protein clevead-parp in cisplatin-induced acute kidney injury and its changes. The experimental results are shown in Figure 28 B, compared with the group with normal expression of STAT3, STAT3 overexpression, like ginsenoside Rg1, reversed the apoptosis protein of HK2 cells caused by cisplatin. The CCK8 results also showed that STAT3 overexpression could improve the proliferation inhibition of HK2 cells by cisplatin and further enhance the improvement of ginsenoside Rg1 on the proliferation inhibition of cisplatin. This indicates that STAT3 overexpression can reverse the apoptosis of HK2 cells induced by cisplatin, and the improvement of ginsenoside Rg1 on cisplatin-induced liver injury is related to its intervention on STAT3 expression.

[0260] 4.3.4 Analysis of the target points of ginsenoside Rg1 in reversing cisplatin-induced HK2 cell injury

[0261] Having identified that JAK-STAT3 is involved in ginsenoside Rg1 reversing cisplatin-induced acute kidney injury, the next step is to further explore the possible target involved therein. RNA-seq transcriptome sequencing technology is used to analyze cisplatin-damaged HK2 cells. For each two groups of samples, the differential gene results are shown in Table 11. The results show that, compared with the cisplatin single-drug group, the total differential genes of the ginsenoside Rg1 combined with cisplatin group are 1029, of which 465 are up-regulated genes and 564 are down-regulated genes Figure 29 ).

[0262] Table 11 Differential gene statistics table

[0263] DEG_Group Up Down Total DDP_vs_Control 232 92 324 DDP-Rg1_vs_Control 1181 868 2049 DDP-Rg1_vs_DDP 465 564 1029 Rg1_vs_Control 274 535 809 Rg1_vs_DDP-Rg1 178 730 908 Rg1_vs_DDP 298 461 759

[0264] Further analysis of the differential genes, referring to the differential gene expression statistics of the two groups and the control group, and the expression of the genes in the ginsenoside Rg1 single-drug group, the expression of the genes in the four groups is calculated comprehensively. Finally, LCP1, CRLF2, IL7R, MAP2, POSTN, CSF2, NEBL, and AOX2 are selected for subsequent experimental verification. RT-qPCR technology is used to detect the expression of the eight genes in the cisplatin-damaged HK2 cell model. Among them, the experimental results of LCP1, CRLF2, IL7R, and MAP2 are consistent with the sequencing results, and the gene expression after ginsenoside Rg1 intervention has a significant difference with the cisplatin single-drug group Figure 30 ).

[0265] Next, Western blot technology is used to further verify the protein expression of the four genes in cisplatin-damaged HK2 cells. Among them, only the experimental results of LCP1 show that LCP1 is significantly up-regulated in the cisplatin group and is reversed under the pretreatment of ginsenoside Rg1. Therefore, it is speculated that LCP1 may be involved in the process of ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury Figure 31 ).

[0266] 4.3.5 Effect of LCP1 on ginsenoside Rg1 alleviating cisplatin-induced acute kidney injury

[0267] Immunofluorescence staining technology is used to detect the expression of LCP1 gene in cisplatin-damaged HK2 cells. The experimental results are consistent with the Western Blot results, and LCP1 is up-regulated in the cisplatin single-drug group, and ginsenoside Rg1 can inhibit its expression in HK2 cells after cisplatin damage Figure 32 ).

[0268] 4.3.6 Molecular docking

[0269] The molecular docking results show that Figure 33), the lowest docking score of LCP1 protein and receptor ginsenoside Rg1 is-6.3 kcal / mol, the conformation with the lowest docking score shows that ginsenoside Rg1 is combined in the hydrophilic surface pocket of the protein of LCP, ARG87, LYS113, CYS109, TYR89 in LCP1 produce hydrogen bond interaction with ginsenoside Rg1, which makes ginsenoside Rg1 have strong binding force with M1 protein. In addition, CYS109 also forms alkyl interaction force (hydrophobic bond force) with ginsenoside Rg1. In summary, ginsenoside Rg1 can relieve cisplatin-induced acute kidney injury by regulating the expression of LCP1.

[0270] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Use of ginsenoside Rg1 in the preparation of a drug for improving cisplatin-induced kidney injury.

2. Use according to claim 1, characterized in that, The ginsenoside Rg1 improves cisplatin-induced kidney injury by reversing the up-regulation of autophagy markers LC3II and Beclin1 and inhibiting the formation of autophagic lysosomes caused by cisplatin.

3. Use according to claim 1, characterized in that, The ginsenoside Rg1 improves kidney injury by reversing the inhibition of the JAK2-STAT3 signaling pathway induced by cisplatin.

4. Use according to claim 1, characterized in that, The ginsenoside Rg1 improves kidney injury by reversing the down-regulation of JAK2, p-JAK2, and p-STAT3 expression and the up-regulation of LCP1 expression induced by cisplatin.

5. The use according to claim 1, characterized in that, The kidney injury includes acute kidney injury.

6. Use of ginsenoside Rg1 in the preparation of a drug for relieving cisplatin-induced nephrotoxicity in vitro.

7. Use according to claim 6, characterized in that, The ginsenoside Rg1 reverses the inhibition of renal tubular epithelial cell proliferation caused by cisplatin.

8. Use according to claim 6 or 7, characterized in that, The concentration of the ginsenoside Rg1 used is 50 µmol / L.

9. Use of ginsenoside Rg1 in the preparation of a drug for relieving cisplatin-induced acute kidney injury in vivo.

10. Use according to claim 9, characterized in that, The concentration of the ginsenoside Rg1 used is 25-50 mg / kg.

Citation Information

Patent Citations

  • Composition for relieving oxidative stress, nano-particles and application of composition and nano-particles

    CN119970769A