Zmkob1 gene and application thereof in regulating maize lodging resistance
By regulating the expression level of the ZmKOB1 gene in maize plants and using CRISPR/Cas9 gene editing technology, the problem of maize lodging was solved, resulting in thicker stems and improved lodging resistance, thus increasing maize yield and quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
- Filing Date
- 2025-12-24
- Publication Date
- 2026-05-12
AI Technical Summary
The problem of corn lodging seriously affects yield and quality, and existing technologies are insufficient to effectively improve the lodging resistance and stalk thickness of corn.
By regulating the expression level of the ZmKOB1 gene in maize plants, CRISPR/Cas9 gene editing technology was used to knock out or overexpress the ZmKOB1 gene, thereby increasing its expression level or protein content and enhancing stem thickening and lodging resistance.
It significantly increases the diameter of the long and short axes of corn stalks, improves lodging resistance, reduces lodging rate, and enhances yield and quality.
Smart Images

Figure CN121380184B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the utilization of ZmKOB1 Methods and applications for regulating maize stalk thickness and lodging resistance through gene overexpression or loss-of-function mutations. Background Technology
[0002] In recent years, due to the deterioration of the climate and environment, the intensification of various adverse stresses and disasters, the large-scale application of nitrogen fertilizer, and the promotion of dense planting, the situation of maize lodging damage has become increasingly severe, and lodging has become a major limiting factor for high and stable maize yields. Maize lodging is a phenomenon caused by external forces that cause maize roots or stalks to bend or break. Its damage is mainly manifested in the following ways: 1) Lodging disrupts the spatial order of leaves, causing plants to collide and damage leaf tissues, resulting in reduced photosynthetic efficiency and affecting yield; 2) Lodging damages the root and stem transport system, affecting the transport of nutrients, water, and photosynthetic products, resulting in yield reduction; 3) Lodging can cause ear sprouting, aggravating ear diseases and affecting maize quality; 4) Lodging can cause disordered plant arrangement, greatly increasing harvesting difficulty and costs. Existing statistics show that maize lodging can cause yield reductions of 15-50%, and in severe cases, even total crop failure; for every 1% increase in the maize lodging rate, the yield reduction is approximately 108 kg / hm². The survey also shows that among all traits, including yield, lodging resistance is the trait that farmers care about most and is the primary factor they consider when selecting varieties. Therefore, good lodging resistance is the primary breeding goal for new maize varieties. Summary of the Invention
[0003] All references cited herein are incorporated herein by reference. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise stated, the techniques used or mentioned herein are standard techniques known to one of ordinary skill in the art. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.
[0004] This application's embodiments, through a series of experimental studies, have found that improving [something] in maize plants [can] ZmKOB1 When the gene expression level is increased, it has unexpected technical effects. Plants with increased expression levels have phenotypes of thicker stems and / or enhanced lodging resistance. Thicker stems include increased diameter of the long axis and / or the short axis of the stem. Enhanced lodging resistance refers to increased thrust at 40 cm above the ground, increased thrust at 20 cm above the ground, and / or increased piercing force of the stem at 20 cm above the ground. The aforementioned gene resources and functions are of great significance for maize breeding.
[0005] This application provides a method for producing maize plants with phenotypes of thickened stems and / or enhanced lodging resistance. The method includes the following steps:
[0006] (a) Enhancing the functional genes in maize plants ZmKOB1 The expression level or protein content;
[0007] (b) Obtain at least one seed from the corn plant produced in step (a).
[0008] Optionally, the aforementioned gene that enhances the function of maize plants ZmKOB1 Expression levels include the introduction of functional genes into maize plants. ZmKOB1 Overexpression vectors, or for ZmKOB1 Knockout of the uORF element of the gene to increase ZmKOB1 The expression level or protein content.
[0009] Optionally, the thickening of the stem includes increasing the diameter of the long axis of the stem and / or increasing the diameter of the short axis of the stem.
[0010] Optionally, the enhanced lodging resistance includes increased thrust at 40 cm above the ground, increased thrust at 20 cm above the ground, and / or increased stem penetration at 20 cm above the ground, and reduced lodging incidence.
[0011] Optionally, the aforementioned ZmKOB1 The gene's polynucleotide sequence is selected from one of the following groups of sequences:
[0012] (a) A polynucleotide sequence as shown in SEQ ID No: 1, 2, 4 or 6;
[0013] (b) The polynucleotide sequence that encodes the amino acid sequence shown in SEQ ID No: 3, 5 or 7;
[0014] (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and overexpression of the exogenous polynucleotide sequence in maize plants has the function of thickening the plant stem and / or enhancing the lodging resistance.
[0015] (d) A polynucleotide sequence that has at least 90%, 95%, or 98% similarity to any of the polynucleotide sequences shown in (a)-(c), wherein overexpression of the exogenous polynucleotide sequence in maize plants has the function of thickening the plant stem and / or enhancing lodging resistance; or
[0016] (e) A polynucleotide sequence complementary to any of the sequences described in (a)-(d).
[0017] Optionally, the overexpression vector further includes a promoter that is operatively linked to the nucleotide sequence of the functional gene and enhances the expression level of the functional gene.
[0018] Optionally, the promoter is an overexpression or overexpression promoter such as cauliflower mosaic virus CaMV 35S, maize ubiquitin promoter, or rice Actin1 promoter. Optionally, the promoter can also be an inducible promoter or a tissue / organ-specific expression promoter. Optionally, the promoter utilizes... ZmKOB1 Natural variant sequences of promoters.
[0019] Optionally, as those skilled in the art will know, the embodiments disclosed in this application... ZmKOB1 After gene function is established, any technology that utilizes naturally occurring variations to enhance [gene function]... ZmKOB1 Methods that increase the expression level or ZmKOB1 protein content to promote stem thickening and / or enhance lodging resistance should also be covered within the scope of protection of this invention.
[0020] Optionally, the ZmKOB1 The nucleotide sequence of the uORF element of the gene is shown in SEQ ID NO:14.
[0021] Optionally, the knockout described in this application refers to the knockout of genes such as CRISPR / Cas9, CRISPR / Cas12i, CRISPR / Cas12i3, CRISPR / Cas12j, CRISPR / Cas3C, and CRISPR / cpf1.
[0022] Optionally, the target sequence used for the CRISPR / Cas9 knockout is shown in SEQ ID NO15 or 16.
[0023] Optionally, this application also provides the application of any of the methods described above in producing maize plants with thicker stems and / or enhanced lodging resistance.
[0024] Optionally, the embodiments provided in this application... ZmKOB1 Genes, including homologous genes or the same gene from different varieties that have at least 80%, 85%, 90%, 95%, 98%, or 99% sequence similarity to their polynucleotide sequences, or genes disclosed in the embodiments of this invention. ZmKOB1 The homologous gene or the same gene in different varieties has at least 90%, 95% or 98% sequence similarity in amino acid sequence, and the homologous gene, when overexpressed, has the function of thickening the plant stem and / or enhancing lodging resistance. The homologous gene can be isolated from any plant.
[0025] Optionally, the method provided in this application can be applied to any substance containing ZmKOB1Plants with homologous genes. Preferably, the plants include monocotyledonous plants such as corn, millet, wheat, barley, rye, rice, and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, and tobacco.
[0026] The percentage of sequence similarity described in this application can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.
[0027] Those skilled in the art should know that single nucleotide polymorphisms (SNPs) exist for the same gene among different varieties of the same plant, meaning that the nucleotide sequence of the same gene often differs by a few bases. However, there are many varieties of the same crop, and it is impossible for the inventors to list them all. The embodiments of this application only provide sequences of representative varieties of maize. Therefore, those skilled in the art should know that sequences from different varieties may differ from those disclosed in this invention. ZmKOB1 Methods and applications for overexpressing genes and their nucleotide sequences containing SNPs to achieve thicker stems and / or enhanced lodging resistance in plants.
[0028] Optionally, embodiments of this application also provide feed, coarse flour, protein, or oil products made from corn, wherein the feed, coarse flour, protein, or oil product contains... ZmKOB1 Increased gene expression. This application also provides a corn-based feed, meal, protein, or oil product, wherein the feed, meal, protein, or oil product contains... ZmKOB1 Gene overexpression constructs.
[0029] Optionally, the methods described in the embodiments of this application for transferring nucleotide sequences, vectors, constructs, or expression cassettes into plants, introducing them into plants, or transforming plants all refer to transferring the target nucleotide sequence, construct, vector, or expression cassette into recipient cells or recipient plants through conventional transgenic methods or methods of hybridization with target transgenic plants. Any transgenic method known to those skilled in the art can be used to transform recombinant expression vectors into plant cells to produce transgenic plants or mutants of the embodiments of this application. Transformation methods may include direct or indirect transformation methods. Specifically, the transformation methods include, but are not limited to, polyethylene glycol-induced DNA uptake, liposome-mediated transformation, gene gun introduction, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods.
[0030] Compared with the prior art, this application has the following beneficial effects:
[0031] (1) This application provides a method for producing maize plants and its application, by improving the quality of maize plants. ZmKOB1 By adjusting gene expression levels, plants exhibiting superior agronomic traits such as thicker stems and / or enhanced lodging resistance can be obtained. The aforementioned genes, methods, and their applications provide new germplasm resources and breeding strategies for maize breeding, which are of great significance to global food security and sustainable agricultural development.
[0032] (2) It was clarified that corn ZmKOB1 It explores the functions of gene overexpression and mutation, and provides upstream regulatory elements, thus offering new gene resources for crop species.
[0033] (3) By overexpressing or suppressing genes, breeding materials with application value can be obtained, providing new ideas for crop breeding and the study of gene action mechanism networks.
[0034] Definitions of terms used in this invention:
[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.
[0036] In the context of this application, the terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers in single-stranded or double-stranded form. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
[0037] In this application, the term "homologous gene" refers to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, positive homologous genes, or directed evolutionary homologous genes), transverse homologous genes (also known as paralogous genes, paralogous homologous genes, or parallel evolutionary homologous genes), and / or heterologous genes.
[0038] The term "sequence similarity" refers to the degree of similarity between two sequences. It is a quantitative concept used to compare the similarity between different sequences, thereby discovering and analyzing the association between the two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.
[0039] The term "strict hybridization conditions" as used in this application refers to conditions of low ionic strength and high temperature known in the art. Typically, under strict conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Strict hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the strictness of hybridization or washing conditions. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, ...). Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, (Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be below the melting point (T0) of the specific sequence at a specified ionic strength pH. m Approximately 5-10℃. m The temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence under equilibrium conditions (at specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is present in excess, therefore at T...). m (Under equilibrium conditions, 50% of the probe is occupied). Strict conditions may include: a salt concentration of less than about 1.0 M sodium ions at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ions (or other salts), and a temperature of at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal may be at least twice the background hybridization, and, where appropriate, 10 times the background hybridization. Exemplary strict hybridization conditions may be: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.
[0040] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, a selection marker engineered for expression in plant cells, and the heterologous DNA sequence to be transcribed.
[0041] The term "mutation" as used in this application refers to a "loss-of-function mutation" or "loss-of-function mutation," which is a mutation in the coding sequence of a gene that causes a reduction or complete loss of function in the gene product (usually a protein). Loss-of-function mutations can be caused, for example, by truncation of the gene product (due to frameshift or nonsense mutations), and the phenotype associated with an allele having a loss-of-function mutation can be recessive or dominant.
[0042] The term "overexpression" refers to the process of operatively linking the full-length sequence of a target gene to a constitutive promoter, inducible promoter, or tissue-specific promoter, and then transferring it into a plant through transformation technology, thereby causing the gene product to accumulate in large quantities in the plant.
[0043] The term uORF, also known as an upstream open reading frame, is a short coding sequence located within the 5' untranslated region (5'UTR) of a gene's mRNA, between the start codon (usually AUG) and the stop codon. It is typically less than 100 amino acids in length. Although it usually does not encode functional proteins, it can regulate the expression of the downstream main ORF (the core sequence encoding the target protein) at the translational level. In plants, a small ORF (uORF) in the 5'-UTR region of a gene generally affects the protein content of the gene product by influencing the gene's protein translation efficiency. Typically, knocking out or altering the uORF increases the translation efficiency of its corresponding gene, thereby increasing its protein content. Attached Figure Description
[0044] Figure 1 yes ZmKOB1 A schematic diagram of gene editing design and mutant deletion sequences.
[0045] Figure 2 yes ZmKOB1 Statistical chart of gene expression levels in overexpression materials.
[0046] Figure 3 It is a wild-type isolate control and ZmKOB1 Comparison of stems at the small trumpet stage of overexpression and gene-edited mutant materials.
[0047] Figure 4 It is a wild-type isolate control and ZmKOB1 Statistical chart of stem diameter during pollen shedding period of overexpression and gene-edited mutant materials.
[0048] Figure 5 It is a wild-type isolate control and ZmKOB1 Statistical chart of thrust and puncture force at ear position, 40 cm above ground, and 20 cm above ground in overexpression and gene-edited mutant materials during pollen shedding.
[0049] Figure 6 It is a wild-type isolate control and ZmKOB1 Statistical chart of lodging incidence of overexpression and gene-edited mutant materials under natural field conditions.
[0050] Figure 7 This is a schematic diagram of the ZmKOB1-uORF gene editing design and mutant deletion sequence.
[0051] Figure 8 These are immunoblotting images of wild-type isolates, controls, and ZmKOB1-uORF gene-edited mutant materials.
[0052] Figure 9 This is a statistical chart of stem diameter during pollen shedding period for wild-type isolates, control groups, and ZmKOB1-uORF gene-edited mutant materials.
[0053] Figure 10 This is a statistical graph showing the thrust and puncture force at the ear position during pollen shedding, 40 cm above the ground, and 20 cm above the ground, for wild-type segregating controls and ZmKOB1-uORF gene-edited mutant materials.
[0054] Figure 11 This is a statistical chart showing the lodging situation of wild-type isolates and ZmKOB1-uORF gene-edited mutant materials under natural field conditions. Detailed Implementation
[0055] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0056] Example 1 ZmKOB1 Creation of mutant materials and overexpression materials
[0057] In order to study corn ZmKOB1 The inventors plan to create, using the CRISPR / Cas9 gene editing system, genes with biological functions in the genetically transformed maize inbred line ZC01 background material. ZmKOB1 The mutant material. ZmKOB1 The gene's gene ID is GRMZM2G123540 in the B73_V3 genome, Zm00001d039284 in the B73_V4 genome, and Zm00001eb119140 in the B73_V5 genome. ZmKOB1The genomic DNA sequence is shown in SEQ ID NO:1, its coding region sequence (CDS) is shown in SEQ ID NO:2, 4 or 6, and the encoded amino acid sequence is shown in SEQ ID NO:3, 5 or 7.
[0058] The specific process is as follows: First, through steps such as CRISPR / Cas9 knockout target prediction, multicopy assessment of sequences in the B73 v5 genome, target-specific BLAST prediction, off-target rate prediction, and sgRNA secondary structure prediction, a design was developed. ZmKOB1 The optimal gene editing target sequences are identified, with a total of two target sites, whose sequences are as follows:
[0059] ZmKOB1 -Target 1: 5'- GTAATGGGAAATCAGCTGCA -3' (SEQ ID NO:8)
[0060] ZmKOB1 -Target 2: 5'- GGCTATCATTCGTGGCCTCA -3' (SEQ ID NO:9)
[0061] Using the above target sequences, a [system / mechanism] was constructed. ZmKOB1 CRISPR / Cas9 gene editing vectors ( Figure 1 ), and through genetic transformation of the maize inbred line ZC01, two independent genotypes were identified. Zmkob1 mutant strains ( Figure 1 ), and named them respectively Zmkob1#1 (KO#1) and Zmkob1#2 (KO#2), hereinafter referred to as KO#1 and KO#2 respectively. The identification PCR primers are:
[0062] ZmKOB1-Crispr-DT-F :5'-TCCCATGCTCTGCCAACGT-3' (SEQ ID NO:10)
[0063] ZmKOB1-Crispr-DT-R :5'- ACATCTGGTCATTCTGGGGTTG -3' (SEQ ID NO:11)
[0064] Amino acid sequence analysis showed that these mutants ZmKOB1 The genes all underwent mutations, resulting in protein deletion, premature termination, frameshift mutations, or complete deletion, among which:
[0065] The KO#1 mutation is characterized by:
[0066] ZmKOB1There is a 600bp deletion between bases 2647 and 3246 in the genomic DNA, or a 267bp deletion between bases 738 and 1004 in the CDS.
[0067] The KO#2 mutation is characterized by:
[0068] ZmKOB1 A 7bp deletion between bases 3243 and 3249 of the genomic DNA, or a 7bp deletion between bases 1001 and 1007 of the CDS.
[0069] To further determine ZmKOB1 The biological functions of the expression vector were constructed using a plant overexpression vector backbone (Ubi promoter). ZmKOB1 The overexpression vector of (SEQ ID NO:2) was obtained and genetically transformed into maize inbred line ZC01 to obtain ZmKOB1 Gene overexpression was obtained, resulting in two independent lines. Both overexpression lines were planted at the Langfang experimental base in the spring and summer of 2024. Leaf samples were taken during the silking and pollination stage and flash-frozen in liquid nitrogen. RNA was extracted using the TRIzol method and then processed using specific primers. ZmKOB1-qRT-F :5'-CTCCAATGGAATCTCGCTCTACC-3' (SEQ ID NO:12), ZmKOB1-qRT- R :5'-GCTGCTACTCTCTGCTTTGTCTTTA-3' (SEQ ID NO:13)
[0070] qRT-PCR quantitative analysis identified two... ZmKOB1 The overexpression lines were named as follows: ZmKOB1-OE3 (OE3) ZmKOB1-OE4 (OE4), hereinafter referred to as OE3 and OE4 respectively, were overexpressed 7.18-fold and 21.15-fold compared to wild-type, respectively. The results are as follows... Figure 2 As shown.
[0071] Example 2 ZmKOB1 Positive regulation of corn stalk diameter
[0072] First, ZC01 background plants were initially cultivated in a greenhouse with constant photoperiod, temperature, and humidity. ZmKOB1 Gene-edited mutant materials KO#1, KO#2 and their corresponding wild-type segregating controls CK, ZC01 background ZmKOB1 The overexpressing lines OE3 and OE4, along with their wild-type segregating controls CK3 and CK4, were observed at the small trumpet stage (i.e., the V6-V8 leaf expansion stage). Compared to the wild-type segregating controls CK3 and CK4, [the results were observed]. ZmKOB1 The stem diameters of the overexpressing gene lines OE3 and OE4 were significantly increased; compared with the wild-type segregating control CK, the stem diameters were significantly increased. ZmKOB1 The stem diameter of both gene-edited mutant materials KO#1 and KO#2 was significantly reduced. Figure 3 Furthermore, in the spring and summer of 2024, at the Langfang experimental base in Hebei Province, studies were conducted on the ZC01 background. ZmKOB1 Gene-edited mutant materials KO#1 and KO#2 and their corresponding wild-type segregating controls CK and ZC01 background ZmKOB1 The overexpressing lines OE3 and OE4, along with their corresponding wild-type segregators CK3 and CK4, were planted. At maturity and pollen shedding, the wild-type segregators and corresponding... ZmKOB1 Gene-edited mutant materials, wild-type isolates and controls ZmKOB1 The diameters of the long and short axes of the stems in the overexpression lines were observed, measured, and statistically analyzed (maize stalks are typically elliptical, with the wide and narrow axes being the long and short axes, respectively). Statistical analysis of the obtained data revealed that compared to the wild-type controls CK3 and CK4, the overexpression lines OE3 and OE4 showed significantly increased stem diameters in both the long and short axes. Specifically, compared to CK3, the average increase in long-axis stem diameter in OE3 was approximately 10.74%, and the average increase in short-axis stem diameter was approximately 6.33%; compared to CK4, the average increase in long-axis stem diameter in OE4 was approximately 8.26%, and the average increase in short-axis stem diameter was approximately 8.67%. Figure 4 Conversely, compared to the wild-type segregating control (CK), the stem diameters of the gene-edited mutants KO#1 and KO#2 were significantly reduced. Specifically, the stem diameter of KO#1 decreased by approximately 11.24% in the long axis and approximately 9.60% in the short axis; while the stem diameter of KO#2 decreased by approximately 14.99% in the long axis and approximately 19.44% in the short axis. Figure 4 The above observations and statistical analysis results indicate that... ZmKOB1 Gene overexpression can significantly increase the diameter of both the long-axis and short-axis stems, demonstrating an important biological function in positively regulating maize stem diameter.
[0073] Example 3 ZmKOB1 Improve corn lodging resistance
[0074] Using a stalk strength meter, simulated field wind force was used to measure and statistically analyze the lodging resistance of maize stalks and roots. The specific method involved using the stalk strength meter to vertically clamp or press a metal prong against the maize stalk, pushing the stalks of different maize materials at various heights to corresponding fixed angles or piercing the stalks, and recording the pushing or piercing force at each point. This included the pushing force at the ear position during pollen shedding at 30° from the vertical line, the pushing force at 40 cm above the ground at 20° from the vertical line, the pushing force at 20 cm above the ground at 15° from the vertical line, and the piercing force at 20 cm above the ground. To ensure measurement accuracy, single plants with similar growth were selected for each material, and the average value was taken. Materials at the beginning and end of each row were not measured, and at least six plants of each material were measured. The measurements were conducted in the spring and summer of 2024 at the experimental base in Langfang, Hebei Province, using the ZC01 background. ZmKOB1 Gene-edited mutant materials KO#1 and KO#2 and their corresponding wild-type segregating controls CK and ZC01 background ZmKOB1 The overexpressing lines OE3 and OE4, along with their corresponding wild-type segregators CK3 and CK4, were planted. Similarly, at the pollen shedding and maturity stage, the wild-type segregators and corresponding... ZmKOB1 Gene-edited mutant materials, wild-type isolates and controls ZmKOB1 Lodging resistance was measured and statistically analyzed in gene overexpression lines. Statistical analysis of the obtained data revealed that, compared with the wild-type segregating control (CK), the ear thrust, 40 cm thrust, 20 cm thrust, and stem piercing force of mutants KO#1 and KO#2 were significantly lower than those of the wild type. Specifically, the percentage reductions in ear thrust, 40 cm thrust, and 20 cm thrust in mutant KO#1 were approximately 20.73%, 20.08%, and 21.85%, respectively, with a piercing force reduction of approximately 6.25%. In mutant KO#2, the percentage reductions were approximately 32.14%, 54.30%, and 50.82%, respectively, with a piercing force reduction of approximately 19.49%. Figure 5 Meanwhile, compared with the segregated wild-type controls CK3 and CK4, ZmKOB1 There was no significant difference in ear thrust between the overexpression lines OE3 and OE4; however, the thrust at 40 cm above the ground was significantly enhanced, with average increases of approximately 15.36% and 14.52%, respectively; the thrust at 20 cm above the ground was also significantly enhanced, with average increases of approximately 18.61% and 47.68%, respectively; and the stem piercing force at 20 cm above the ground was also significantly enhanced, with average increases of approximately 5.65% and 12.10%, respectively. Figure 5 ).
[0075] By using a stalk strength tester to simulate field wind force through thrust and puncture force measurements, the lodging resistance of corn stalks can be effectively simulated and evaluated. ZmKOB1Gene-edited mutant materials and ZmKOB1 The changes in thrust characteristics in the gene overexpression materials indicate that mutants KO#1 and KO#2 are more prone to lodging than wild-type, while overexpression materials OE3 and OE4 are more resistant to lodging than wild-type. This is further supported by phenotypic observations of stem long axis diameter and short axis diameter in both mutant and overexpression materials. Zmkob1 The mutants showed a significant reduction in stem diameter, making maize less resistant to lodging; the KOB1-OE overexpression materials showed a significant increase in stem diameter, making maize more resistant to lodging.
[0076] In addition, different genetic materials were planted under natural conditions in Langfang in 2025. The Langfang experimental station experienced two consecutive heavy rainstorms on August 7th and 13th, 2025 (data from the Langfang Meteorological Bureau shows instantaneous winds reaching level 10-11), causing widespread lodging of some maize materials in the fields. We... ZmKOB1 The lodging conditions of different genetic materials were statistically analyzed. A lodging coefficient of 1 was defined as the stem remaining vertical or tilted at an angle within 15°; 15° to 30° as a lodging coefficient of 2; 30° to 45° as a lodging coefficient of 3; 45° to 70° as a lodging coefficient of 4; and 70° or more, or stem breakage or root collapse, as a lodging coefficient of 5. The statistical results showed that… ZmKOB1 Mutants KO#1 and KO#2 showed an increased lodging rate after wind and rain disasters compared to the wild type, meaning they were more prone to lodging. ZmKOB1 Compared to wild-type OE4, overexpressed materials OE3 and OE4 showed a lower lodging rate after wind and rain disasters, indicating greater lodging resistance. Figure 6 ).
[0077] Example 4: Precise knockout using gene editing ZmKOB1-uORF Components improve corn's resistance to lodging
[0078] More importantly, we are ZmKOB1 A 24nt regulatory mechanism was found in the 5' UTR region upstream of the gene's CDS. ZmKOB1 The expressed uORF (Upstream Open Reading Frame) element "ATGATCACAAATAAGCTAAGTTAA" (SEQ ID NO:14) is located in ZmKOB1 -245 bp upstream of the ATG start codon in the gene.
[0079] In the genetically transformed maize inbred line ZC01, we plan to precisely create knockout gene editing systems using the CRISPR / Cas9 gene editing system. ZmKOB1-uORF The component is a lodging-resistant corn mutant material. Similarly, a design was created... ZmKOB1-uORF The optimal gene editing target sequences are identified, with a total of two target sites, whose sequences are as follows:
[0080] ZmKOB1-uORF Target 1: 5'-ATTATGGTAGAAAGCTTGGA-3' (SEQ ID NO:15)
[0081] ZmKOB1-uORF Target 2: 5'-TAACCTAACTTATATAATTT-3' (SEQ ID NO:16)
[0082] Using the above target sequence , constructed ZmKOB1-uORF CRISPR / Cas9 gene editing vectors ( Figure 7 ), and through genetic transformation of the maize inbred line ZC01, two independent genotypes were identified. Zmkob1-uorf mutant strains ( Figure 7 ), and named them respectively Zmkob1-uorf#1 (uORF-KO#1) and Zmkob1-uorf#2 (uORF-KO#2), and its isolation control is named uORF-CK (uORF-CK), hereinafter referred to as uORF-KO#1, uORF-KO#2, and uORF-CK, respectively. The identification PCR primers are:
[0083] ZmKOB1-uORF-Crispr-DT-F :5'-GCAAGAGGCAGATGTACCTGA-3' (SEQ ID NO:17)
[0084] ZmKOB1-uORF-Crispr-DT-R :5'-GTTGGATGGAGGAGAGCTCG-3' (SEQ ID NO:18)
[0085] Nucleotide sequence analysis showed that both uORF-KO#1 and uORF-KO#2 deleted 48 bp containing the uORF element, but there was one base difference between them ( Figure 7 The mutated 5' UTR sequence is shown in SEQ ID NO:19 and 20.
[0086] Furthermore, in order to detect the effects of uORF element sequence deletions or mutations... ZmKOB1 The effect of protein-encoded abundance was investigated by growing ZC01-background proteins in a greenhouse under constant culture conditions. ZmKOB1-uORFGene-edited mutant materials uORF-KO#1 and uORF-KO#2, and their corresponding wild-type segregating control uORF-CK, were used. The uppermost unfolded leaf at stage V3 was used to extract crude total protein. Protein immunoblotting was performed, and the abundance of the target protein ZmKOB1 and the internal control protein β-actin was detected using antibodies. The results showed that, compared with the wild-type segregating control uORF-CK, ZmKOB1-uORF The abundance of ZmKOB1 relative to the internal reference protein β-actin was significantly increased in the gene-edited mutant materials uORF-KO#1 and uORF-KO#2. Figure 8 This indicates that deleting or mutating the uORF element can effectively improve... ZmKOB1 The amount of encoded protein.
[0087] To investigate the biological function of this uORF element, in the spring and summer of 2024, experiments were conducted at the Langfang Experimental Base in Hebei Province, using ZC01 background microstructures. ZmKOB1-uORF Gene-edited mutant materials uORF-KO#1 and uORF-KO#2, along with their corresponding wild-type segregators uORF-CK, were planted. At maturity and pollen shedding stage, the wild-type segregators and corresponding... ZmKOB1-uORF Gene-edited mutant materials were used, and the diameters of the long and short axes of the stems were observed, measured, and statistically analyzed. Statistical analysis of the obtained data revealed that, compared to uORF-CK, uORF-KO#1 and uORF-KO#2 showed a significant increase in stem diameter, with significant increases in both the long and short axis diameters. Specifically, the long axis diameter of uORF-KO#1 increased by approximately 10.64%, and the short axis diameter increased by approximately 13.67%; while the long axis diameter of uORF-KO#2 increased by approximately 9.06%, and the short axis diameter increased by approximately 9.65%. Figure 9 ).
[0088] Furthermore, to evaluate the effect of the uORF element on the lodging resistance of maize stalks, a stalk strength tester was used to measure the thrust at the ear position at 30° from the vertical during pollen shedding, the thrust at 40 cm above the ground at 20° from the vertical, the thrust at 20 cm above the ground at 15° from the vertical, and the stalk piercing force at 20 cm above the ground. Simulated field wind forces were used to measure and statistically analyze the uORF-CK, uORF-KO#1, and uORF-KO#2 materials. The results showed that compared to uORF-CK, uORF-KO#1 and uORF-KO#2 exhibited significantly improved ear thrust, thrust at 40 cm above the ground, thrust at 20 cm above the ground, and stalk piercing force. Among them, uORF-KO#1 showed an increase of approximately 40.08% in ear thrust, approximately 45.31% in thrust at 40 cm above the ground, approximately 37.03% in thrust at 20 cm above the ground, and approximately 14.08% in stalk penetration; uORF-KO#2 showed an increase of approximately 22.15% in ear thrust, approximately 37.98% in thrust at 40 cm above the ground, approximately 31.48% in thrust at 20 cm above the ground, and approximately 7.66% in stalk penetration. Figure 10 ).
[0089] In addition, under different natural conditions in Langfang in 2025, [the study will also be conducted on] different [projects / measures]. ZmKOB1-uORF The edited genetic materials were planted. The Langfang experimental station experienced two consecutive heavy rainstorms on August 7th and 13th, 2025 (data from the Langfang Meteorological Bureau shows instantaneous winds reaching level 10-11), causing widespread lodging of some maize materials in the fields. We... ZmKOB1-uORF The lodging characteristics of the edited genetic materials were statistically analyzed. A lodging coefficient of 1 was defined as stems remaining vertical or tilted at an angle within 15°; 15° to 30° as a level 2 lodging coefficient; 30° to 45° as a level 3 lodging coefficient; 45° to 70° as a level 4 lodging coefficient; and 70° or more, or stem breakage and root collapse, as a level 5 lodging coefficient. The results showed that uORF-KO#1 and uORF-KO#2 exhibited significantly lower lodging rates after wind and rain damage compared to the wild type, indicating greater lodging resistance. Figure 11 ).
[0090] The above results indicate that we have discovered a ZmKOB1 Negative regulatory elements of gene expression uORF The deletion or mutation of this element can effectively improve... ZmKOB1 The level of the encoded protein was increased to obtain the corresponding "knock-up" phenotype. Compared with the isolated wild-type uORF-CK, ZmKOB1-uORF The gene-edited mutants uORF-KO#1 and uORF-KO#2 showed higher abundance of ZmKOB1 protein and were more resistant to lodging. This was further analyzed by examining the phenotypic observations of their stem long axis diameter and short axis diameter. ZmKOB1-uORFThe gene-edited mutants uORF-KO#1 and uORF-KO#2 showed a significant increase in stem diameter, resulting in greater lodging resistance and improved lodging tolerance in maize, which ultimately led to a significant reduction in lodging rate in the field.
Claims
1. A method for producing corn plants, characterized in that, The corn plant exhibits a phenotype of thickened stems and / or enhanced lodging resistance, and the method includes the steps of: (a) Enhancing the functional genes in maize plants ZmKOB1 The expression level or protein content; (b) Obtain at least one seed from the corn plant produced in step (a); The functional genes ZmKOB1 The polynucleotide sequence is selected from one of the following groups of sequences: (c) A polynucleotide sequence as shown in SEQ ID No: 1 or 2; or (d) Its encoding amino acid sequence is a polynucleotide sequence as shown in SEQ ID No: 3; or (e) and any of the sequences described in (c)-(d) are complementary polynucleotide sequences.
2. The method according to claim 1, wherein the method enhances the functional genes in maize plants. ZmKOB1 Expression levels include the introduction of functional genes into maize plants. ZmKOB1 Overexpression vectors, or for ZmKOB1 The uORF element of the gene is knocked out to increase the expression level or protein content of ZmKOB1, and the nucleotide sequence of the uORF element is shown in SEQ ID NO:
14.
3. The method according to claim 1 or 2, wherein the stem thickening includes increasing the diameter of the long axis of the stem and / or increasing the diameter of the short axis of the stem.
4. The method according to claim 1 or 2, wherein the enhanced lodging resistance includes enhanced thrust at 40 cm above the ground, enhanced thrust at 20 cm above the ground, and / or enhanced stem piercing force at 20 cm above the ground, and reduced lodging incidence.
5. The method according to claim 2, wherein the overexpression vector further comprises a promoter operably linked to the nucleotide sequence of the functional gene and increasing the expression level of the functional gene.
6. The method according to claim 5, wherein the promoter is cauliflower mosaic virus CaMV 35S, maize ubiquitin promoter, rice Actin1 promoter, or using... ZmKOB1 Natural variation of promoters.
7. The method according to claim 2, wherein the knockout is CRISPR / Cas9, CRISPR / Cas12i, CRISPR / Cas12i3, CRISPR / Cas12j, CRISPR / Cas3C, or CRISPR / cpf1 knockout.
8. The application of the method according to any one of claims 1-7 in the production of maize plants with thicker stems and / or enhanced lodging resistance.