A sequence composition and kit for detecting tissue distribution and / or expression levels of AAV vector drugs

By combining qPCR and CRISPR-Cas12a fluorescence detection technologies, the problem of detecting the distribution and expression level of AAV vector drugs in vivo was solved, achieving efficient and accurate detection results and ensuring the reliability and safety of experimental results.

CN121380456BActive Publication Date: 2026-07-10天津天诚新药评价有限公司 +1
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
天津天诚新药评价有限公司
Filing Date
2025-12-23
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing technologies are insufficient to accurately and efficiently detect the tissue distribution and expression levels of adeno-associated virus (AAV) vector drugs in vivo, and cannot effectively screen whether experimental animals carry AAV antibodies, making it difficult to guarantee efficacy and safety.

Method used

A fluorescence detection technology based on qPCR and CRISPR-Cas12a system was developed, combined with recombinase polymerase isothermal amplification (RPA) technology. By recognizing conserved sequences in the AAV vector genome, efficient screening and detection of AAV vector drugs can be achieved. A set of primer and probe combinations is used to simultaneously detect DNA and mRNA content.

Benefits of technology

This method enables precise detection of the tissue distribution and expression levels of AAV vector drugs in experimental animals, ensuring the reliability and accuracy of the detection data, eliminating interference from pre-infection, and improving the credibility of experimental results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380456B_ABST
    Figure CN121380456B_ABST
Patent Text Reader

Abstract

The application provides a sequence composition and a kit for detecting tissue distribution and / or expression level of an AAV vector drug.The sequence composition for detecting tissue distribution and / or expression level of the AAV vector drug provided by the application comprises a first forward primer as shown in SEQ ID NO:1, a first reverse primer as shown in SEQ ID NO:2 and a first probe as shown in SEQ ID NO:4.The sequence composition and the kit provided by the application have the remarkable advantages of being universal, efficient, specific, accurate, sensitive and the like in application, and provide a more optimal solution for detection and research in the related field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and gene detection. Specifically, this invention relates to a sequence composition and kit for detecting the tissue distribution and / or expression level of AAV vector drugs. Background Technology

[0002] Hemophilia A is caused by mutations in the coagulation factor VIII (FVIII) gene. Traditional therapies rely on frequent injections of exogenous FVIII, while gene therapy based on adeno-associated virus (AAV) vectors has become a research hotspot due to its potential for long-term expression with a single dose. However, the distribution and expression of AAV vector drugs in vivo are complex, requiring precise detection of their biodistribution in target tissues (such as the liver) and non-target tissues (such as the heart and spleen). Infection in non-target tissues may trigger toxicity risks associated with the vector itself or its expression products. Therefore, conducting biodistribution and target gene expression analysis of AAV therapeutics is a crucial step in preclinical research of related drugs.

[0003] Given the unique characteristics of AAV vector therapeutics, traditional pharmacokinetic analysis methods are difficult to apply. Currently, real-time quantitative polymerase chain reaction (qPCR) remains the gold standard for tracking and quantifying vector genome copy numbers in non-clinical biological sample testing. However, developing primer-probe combinations with high sensitivity, specificity, and versatility for qPCR detection of AAV biodistribution still faces multiple challenges: 1) High homology of the human FVIII gene in animal models easily leads to non-specific amplification by qPCR; 2) Simultaneously detecting the tissue distribution of vector DNA and the expression level of the target gene RNA requires separate primer and probe design, resulting in low efficiency; 3) Different AAV vector drugs usually require customized detection methods, lacking versatility.

[0004] Furthermore, AAV capsid neutralizing antibodies are prevalent in most laboratory animals and can block transduction of the vector after it enters the bloodstream. Therefore, accurately, efficiently, and reliably screening laboratory animals for AAV anti-drug antibodies (i.e., the presence of pre-existing neutralizing antibodies) before administering systemic gene therapy drugs is a crucial prerequisite for ensuring efficacy and safety.

[0005] Therefore, providing an efficient, specific, and accurate analytical detection system and method for AAV-carrier drugs is a technical problem that urgently needs to be solved. Summary of the Invention

[0006] Therefore, in view of the problems existing in the prior art, the object of the present invention is to provide a sequence composition and kit for detecting the tissue distribution and / or expression level of AAV vector drugs in test animals. This provides a powerful research tool for preclinical studies of the safety and efficacy of AAV vector drugs.

[0007] This invention targets replication-defective recombinant adeno-associated virus (rAAV) vectors. Through vector construction, viral packaging and purification, and genomic structure analysis, and by accurately identifying conserved sequences using bioinformatics software, a one-step fluorescence detection technology based on qPCR (probe method) has been successfully developed. Furthermore, this invention innovatively combines the CRISPR-Cas12a system with recombinase polymerase isothermal amplification (RPA) technology to construct a one-step fluorescence detection system for efficient AAV screening. This system can perform pre-infection screening before experimental animal enrollment, accurately eliminating test animals already infected with AAV, avoiding interference from pre-infection on experimental results from the source, and ensuring the reliability and accuracy of subsequent detection data.

[0008] The technical solution of this invention is proposed based on the following findings and research:

[0009] The inventors selected a conserved sequence downstream of the promoter in the AAV vector genome as the target sequence, the nucleotide sequence of which is shown in SEQ ID NO: 9, for use in detecting the DNA content of the vector genome via qPCR. Crucially, this target sequence is not spliced ​​during transcription and remains intact in the 5'UTR region of the mRNA. Therefore, no additional specific primers or probes need to be designed; the same set of primers and probes can be used to simultaneously detect the target mRNA content via RT-qPCR. This achieves the technical effect of "one set of primers and probes for dual purposes," simultaneously meeting the need for accurate detection of both vector DNA copy number and mRNA expression level.

[0010] In this invention, the test animals refer to rodents or non-human primates, including but not limited to rats, mice, cynomolgus monkeys, etc.

[0011] In this invention, the AAV vector drug specifically refers to an AAV vector drug for treating hemophilia A. Specifically, the AAV vector drug of this invention uses the AAV2 backbone as its core. The vector genome sequence of the AAV vector drug of this invention includes, starting from the 5' end, an inverted terminal repeat (ITR), a promoter, a target gene sequence (i.e., the FVIII gene), and a PolyA sequence. The ITR contains the nucleotide sequences shown in SEQ ID NO: 10 and SEQ ID NO: 11; the promoter contains the nucleotide sequence shown in SEQ ID NO: 12 or its nucleotide sequence; the target gene sequence (i.e., the FVIII gene) contains the nucleotide sequence shown in SEQ ID NO: 13 or its nucleotide sequence; and the PolyA sequence contains the nucleotide sequence shown in SEQ ID NO: 14 or its nucleotide sequence.

[0012] SEQ ID NO: 9:

[0013] CAGGAGAAGCCGTCACACAGATCCACAAGCTCCTGCGATCGCCATGAAGTGGGTCACCTTTATCTCCCTGCTGTTTCTGTTCAGCTCGGCCTACTCAGCCACCAGAAGATACTACCTGGGTGCAGTGGAACTGT

[0014] SEQ ID NO: 10:

[0015] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTAGA

[0016] SEQ ID NO: 11:

[0017] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG

[0018] SEQ ID NO: 12:

[0019] GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACTGTTCCGATACTCTAATCTCCCTAGGCAAGGTTCATATTTGTGTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTCACACAGATCCACAAGCTCCT

[0020] SEQ ID NO: 13

[0021]

[0022] SEQ ID NO: 14:

[0023] ATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGG

[0024] For example, the nucleotide sequence of the vector genome of the AAV vector drug of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 15 or as shown in SEQ ID NO: 15. In the nucleotide sequence shown in SEQ ID NO: 15, positions 1 to 142 and 4941 to 5081 are the upstream and downstream inverted terminal repeat (ITR) sequences, respectively; positions 143 to 409 are the promoter; positions 521 to 4798 are the target gene sequence (i.e., FVIII gene); and positions 4807 to 4933 are the PolyA sequence.

[0025] SEQ ID NO: 15:

[0026]

[0027] To achieve the above objectives, the present invention provides the following technical solution:

[0028] In a first aspect, the present invention provides a sequence composition for detecting the tissue distribution and / or expression level of an AAV vector drug, comprising a first forward primer and a first reverse primer; wherein:

[0029] The nucleotide sequence of the first forward primer contains the nucleotide sequence shown in SEQ ID NO: 1, or the nucleotide sequence of the first forward primer is shown in SEQ ID NO: 1;

[0030] The nucleotide sequence of the first reverse primer comprises the nucleotide sequence shown in SEQ ID NO: 2, or the nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 2.

[0031] SEQ ID NO: 1:CAGGAGAAGCCGTCACACAG

[0032] SEQ ID NO: 2:GTTCCACTGCACCCAGGTAGTAT

[0033] According to some embodiments of the present invention, the sequence composition further includes a first probe, wherein the nucleotide sequence of the first probe comprises the nucleotide sequence shown in SEQ ID NO: 3, or the nucleotide sequence of the first probe is shown in SEQ ID NO: 3, and the 5' end of the first probe has a fluorescent group and / or the 3' end of the first probe has a quenching group.

[0034] SEQ ID NO: 3: TGCGATCGCCATGAAGTGGGTC

[0035] Preferably, the fluorescent group is selected from FAM, HEX, CY5 and Texas Red.

[0036] Preferably, the quenching group is BHQ1 or BHQ2.

[0037] More preferably, the nucleotide sequence of the first probe is shown in SEQ ID NO: 4.

[0038] SEQ ID NO: 4: 5'-FAM-TGCGATCGCCATGAAGTGGGTC-BHQ1-3'

[0039] According to some embodiments of the present invention, the working concentrations of the first forward primer, the first reverse primer, and the first probe are all 200 nM.

[0040] In a second aspect, the present invention provides a kit for detecting the tissue distribution and / or expression level of an AAV vector drug, comprising the sequence composition described in the first aspect of the present invention.

[0041] According to some embodiments of the present invention, the kit is a qPCR kit for detecting the tissue distribution of AAV vector drugs in test animals.

[0042] Preferably, the nucleotide sequence of the DNA standard comprises the nucleotide sequence shown in SEQ ID NO: 9, or the nucleotide sequence of the DNA standard is as shown in SEQ ID NO: 9.

[0043] In practical operation, to facilitate the implementation of the technical solution of this invention, genomic single-stranded DNA (ssDNA) extracted from AAV vector drugs can be directly used as DNA standards. The core advantage of this approach is that the prepared standards can more realistically simulate the genomic structure or template characteristics of actual samples, making the amplification efficiency closer to that of real samples, thereby significantly improving the accuracy of sample calibration values. Therefore, as a preferred embodiment, the nucleotide sequence of the DNA standard is shown in SEQ ID NO: 15. Preferably, the kit further includes a first blank matrix, which is used to dilute the DNA standard to prepare a gradient dilution of the DNA standard. The first blank matrix is ​​a solution of genomic DNA from a blank test animal. The blank test animal is a healthy test animal that has not received any experimental treatment or intervention.

[0044] More preferably, the first blank matrix can be prepared using a method including the following steps:

[0045] (1-1) Genomic DNA was extracted from tissues of blank test animals, such as liver, spleen or heart;

[0046] (1-2) Using a suitable buffer, such as TE buffer (Tris-EDTA buffer) or sterile enzyme-free water, dilute the genomic DNA to a concentration of 100 ng / μL to form the first blank matrix.

[0047] Optionally, the kit may also include other reagents for qPCR amplification, such as qPCR premixes, such as PerfectStart® IV Fast Probe qPCR SuperMix UDG or Premix Ex Taq. TM .

[0048] According to other embodiments of the present invention, the kit is an RT-qPCR kit for detecting the expression level of the human FVIII gene after delivery into a test animal using an AAV vector.

[0049] Preferably, the kit further includes an RNA standard. The RNA standard is RNA obtained by in vitro transcription of the genome of the AAV vector drug.

[0050] More preferably, the nucleotide sequence of the RNA standard comprises the nucleotide sequence shown in SEQ ID NO: 5, or the nucleotide sequence of the RNA standard is as shown in SEQ ID NO: 5.

[0051] SEQ ID NO: 5:

[0052] 5'-CAGGAGAAGCCGUCACACAGAUCCACAAGCUCCUGCGAUCGCCAUGAAGUGGGUCACCUUUAUCUCCCUGCUGUUUCUGUUCAGCUCGGCCUACUCAGCCACCAGAAGAUACUACCUGGGUGCAGUGGAACUGU-3'

[0053] Preferably, the kit further includes a second blank matrix for simulating the in vivo blank matrix interference effect. The second blank matrix is ​​a solution of RNA from a blank test animal. The blank test animal is a healthy test animal that has not received any experimental treatment or intervention.

[0054] More preferably, the second blank matrix can be prepared using a method including the following steps:

[0055] (2-1) RNA was extracted from tissues of blank test animals, such as liver, spleen or heart;

[0056] (2-2) The RNA was diluted to a concentration of 100 ng / μL using enzyme-free sterile water (DNase / RNase-Free water), which is the second blank matrix.

[0057] Optionally, the kit may also include other reagents for RT-qPCR amplification, such as RT-qPCR premixes, such as TransScript® II Multiplex Probe One-Step qRT-PCR SuperMix UDG, and reverse transcriptase mixtures, such as TransScript® II Probe One-Step RT / RI Enzyme Mix.

[0058] It should be noted that in the kit provided by this invention, the DNA standard, the first blank matrix, the RNA standard, and the second blank matrix can all be in forms commonly used in the art. For example, the DNA standard and the RNA standard can be lyophilized microspheres, thin-film dry powder, or low-concentration liquid (-20°C); the first blank matrix and the second blank matrix can be solutions stored at -20°C or 2-8°C. Of course, the first blank matrix and the second blank matrix can also be prepared on-site during the experiment. Those skilled in the art can make appropriate choices as needed, and this invention does not impose specific limitations here.

[0059] Before using the kit of the present invention to detect the tissue distribution of AAV vector drugs and / or the expression level of the target gene in test animals, the test animals can be screened for AAV virus to exclude test animals infected with AAV virus. Therefore, according to some embodiments of the present invention, the kit further includes a sequence composition for AAV virus screening, comprising a second forward primer, a second reverse primer and crRNA, wherein:

[0060] The nucleotide sequence of the second forward primer contains the nucleotide sequence shown in SEQ ID NO: 6, or the nucleotide sequence of the second forward primer is shown in SEQ ID NO: 6;

[0061] The nucleotide sequence of the second reverse primer contains the nucleotide sequence shown in SEQ ID NO: 7, or the nucleotide sequence of the second reverse primer is shown in SEQ ID NO: 7;

[0062] The nucleotide sequence of the crRNA comprises the nucleotide sequence shown in SEQ ID NO: 8, or the nucleotide sequence of the crRNA is shown in SEQ ID NO: 8.

[0063] SEQ ID NO: 6: 5'-TCGCAGAAGCCATTGCCCACCRCYGTGCCCTT-3'

[0064] SEQ ID NO: 7:

[0065] 5'-ACCTTGGCCGTCATCTTMCCCTCCTCCCACCA-3'

[0066] Where Y is C or T, M is G or T, and R is A or G.

[0067] SEQ ID NO: 8:

[0068] 5'-UAAUUUCUACUAAGUGUAGAUCCUUCAACGAUUGCGUCGACAAG-3'

[0069] Preferably, the sequence composition for AAV virus screening further includes a second probe, wherein the nucleotide sequence of the second probe comprises 5'-TCCTTATT-3', or the nucleotide sequence of the second probe is as shown in 5'-TCCTTATT-3', and the 5' end of the second probe has a fluorescent group and / or the 3' end of the second probe has a quenching group.

[0070] More preferably, the nucleotide sequence of the second probe is shown as 5'-FAM-TCCTTATT-BHQ1-3'.

[0071] Preferably, the kit further includes a positive control for AAV virus screening, which contains a nucleotide sequence as shown in SEQ ID NO:16.

[0072] SEQ ID NO: 16:

[0073] ACCAACATCGCAGAAGCCATTGCCCACGCCGTGCCCTTCTACGGCTGCGTCAACTGGACCAATGAGAACTTTCCCTTCAACGATTGCGTCGACAAGATGGTGATCTGGTGGGAGGAGGGCAAGATGACGGCCAAGGT

[0074] More preferably, the positive control is a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO: 16.

[0075] More preferably, the plasmid backbone gene sequence of the recombinant plasmid is any vector that does not nonspecifically bind to the second forward primer, the second reverse primer and the second probe, such as the pUC57 vector.

[0076] Thirdly, the present invention provides a method for detecting the tissue distribution of AAV carrier drugs in test animals, comprising the following steps:

[0077] Step 1: Obtain the first test sample from the test animal, and then extract DNA from the first test sample;

[0078] Step 2: Using gradient dilutions of DNA standards and the DNA as templates, qPCR amplification reactions are performed using the sequence composition according to the first aspect of the present invention or the kit according to the second aspect of the present invention to obtain a first standard curve and the Ct value of the DNA.

[0079] Step 3: Using the Ct value of the DNA, calculate the content (copy / μg gDNA) of the genomic DNA of the AAV vector drug in the first test sample using a first standard curve (e.g., using Origin software to calculate using a first standard curve).

[0080] According to some embodiments of the present invention, the first test sample includes target tissue, such as the liver, and non-target tissue, such as the heart, spleen, blood, lungs, kidneys, inguinal lymph nodes, brain, spinal cord, muscles, testes, bone marrow, small intestine, pancreas, adrenal glands, or excrement (feces and urine).

[0081] According to some embodiments of the present invention, the reaction system of the qPCR amplification reaction, with a total volume of 25 μL, includes: 12.5 μL of qPCR premix, 0.5 μL of 10 μM first forward primer, 0.5 μL of 10 μM first reverse primer, 0.5 μL of 10 μM first probe, 3 μL of template, and the remainder water.

[0082] According to some embodiments of the present invention, the reaction program of the qPCR amplification reaction is as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds; annealing and extension at 60°C for a total of 30 seconds; fluorescence detection at 60°C; for a total of 45 cycles.

[0083] In this invention, the specific method for obtaining the first standard curve can refer to relevant solutions in the prior art. For example, the first standard curve can be plotted by a method including the following steps:

[0084] (3-1) The DNA standard was serially diluted 10-fold using the first blank matrix to obtain concentrations ranging from 5 × 10¹ to 5 × 10¹. 7 A gradient dilution of copies / μL, also known as a calibration standard;

[0085] (3-2) Perform qPCR amplification reactions using gradient dilutions of the DNA standard to obtain the corresponding Ct values;

[0086] (3-3) Plot a standard curve with the logarithm of the theoretical content of genomic DNA in the gradient dilution of the DNA standard as the abscissa and the corresponding Ct value as the ordinate.

[0087] Fourthly, the present invention provides a method for detecting the expression level of an AAV vector drug in test animals, comprising the following steps:

[0088] Step 1': Obtain a second test sample from the test animal, and then extract RNA from the second test sample;

[0089] Step 2': Using gradient dilutions of RNA standards and the RNA as templates, perform RT-qPCR reactions to obtain a second standard curve and the Ct value of the RNA.

[0090] Step 3': Using the Ct value of the RNA, calculate (e.g., using Origin software to calculate via a second standard curve) the transcription level of the human FVIII gene delivered by the AAV vector drug in the second test sample, such as the content (copy / reaction) of the genomic RNA of the AAV vector drug.

[0091] According to some embodiments of the present invention, the second test sample is a target tissue, for example, the test sample is a liver sample of a test animal.

[0092] According to some embodiments of the present invention, the reaction system of the one-step RT-qPCR reaction, with a total volume of 20 μL, comprises: 10 μL of one-step RT-qPCR premix, 0.4 μL of 10 μM first forward primer, 0.4 μL of 10 μM first reverse primer, 0.2 μL of 10 μM first probe, 2 μL of template, 0.4 μL of reverse transcriptase mixture, 2 μL of 100 ng / μL second blank matrix, and the remainder being water.

[0093] In the RT-qPCR reaction of this invention, reverse transcription of RNA into cDNA is achieved using a first reverse primer.

[0094] According to some embodiments of the present invention, the reaction procedure of the one-step RT-qPCR reaction is as follows: reverse transcription at 50°C for 5 minutes; pre-denaturation at 94°C for 30 seconds; denaturation at 94°C for 5 seconds; annealing and extension at 60°C for a total of 30 seconds; fluorescence detection at 60°C; for a total of 45 cycles.

[0095] In this invention, the specific method for obtaining the second standard curve can refer to relevant solutions in the prior art. For example, the second standard curve can be plotted by a method including the following steps:

[0096] (4-1) The RNA standard was serially diluted 10-fold using enzyme-free sterile water to obtain a concentration range of 1.0 × 10⁻⁶. 2 Up to 1.0×10 7 A gradient dilution of copies / μL, also known as a calibration standard;

[0097] (4-2) Perform one-step RT-qPCR reactions using gradient dilutions of the RNA standard to obtain the corresponding Ct values;

[0098] (4-3) Plot a standard curve with the logarithm of the theoretical content of standard RNA in the gradient dilution of the RNA standard as the abscissa and the corresponding Ct value as the ordinate.

[0099] According to some embodiments of the present invention, in step 1 and / or step 1, the test animal has undergone AAV virus pre-screening and the screening result is negative.

[0100] According to a preferred embodiment of the present invention, the AAV virus screening includes the following steps:

[0101] Step 1: Extract genomic DNA from samples from the test animals;

[0102] Step 2: Perform RPA-CRISPR / Cas12a combined detection using the genomic DNA, high-concentration positive control, low-concentration positive control, negative control, and nuclease-free water (NTC). After the reaction, adjust the baseline start value, stop value, and threshold according to the amplification curve to ensure the baseline is in the exponential growth phase of the amplification curve (adjust the amplification curve of the negative control to be below the threshold line). Click Analysis to automatically obtain the analysis results and record the sample CT value.

[0103] Step 3: Simultaneously test the following quality control items. All quality control results must meet the corresponding quality control standards before the results of the sample to be tested can be determined; if any quality control item fails to meet the standard, the results of this experiment will be invalid.

[0104] Negative control: The amplification curve shows no obvious logarithmic growth phase, or the Ct value is ≥20;

[0105] The high-concentration positive control sample is 5.0 × 10⁻⁶. 6 The amplification curve showed a clear logarithmic growth phase and a Ct value <20;

[0106] The low-concentration positive control sample is 2.0 × 10⁻⁶. 2 The amplification curve showed a clear logarithmic growth phase and a Ct value <20;

[0107] Template-free control (NTC): The amplification curve shows no obvious logarithmic growth phase (excluding reagent / environmental contamination).

[0108] Sample selection criteria:

[0109] Positive result: The sample amplification curve shows a clear logarithmic growth phase, and the Ct value is < 20;

[0110] Negative result: The sample amplification curve shows no obvious logarithmic growth phase, or the Ct value is ≥20.

[0111] Preferably, the sample is a mucosal secretion and / or cell sample from the nasopharynx, and / or a salivary secretion and / or cell sample from the oropharynx.

[0112] According to a preferred embodiment of the present invention, the reaction system for the RPA-CRISPR / Cas12a joint detection comprises a sequence composition for AAV virus screening, which includes a second forward primer, a second reverse primer, and crRNA, wherein:

[0113] The nucleotide sequence of the second forward primer contains the nucleotide sequence shown in SEQ ID NO: 6, or the nucleotide sequence of the second forward primer is as shown in SEQ ID NO: 6;

[0114] The nucleotide sequence of the second reverse primer contains the nucleotide sequence shown in SEQ ID NO: 7, or the nucleotide sequence of the second reverse primer is shown in SEQ ID NO: 7;

[0115] The nucleotide sequence of the crRNA comprises the nucleotide sequence shown in SEQ ID NO: 8, or the nucleotide sequence of the crRNA is shown in SEQ ID NO: 8.

[0116] Preferably, the sequence composition for AAV virus screening further includes a second probe, wherein the nucleotide sequence of the second probe comprises 5'-TCCTTATT-3', or the nucleotide sequence of the second probe is as shown in 5'-TCCTTATT-3', and the 5' end of the second probe has a fluorescent group and / or the 3' end of the second probe has a quenching group.

[0117] More preferably, the fluorescent group is selected from FAM, HEX, CY5 and Texas Red.

[0118] More preferably, the quenching group is BHQ1 or BHQ2.

[0119] Particularly preferably, the nucleotide sequence of the second probe is shown as 5'-FAM-TCCTTATT-BHQ1-3'.

[0120] According to a particularly preferred embodiment of the present invention, the reaction system for the RPA-CRISPR / Cas12a co-detection, with a total volume of 25 μL, comprises: 5 μL of RPA premix, 0.5 μL of 10 μM second forward primer, 0.5 μL of 10 μM second reverse primer, 0.5 μL of 10 μM second probe, 1 μL of template, 1 μL of 2 μM crRNA, 1 μL of 2 μM Cas12a protein, 10 μL of reaction buffer, and the remainder being water.

[0121] According to another preferred embodiment of the present invention, the detection procedure of the RPA-CRISPR / Cas12a joint detection is as follows: constant temperature incubation for 30 to 40 minutes (preferably 40 minutes) within a temperature range of 37°C to 42°C (preferably 42°C), with fluorescence signal collected once per minute.

[0122] It should be noted that in the various kits provided by the present invention, the amount of each component can be determined by those skilled in the art according to the intended purpose, and kits containing any amount of the above-mentioned components are all within the scope of the present invention.

[0123] The various kits provided by this invention may also include instructions for use. These instructions for use typically include a clear description of the techniques employed when using the kit components to achieve desired results, such as the detection of tissue distribution of the AAV vector drug in test animals, the mRNA level of the human FVIII gene in test animals, or whether the test animals are infected with AAV virus. Optionally, the kit may also contain other suitable components, such as measuring instruments, diluents, buffers, positive controls, template-free negative controls, syringes, or other suitable accessories that will be readily recognized by those skilled in the art.

[0124] Compared with the prior art, the technical solution of the present invention has at least the following beneficial effects:

[0125] First, the sequence composition provided by this invention for detecting the tissue distribution and expression level of AAV vector drugs is specifically designed to detect the biodistribution and in vivo expression level of human coagulation factor VIII gene therapeutic drugs delivered by AAV vectors. This sequence composition (primer-probe set) is cleverly designed to simultaneously achieve the following dual detection functions: (1) quantitative analysis of the tissue distribution of vector DNA; (2) accurate determination of the transcriptional level of exogenous FVIII genes. Compared with the traditional method RT-qPCR, this invention eliminates interference from endogenous FVIII genes and achieves multiple detection targets with a single set of primers and probes, exhibiting significant advantages in efficiency, specificity, and accuracy.

[0126] Secondly, this invention provides an AAV virus detection system based on recombinase polymerase amplification (RPA) combined with CRISPR / Cas12a technology, comprising specific RPA primers, targeting crRNA, and a fluorescently quenched reporter probe. By optimizing the RPA reaction conditions and CRISPR / Cas12a detection parameters, the detection sensitivity is greatly improved, with a detection limit as low as 10 copies / μL, enabling efficient detection of whether experimental animals are pre-infected with AAV virus. Furthermore, the scheme of this invention can rapidly screen for multiple AAV serotypes (including but not limited to AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9). Therefore, the scheme of this invention can accurately screen for AAV infection in experimental animals in advance, thereby eliminating interference with AAV vector drugs before systemic drug administration. Attached Figure Description

[0127] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0128] Figure 1 The melting curves obtained in Example 1 of this invention are shown, where red represents the melting curves of positive quality control samples (HQC, LQC), and green represents NTC and standard dilution solutions.

[0129] Figure 2 This is the qPCR amplification curve obtained in Example 1 of the present invention.

[0130] Figure 3 This is the linear standard curve obtained by fitting with Origin software in Embodiment 2 of the present invention.

[0131] Figure 4 This is the RT-qPCR amplification curve obtained in Example 2 of the present invention.

[0132] Figure 5 The sensitivity detection results for RPA-CRISPR / Cas12a amplification in Example 3 of this invention are shown, with p ≤ 0.001.

[0133] Figure 6 The image shows the RPA-CRISPR / Cas12a amplification curve obtained in Example 3 of this invention.

[0134] Figure 7 The fluorescence detection results of RPA-CRISPR / Cas12a positive animal samples in Example 3 of this invention are shown, with ***p≤0.001. Detailed Implementation

[0135] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0136] The AAV vector drug used in the following examples was obtained from the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, and its vector genome nucleotide sequence is shown in SEQ ID NO: 15.

[0137] Example 1: Detection of the genomic biodistribution of AAV vector drugs (carrying human FVIII gene) using qPCR technology

[0138] 1. Experimental Materials

[0139] DNA Standard: Genomic single-stranded DNA (SEQ ID NO: 15) was isolated and extracted from the AAV vector drug using a viral DNA / RNA extraction kit (TransGen Biotech (Beijing) Co., Ltd., catalog number: ER201-01). After quantitative detection using a BioPhotometer D30 nucleic acid and protein analyzer, the copy number concentration was calculated using the following formula:

[0140] Copy / μL = [6.02 × 10] 23 × (ng / μL × 10 -9 )] / (DNA length × 330)

[0141] Blank matrix treatment: The blank biological matrix was ICR mouse liver tissue. Genomic DNA was extracted using a DNA extraction kit (TransGen Biotech (Beijing) Co., Ltd., catalog number: ER201-01) and then diluted to 100 ng / μL with TE buffer as the DNA standard dilution solution (i.e., the first blank matrix).

[0142] AAV primers and probes: The sequences SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 4 were synthesized by GenScript Biotech Ltd.

[0143] Forward primer (AAV-F):

[0144] 5'-CAGGAGAAGCCGTCACACAG-3' (SEQ ID NO: 1)

[0145] Reverse primer (AAV-R):

[0146] 5'-GTTCCACTGCACCCAGGTAGTAT-3' (SEQ ID NO: 2)

[0147] Fluorescent probe (AAV-P):

[0148] 5'-FAM-TGCGATCGCCATGAAGTGGGTC-BHQ1-3' (SEQ ID NO: 4)

[0149] Test samples: During the test, each test sample is diluted to 100 ng / μL, and 3 μL of the sample is loaded into the reaction system.

[0150] 2. PCR reaction system and procedure

[0151] PCR reaction system: 12.5 μL of premixed solution (SuperMix, TransGen Biotech (Beijing) Co., Ltd., catalog number: AQ732-S2-01), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 0.5 μL of fluorescent probe (10 μM), 3 μL of template DNA, and water to make up to 25 μL.

[0152] PCR reaction program: 95℃ for 30 seconds; 95℃ for 5 seconds, 60℃ for 30 seconds, 45 cycles.

[0153] 3. Verify primer secondary structure and amplification product specificity: Amplification analysis was performed using SYBR Green qPCR (dye method).

[0154] Template settings: Prepare HQC and LQC solutions by diluting DNA standards using DNA standard dilution buffer, with concentrations of 2.0 × 10⁻⁶. 7 250 copies / μL and 250 copies / μL, i.e., high quality control and low quality control, were used as templates for validation, respectively, with DNA standard dilutions of 100 ng / μL, high quality control, and low quality control.

[0155] Melting curve analysis: qPCR reaction was performed using a qPCR instrument. After the reaction was completed, a melting curve program (60℃-95℃) was run, and the amplification specificity was evaluated by the characteristics of the melting peak.

[0156] The results are as follows Figure 1 As shown in Table 1. From Figure 1 As shown in Table 1, the melting curves of the AAV primer pairs of this invention exhibit a single peak (Tm=86℃), with no heterogeneous peaks or non-specific amplification. This indicates that the primers themselves did not form dimers; the primer design is reasonable and can specifically amplify the target sequence.

[0157]

[0158] 4. Primer and probe specificity verification: Validation was performed using probe-based qPCR.

[0159] Template settings, using serially diluted AAV genomic standards (i.e., the DNA standards mentioned above) (5 × 10⁻⁶) 1 ~ 5×10 7 (Copies / μL) is the detection template;

[0160] Interference controls: cynomolgus monkey liver genomic DNA (closely related species) and mouse liver genomic DNA (unrelated species); concentration: 100 ng / μL.

[0161] Negative control: Template-free control group (NTC).

[0162] The results are as follows Figure 2 As shown in Table 2. Figure 2 In the middle, the straight line represents the cynomolgus monkey DNA, mouse DNA, and NTC samples. No peak was observed, indicating no amplification signal (ND) was detected in any of the cynomolgus monkey DNA, mouse DNA, or NTC groups. The red curves from left to right represent the concentration range of 5 × 10⁻⁶. 7 ~ 5×10 1 AAV genome standard at copies / μL.

[0163]

[0164] 5. Methods for establishing and validating qPCR standard curves

[0165] Standard gradient: The AAV genomic standard was serially diluted 10-fold, with a concentration range of 5 × 10⁻⁶. 1 ~ 5×10 7 Copy / μL.

[0166] Standard curve generation: One-step qPCR was used, and linear regression analysis was performed between the logarithmic copy number of the standard (X-axis) and the average Ct value of the two replicates (Y-axis). The correlation coefficient R was required to be... 2 ≥0.98. The specific method involves using LightCycler 480 Software and performing data analysis via Abs Quant / 2nd Derivative Max. The logarithmic value (the theoretical content of the test sample's genomic DNA in the calibration standard) is plotted on the x-axis, and the corresponding Cp value is plotted on the y-axis. A linear standard curve is fitted using calculation software, and the content of the test sample's genomic DNA (copies / μg gDNA) in the sample is calculated using Origin software based on the standard curve.

[0167] Validation design: Run two independent analysis batches consecutively.

[0168] The results are shown in Tables 3 and 4. The accuracy of the calibration standards ranged from -21.09% to 41.61%, meeting the ±25% (LLOQ ±50%) requirement; the slopes of the standard curves (-3.35, -3.31) and the correlation coefficient R0 were also satisfactory. 2 The amplification efficiency (0.9989, 0.9983) and the calibrated standard double-duplicate Ct value (0.99, 1.0) both meet the acceptance requirements, and the %CV of the Ct value is ≤2%. No amplification was observed in the NTC. All parameters meet the preset acceptance criteria.

[0169]

[0170]

[0171] 6. Validation of the lower limit of quantitation (LLOQ)

[0172] Methods: DNA standard solutions were prepared by serially diluting the DNA standard 10-fold with DNA standard dilution buffer, covering 5 × 10⁻⁶ cells / day. 7 ~ 5×10 1 Detection range per copy / μL; accuracy (deviation from labeled value) and precision (%CV) are calculated based on LLOQ level samples.

[0173] Acceptance criteria: Precision ≤ 50%; Mean accuracy within ± 50% of the stated value; ≥ 50% LLOQ sample accuracy meets ± 50% requirement.

[0174]

[0175] The results are shown in Table 5. All parameters met the acceptance criteria. The limit of quantitation (LLOQ) of this detection method was 50 copies / μL.

[0176]

[0177] Example 2: One-step RT-qPCR detection of in vivo mRNA transcription level of AAV vector drug (delivering human FVIII gene)

[0178] 1. Experimental Materials

[0179] Primers and probes: Same as in Example 1

[0180] Preparation of RNA standards: A DNA fragment containing the AAV vector target gene (human FVIII) was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned into the pUC57 vector containing the T7 promoter to obtain a recombinant plasmid; the recombinant plasmid was used as a template for in vitro transcription using the TransScript® II kit (catalog number: JT101) from TransGen Biotech Co., Ltd. to obtain RNA standards, the nucleotide sequence of which is shown in SEQ ID NO: 5.

[0181] SEQ ID NO: 5:

[0182] 5'-CAGGAGAAGCCGUCACACAGAUCCACAAGCUCCUGCGAUCGCCAUGAAGUGGGUCACCUUUAUCUCCCUGCUGUUUCUGUUCAGCUCGGCCUACUCAGCCACCAGAAGAUACUACCUGGGUGCAGUGGAACUGU-3'

[0183] RNA standard quantification and calibration: RNA concentration (ng / μL) was quantified using a BioPhotometer D30 nucleic acid and protein analyzer, and the copy number was calculated using the formula: copies / μL = [6.02 × 10⁻⁶]. 23 × (concentration × 10) -9 [RNA length (nt) × 330], the range of 10-fold serial dilutions of RNA standards (i.e., calibration standards): 1.0 × 10 2 ~1.0×10 7 Copy / μL.

[0184] Blank matrix treatment: livers of blank ICR mice were taken and RNA was extracted using the EasyPure® RNAKit (catalog number: ER101-01) from TransGen Biotech Ltd.; the RNA was diluted with DNase / RNase-Free water to 100 ng / μL as blank matrix (i.e., second blank matrix).

[0185] Test samples: During testing, each test sample is diluted to 500 ng / μL, and 2 μL of the sample is loaded into the reaction system.

[0186] 2. One-step RT-qPCR detection:

[0187] The one-step RT-qPCR premix solution from TransGen Biotech was used.

[0188]

[0189]

[0190] 3. Results Analysis: The logarithmic value of the theoretical RNA content in the calibration standard was plotted on the x-axis, and the mean Cp value corresponding to the content was plotted on the y-axis. A linear standard curve was fitted using Origin software, as shown below. Figure 3 As shown, the linear equation is Y = -3.43X + 41.30, r 2 =1.0, E=0.96; meets the linearity criterion.

[0191] 4. Specific detection

[0192] RNA extracted from the livers of blank mice and cynomolgus monkeys was amplified by RT-qPCR, and the results are as follows. Figure 4 As shown. In Figure 4 In the middle, red represents the RNA standard gradient dilution solution (concentration range: 1.0 × 10⁻⁶). 2 ~ 1.0×10 7 Amplification curves (copy / μL), green represents the amplification curves of RNA extracted from the livers of NTC mice, blank mice, and cynomolgus monkeys. From Figure 4 As can be seen, no amplification curve appeared (no Ct value); combined with the primer and probe specificity data of Example 1, it can be confirmed that the primer and probe combination and detection method provided by the present invention can accurately detect the exogenous human FVIII gene transcript delivered by AAV vector drugs, and can exclude the interference of endogenous FVIII genes, which fully demonstrates the specificity and reliability of the detection system of the present invention.

[0193] Example 3: Joint detection of AAV virus based on RPA and CRISPR / Cas12a

[0194] 1. Screening of target gene sequences

[0195] The target gene sequence screening is shown in Table 8. Homologous conserved sequences for different AAV subtypes were screened: ACCAACATCGCAGAAGCCATTGCCCACGCCGTGCCCTTCTACGGCTGCGTCAACTGGACCAATGAGAACTTTCCCTTCAACGATTGCGTCGACAAGATGGTGATCTGGTGGGAGGAGGGCAAGATGACGGCCAAGGT (SEQ ID NO: 16). Nanjing Genscript Biotech Co., Ltd. was commissioned to insert this homologous sequence into the pUC57 vector via blunt-end insertion into EcoRV, and plasmid DNA was extracted as a positive control sample.

[0196]

[0197] 2. Experimental Materials

[0198] (1) The following components were synthesized by Genscript Biotech Ltd.:

[0199] RPA amplification primers:

[0200] Forward primer (RPA-F): SEQ ID NO: 6:

[0201] 5'-TCGCAGAAGCCATTGCCCACRCYGTGCCCTT-3'

[0202] Reverse primer (RPA-R): SEQ ID NO: 7

[0203] 5'-ACCTTGGCCGTCATCTTMCCCTCCTCCCACCA-3'

[0204] Degenerate bases: Y=C / T; M=G / T; R=A / G

[0205] Fluorescent reporter probe: 5'-FAM-TCCTTATT-BHQ1-3'

[0206] The above primers and probes were diluted to 10 μM for later use.

[0207] Cas12a crRNA: SEQ ID NO: 8:

[0208] 5'-UAAUUUCUACUAAGUGUAGAUCCUUCAACGAUUGCGUCGACAAG-3', release to 2 μM for later use.

[0209] (2) The following reagents were purchased from Yizhi Biotechnology Co., Ltd. (item number: DF-CAS12-LYO-1S):

[0210] Cas12a protein, RPAMix, reaction buffer

[0211] 3. Reaction system and detection procedures

[0212] Reaction system: Prepare the amplification system according to the components and volumes in Table 9.

[0213]

[0214] Instrument: LightCycler® 480 Real-Time PCR System; Set the detection program (warm-up: 42℃, 1 min; amplification: 42℃, 60 s / cycle, 40 cycles), and collect FAM fluorescence signals once per cycle.

[0215] Blank control group (NTC): Nuclease-free water (N2O) was used instead of DNA template for detection.

[0216] 4. Sensitivity Verification

[0217] Preparation of positive standards: The AAV target sequence (SEQ ID NO: 16) was cloned into the pUC57 vector, the plasmid was extracted, and its concentration (ng / μL) was determined. The plasmid copy number concentration was calculated according to the following formula: copy number / μL = [6.02 × 10] 23 ×(concentration×10) -9[Length of insert fragment in plasmid (bp) × 660]; The above positive control samples were serially diluted 10-fold using Nuclease-free H2O to obtain amplification template concentration range of 1.0 × 10⁻⁶. 0 Up to 1.0×10 7 Copy / μL. RPA-CRISPR / Cas12a combined detection was performed on template DNA at each dilution.

[0218] The results are as follows Figure 5 As shown. From Figure 5 It can be seen that the concentration is 1.0 × 10 0 No significant fluorescence signal was detected in samples with a concentration of copies / μL; while the target template concentration was 1.0 × 10⁻⁶. 1 Up to 1.0×10 7 The fluorescence intensity of samples within the range of copies / μL was significantly higher than that of the blank control group (NTC). This result indicates that the sensitivity of the RPA-CRISPR / Cas12a detection system can reach 10 copies / μL.

[0219] 5. Specificity verification

[0220] The results were obtained by using 100 ng / μL of blank mouse liver genomic DNA (gDNA) and blank cynomolgus monkey liver gDNA as negative controls. Figure 6 As shown. In Figure 6 In the diagram, green represents the negative control and NTC amplification curves, while red represents the amplification curve of the positive quality control standard template (target template concentration is 1.0 × 10⁻⁶). 1 ~1.0×10 7 (copy / μL). Figure 6 The results showed that the negative control did not produce a significant fluorescence signal, which was consistent with the NTC background, indicating that the detection system had good specificity.

[0221] 6. Detection of AAV-positive animal samples

[0222] The experimental mouse population was screened by ELISA serological testing, and positive individuals naturally infected with AAV and negative individuals not infected with AAV were selected to verify the performance of the RPA-CRISPR / Cas12a detection technology for AAV of the present invention.

[0223] In the RPA-CRISPR / Cas12a assay, nasopharyngeal secretions from mice were collected via nasopharyngeal swabs, and viral DNA was extracted from the secretions using a viral DNA extraction kit (TransGen Biotech (Beijing) Co., Ltd., catalog number: ER201-01). The extracted genomic DNA was diluted to 100 ng / μL and used as a template for the RPA-CRISPR / Cas12a assay. The components were added sequentially according to the reaction system in Table 9, and the sample was placed in a LightCycler® 480 real-time PCR instrument. The detection program was set (warm-up: 42℃, 1 min; amplification: 42℃, 60 s / cycle, 40 cycles), and FAM fluorescence signal was acquired once per cycle. The presence of AAV viral DNA in the sample was determined based on the fluorescence intensity.

[0224] The results are as follows Figure 7 As shown, the fluorescence signal value of AAV-infected positive mouse samples was significantly higher than that of the template-free control (NTC), and statistical analysis (p≤0.001) confirmed a highly significant difference between the two. In contrast, the fluorescence signal value of uninfected AAV negative control mice (blank mice) samples showed no significant difference from the NTC (P > 0.05). These results indicate that in AAV-infected positive mouse samples, crRNA binds to the Cas12a protein to form a functional complex, which can be specifically activated by the target sequence and acquire trans-cleavage activity. During the detection process, the fluorescent reporter probe is efficiently cleaved, resulting in an exponential increase in fluorescence signal. In uninfected AAV negative control mouse samples, due to the lack of the target sequence, the crRNA-Cas12a complex cannot be activated and lacks trans-cleavage activity; therefore, no fluorescence signal from the reporter probe was detected.

[0225] In summary, the screening system established in this invention can accurately distinguish between positive and negative samples of AAV virus infection, exhibiting high specificity and accuracy, and can be used for pre-screening of AAV virus infection in laboratory animals.

[0226] The above descriptions are merely several exemplary embodiments of the present invention and are not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any equivalent or related embodiments obtained by those skilled in the art through minor modifications or variations of the disclosed technical content without departing from the scope of the present invention fall within the scope of the present invention.

Claims

1. A sequence composition for detecting the tissue distribution and / or expression level of an AAV vector drug, comprising a first forward primer and a first reverse primer; characterized in that: The nucleotide sequence of the first forward primer is shown in SEQ ID NO: 1; The nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 2; The sequence composition further includes a first probe, the nucleotide sequence of which is shown in SEQ ID NO: 3, and the first probe has a fluorescent group at its 5' end and a quenching group at its 3' end. The AAV vector drug is an AAV vector drug used to treat hemophilia A, and its target gene sequence is the FVIII gene.

2. The sequence composition according to claim 1, characterized in that, The fluorescent group is selected from one of FAM, HEX, CY5 and Texas Red; and / or, the quenching group is BHQ1 or BHQ2.

3. The sequence composition according to claim 2, characterized in that, The nucleotide sequence of the first probe is shown in SEQ ID NO:

4.

4. A kit for detecting the tissue distribution and / or expression level of AAV vector drugs, characterized in that, The kit comprises the sequence composition according to any one of claims 1 to 3; The AAV vector drug is an AAV vector drug used to treat hemophilia A, and its target gene sequence is the FVIII gene.

5. The reagent kit according to claim 4, characterized in that, The kit also includes DNA standards, the nucleotide sequences of which are shown in SEQ ID NO:

15.

6. The reagent kit according to claim 5, characterized in that, The kit also includes a first blank matrix, which is a solution of genomic DNA from a blank test animal.

7. The reagent kit according to claim 6, characterized in that, The first blank matrix was prepared using a method comprising the following steps: (1-1) Genomic DNA was extracted from the tissues of blank test animals; (1-2) Dilute the genomic DNA to a concentration of 100 ng / μL using a buffer solution or sterile enzyme-free water.

8. The reagent kit according to claim 4, characterized in that, The kit also includes an RNA standard, the nucleotide sequence of which is shown in SEQ ID NO:

5.

9. The reagent kit according to claim 8, characterized in that, The kit also includes a second blank matrix, which is a solution of RNA from a blank test animal.

10. The reagent kit according to claim 9, characterized in that, The second blank matrix was prepared using a method comprising the following steps: (2-1) RNA was extracted from the tissues of blank test animals; (2-2) The RNA was diluted with enzyme-free sterile water to a concentration of 100 ng / μL.

11. The kit according to claim 4, characterized in that, The kit also includes a sequence composition for AAV virus screening, comprising a second forward primer, a second reverse primer, and crRNA, wherein: The nucleotide sequence of the second forward primer is shown in SEQ ID NO: 6; The nucleotide sequence of the second reverse primer is shown in SEQ ID NO: 7; The nucleotide sequence of the crRNA is shown in SEQ ID NO:

8.

12. The kit according to claim 11, characterized in that, The sequence composition for AAV virus screening further includes a second probe, wherein the nucleotide sequence of the second probe is as shown in 5'-TCCTTATT-3', and the 5' end of the second probe has a fluorescent group and / or the 3' end of the second probe has a quenching group.

13. The reagent kit according to claim 12, characterized in that, The nucleotide sequence of the second probe is shown as 5'-FAM-TCCTTATT-BHQ1-3'.

14. The kit according to any one of claims 11 to 13, characterized in that, The kit also includes a positive control for AAV virus screening, wherein the positive control is a recombinant plasmid containing a nucleotide sequence as shown in SEQ ID NO:16.

Citation Information

Patent Citations

  • Primer probe, kit and method for rapidly detecting wild adeno-associated virus and application

    CN116622908A

  • Blood coagulation factor FVIII protein variant, expression vector and application

    CN116715752A

  • QPCR primer probe set, kit and method for detecting AAV genome titer

    CN117431345A

  • CRISPR / Cas12a-RPA-based sequence combination for rapidly detecting mouse hepatitis virus and kit thereof

    CN120796593A