Methods, immunogens, compositions and uses for identifying bovine coronavirus spike protein neutralizing epitopes
By combining online B-cell epitope prediction, self-assembled nanoparticle display, and virus neutralization verification, neutralizing antigenic epitopes of the BCoV S protein were screened and identified. This solved the problems of the lack of commercially available formulations of bovine coronaviruses and the low efficiency of traditional identification methods in existing technologies, and enabled the application of efficient screening and neutralizing antigenic epitopes.
Patent Information
- Application Number
- CN202511976395.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-12-25
AI Technical Summary
There is a lack of commercially available preventive or therapeutic agents against bovine coronavirus (BCoV) in the current technology, and traditional methods for identifying neutralizing antigenic epitopes are time-consuming, costly, and have low throughput, making them ineffective for screening neutralizing antigenic epitopes of the BCoV S protein.
By combining online B-cell epitope prediction, self-assembled nanoparticle display, and virus neutralizing function verification, neutralizing antigenic epitopes of the BCoV S protein were screened and identified. The Helicobacter pylori ferritin subunit was genetically fused with candidate linear epitope peptides to form ferritin nanoparticle immunogens, which were then used for immunization, and the epitope-specific antibody response and neutralizing activity were detected.
This method enables efficient screening of BCoV S protein neutralizing antigenic epitopes within a short timeframe, improves immunogenicity and neutralizing antibody induction capacity, provides neutralizing B cell antigenic epitopes for vaccine design and neutralizing antibody development, and can reduce or block BCoV infection and related symptoms.
Smart Images

Figure CN121385299A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological technology, in particular to a method for identifying neutralizing antigenic epitopes in bovine coronavirus spike protein, immunogen, composition and use. BACKGROUND
[0002] Bovine coronavirus (BCoV) can cause diarrhea in calves, winter dysentery and respiratory disease in adult cattle, which seriously affects the health of cattle and the production efficiency of breeding, and causes significant economic losses. At present, there is no commercialized prophylactic or therapeutic preparation against BCoV in China. The spike (S) protein is a key glycoprotein for BCoV to invade host cells, which contains multiple antigenic epitopes that can induce neutralizing antibodies, and is a core target for vaccine design and antibody drug development. However, so far there has been no public report on the systematic identification and application of neutralizing antigenic epitopes of BCoV S protein.
[0003] Traditional identification of neutralizing epitopes usually relies on synthetic peptide screening, monoclonal antibody epitope mapping or structural biology analysis, which has problems such as long cycle, high cost and limited throughput. In recent years, linear B cell epitope prediction based on ABCpred and other platforms provides a technical basis for rapid screening of candidate linear epitopes. However, the epitopes are usually short peptides, which have weak immunogenicity and are often difficult to induce strong and persistent immune responses, and usually need to be combined with suitable carrier proteins to enhance immunogenicity. Self-assembled protein nanoparticles such as ferritin can display foreign epitopes in a multivalent form, significantly improving the immunogenicity of the epitopes, and have become an important carrier for new generation of vaccine design. However, how to organically integrate the online epitope prediction, self-assembled nanoparticle display and verification process based on functional virus neutralization experiments to construct an efficient and generalizable neutralizing antigenic epitope identification technology route is still a technical problem to be solved in the field. SUMMARY
[0004] Therefore, the purpose of the present application is to provide a method for identifying neutralizing antigenic epitopes in bovine coronavirus spike protein, immunogen, composition and use, to solve the problems in the prior art that there is no commercialized prophylactic or therapeutic preparation against bovine coronavirus (BCoV), and there is no public report on the systematic identification and application of neutralizing antigenic epitopes of BCoV S protein, and the traditional epitope identification method has problems such as long cycle, high cost and low throughput.
[0005] In order to achieve the above purpose, the present application provides a method for identifying neutralizing antigenic epitopes in bovine coronavirus spike protein, wherein the neutralizing antigenic epitopes are neutralizing B cell antigenic epitopes, comprising the following steps:
[0006] A plurality of candidate linear epitope peptide segments are obtained, the candidate linear epitope peptide segments are genetically fused to the H. pylori ferritin subunit in a single epitope or multi-epitope tandem form, and a prokaryotic expression system is used to express and obtain a fusion protein, and the fusion protein self-assembles to form a ferritin nanoparticle immunogen;
[0007] The ferritin nanoparticle immunogen is used to immunize mice, an epitope-specific antibody response is detected based on the serum of the immunized mice and by enzyme-linked immunosorbent assay, and neutralizing activity is evaluated by a virus neutralization test;
[0008] Based on the neutralizing activity results, a neutralizing B cell antigen epitope is screened and identified.
[0009] Alternatively, the plurality of candidate linear epitope peptide segments are obtained by the following steps:
[0010] Linear B cell epitopes of the BCoV S protein are predicted by using ABCpred or similar platforms to obtain a primary screening set;
[0011] Secondary screening of high-antigenicity linear B cell epitopes is performed according to Vaxijen;
[0012] Allergenicity-free and toxicity-free third screening of the screened high-antigenicity linear B cell epitopes is performed by using Allertop and Toxinpred platforms;
[0013] The amino acid sequences of all BCoV S proteins in the GenBank database are downloaded, and after conservative analysis of the epitopes screened in the three screenings, epitopes with a conservation of > 70% are selected to form a final linear B cell epitope candidate list.
[0014] Alternatively, the length of the candidate linear epitope peptide segment is 16-20 amino acids.
[0015] Alternatively, the H. pylori ferritin subunit is a wild type or a functional equivalent with an amino acid identity of ≥ 90%.
[0016] Alternatively, the candidate linear epitope peptide segments are connected to the H. pylori ferritin subunit by a flexible linker peptide, and the flexible linker peptide comprises 2 repeating units, and the repeating unit is GGGS.
[0017] Alternatively, the virus neutralization test is selected from virus neutralization tests for evaluating antibody titers.
[0018] The present application provides a neutralizing B cell antigen epitope obtained by any of the above-mentioned methods for identifying neutralizing antigen epitopes of the bovine coronavirus spike protein, and the neutralizing B cell antigen epitope is selected from at least one of the peptide segments listed in SEQ ID NO: 1 to SEQ ID NO: 10.
[0019] or a conservative variant thereof having at least 90% amino acid identity thereto, wherein the neutralizing epitopes are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8.
[0020] The present application provides a multi-epitope combined immunogen comprising all the neutralizing B cell antigen epitopes described above, and adjacent epitopes are separated by flexible connecting peptides.
[0021] The present application provides a multi-epitope combined composition, which can further comprise a pharmaceutically acceptable carrier and / or adjuvant, and also comprises the immunogen described above.
[0022] The present application provides the use of the neutralizing B cell antigen epitopes, immunogens and compositions in the preparation of a medicament for preventing or treating diseases caused by BCoV.
[0023] The present application provides the use of the neutralizing B cell antigen epitopes, immunogens and compositions in the preparation of an in vitro diagnostic reagent for detecting neutralizing antibodies against BCoV S protein in a sample.
[0024] The method for identifying neutralizing antigen epitopes of bovine coronavirus spike protein, immunogen, composition and use provided by the present application have the following technical effects:
[0025] (1) The method combines online B cell epitope prediction, self-assembled nanoparticle carrier display and virus neutralization function verification organically, and can efficiently screen and confirm the neutralizing antigen epitopes on the BCoV S protein in a short period and at a low cost.
[0026] (2) A further object is to provide a group of BCoV S protein neutralizing antigen epitopes identified by the above method, the amino acid sequences of which are shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, which can be used for vaccine design and neutralizing antibody development.
[0027] (3) Still another object is to provide an immunogen constructed based on the neutralizing antigen epitopes, preferably a multi-epitope immunogen formed by linking and fusing multiple neutralizing epitopes to a Helicobacter pylori ferritin skeleton through flexible connecting peptides, so as to realize multivalent and high-density display of the neutralizing epitopes, thereby significantly improving immunogenicity and neutralizing antibody induction capacity.
[0028] (4) The present application also aims to provide an immunological composition comprising the immunogen and uses thereof, which can further comprise a pharmaceutically acceptable carrier and / or adjuvant, for preparing a vaccine or immunological preparation for preventing or treating BCoV infection, inducing the body to produce neutralizing antibodies against BCoV, thereby reducing or blocking the occurrence of BCoV infection and related clinical symptoms. BRIEF DESCRIPTION OF DRAWINGS
[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the following embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.
[0030] Figure 1 Schematic diagram of the overall process for epitope identification;
[0031] Figure 2 SDS-PAGE diagram after 10 candidate epitope-ferritin fusion expression proteins (M represents protein maker, lanes 1-10 correspond to single epitope-ferritin fusion expression proteins B1-B10 respectively, lane 11 is empty vector control);
[0032] Figure 3 Western blot identification diagram after 10 candidate epitope-ferritin fusion expression (M represents protein maker, lanes 1-10 correspond to single epitope-ferritin fusion expression proteins B1-B10 respectively, lane 11 is empty vector control);
[0033] Figure 4 Transmission electron microscopy (TEM) diagram of single epitope-ferritin self-assembly nanoparticles;
[0034] Figure 5 Virus neutralization titer diagram of each immune group of single epitope tandem ferritin;
[0035] Figure 6A SDS-PAGE diagram of the construction of a multi-epitope immunogen containing 6 neutralizing epitopes, wherein M represents protein maker, lane 1 is the multi-epitope immunogen protein, and lane 2 is the empty vector control;
[0036] Figure 6B Western blot diagram of the construction of a multi-epitope immunogen containing 6 neutralizing epitopes, wherein M represents protein maker, lane 1 is the multi-epitope immunogen protein, and lane 2 is the empty vector control;
[0037] Figure 7 Transmission electron microscopy (TEM) diagram of multi-epitope-ferritin self-assembly nanoparticles. Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0039] The neutralizing effect of S protein on B-cell antigenic epitopes and the specific antibodies induced by these epitopes play a crucial role in inhibiting viral invasion of the body. Neutralizing B-cell antigenic epitopes, also known as antigenic determinants, are specific sequences of amino acids (also called polypeptides) on pathogen proteins (also called antigens) that can specifically bind to B-cell antigen receptors and specific antibodies.
[0040] Optional embodiments and their scope of protection are described below:
[0041] Epitope variants: peptides containing one or more conserved substitutions, deletions, or insertions of amino acids that retain neutralizing activity;
[0042] Homology: This also applies to sequences with at least 90%, 95%, or 98% amino acid identity;
[0043] Vectors and systems: Equivalent substitutions of expression vectors, host strains, purification methods, and adjuvant systems do not affect the scope of protection of this invention;
[0044] Functional definition: The criterion is the induction of serum or antibodies with substantial neutralizing activity against BCoV.
[0045] The following detailed embodiments further illustrate the technical effects of the method, immunogen, composition, and uses of the present invention for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein. However, the specific implementation methods mentioned in these embodiments are merely illustrative examples of the technical solutions of the present invention and are not intended to limit the scope of the invention.
[0046] The reagents and materials used in the examples are as follows:
[0047] HCT-8 cells were preserved by the Animal Medicine Laboratory of Southwest University for Nationalities; bovine coronavirus strain (XHD strain, GenBank accession number: OR621178.1) was preserved by the Animal Medicine Laboratory of Southwest University for Nationalities; E. coli BL21 (DE3) competent cells were purchased from Beijing Cheng Biotechnology Co., Ltd.; hypersensitive ECL chemiluminescence substrate was purchased from Sibeier Biotechnology Co., Ltd.; horseradish peroxidase (HRP) labeled goat anti-mouse IgG (H+L) were purchased from Beijing Boao Sun Biological Technology Co., Ltd.; BCA protein concentration determination kit was purchased from Doctor Deer Biological Engineering Co., Ltd.; enzyme-labeled plate was purchased from Wuxi Naisi Life Science and Technology Co., Ltd.; BSA and ELISA termination liquid were purchased from Solabio Technology Co., Ltd.; His Cap 6FF nickel ion purification column was purchased from Changzhou Tiandi Renhe Biological Technology Co., Ltd.; animal immunization adjuvant Montanide ISA 201 adjuvant was purchased from SEPPIC company.
[0048] Example 1: Screening of candidate linear epitopes
[0049] This example is aimed at screening candidate linear epitopes for BCoV S protein, as shown in Figure 1
[0050] Firstly, the representative sequence of S protein (GenBank accession number: OR621178) in GenBank database was subjected to linear B cell epitope prediction (threshold set to >0.51, epitope length 16-20 amino acids) using ABCpred platform to obtain the primary screening set; then, secondary screening of high antigenicity linear B cell epitopes was performed according to Vaxijen (high antigenicity prediction threshold set to score >1); finally, the high antigenicity linear B cell epitopes screened were subjected to third screening of non-allergenicity and non-toxicity using Allertop and Toxinpred platforms.
[0051] All BCoV S protein amino acid sequences in GenBank database (a total of 492) were downloaded, and the epitopes after three screenings were subjected to conservation analysis to select epitopes with conservation >70% to form the final linear B cell epitope candidate list.
[0052] Based on the results of Vaxijen antigenicity strength, non-allergenicity and non-toxicity, and sequence conservation, 10 candidate linear epitopes (see Table 1 for sequences) were finally determined, which can be used for identification of BCoV neutralizing antigen epitopes in the next step.
[0053] Table 1: Information of candidate linear B cell epitope list
[0054]
[0055] Example 2: Construction and expression of candidate epitope-ferritin fusion AsFigure 1 As shown, comprising the following steps:
[0056] 2.1 Vector construction: the candidate linear epitope [SEQ ID NO: 1-10] was fused with the N-terminal of H. pylori ferritin subunit (SEQ ID NO: 11) through a flexible linker peptide (GGGS)2, and both were selected for SacI and XhoI enzyme digestion sites to be connected to the PET28a vector, which was synthesized and constructed by GenScript Biotech Corporation.
[0057] 2.2 Transformation: the constructed 10 expression vectors were respectively transformed into BL21 (DE3) E. coli competent cells according to the heat shock method, and single colonies on LB plates were picked into 1 mL of liquid LB and placed in a 37°C benchtop constant temperature shaker at a rotation speed of 200 rpm for overnight culture. 2 μL was used as a template for PCR amplification using T7 promoter universal primers (primer sequence F: TAATACGACTCACTATAGGG; primer sequence R: TGCTAGTTATTGCTCAGCGG), followed by gel electrophoresis. The bands were observed under the gel imaging system, and the bands that met the purpose and were identified as correct by sequencing were identified as positive clones for the next step of protein expression.
[0058] 2.3 Protein induction expression and purification: 10 bottles of 100 ml liquid LB medium were prepared, and 1 ml of the 10 different positive clones selected was added at a ratio of 100:1, and placed in a 16°C benchtop constant temperature shaker at a rotation speed of 200 rpm. When the OD450 nm value reached 0.6, 1 mM IPTG was added for low-temperature induction expression for 12-14 h. Then, 10 mL of bacterial liquid was taken and centrifuged at 5000 rpm for 5 min, and the supernatant was discarded. The bacterial slurry was resuspended with 2 mL of PBS buffer. 20 μL of resuspended bacteria was taken, 5 μL of SDS loading solution was added at a ratio of 4:1, and then boiled in water for 5 min. The SDS-PAGE sample was prepared and identified for protein expression, and the results were detected as clear bands near the expected molecular weight (about 25 kDa), as shown in Figure 2 , indicating protein expression. Then, 1 mL of resuspended bacteria was taken, and the bacteria were broken by ultrasonic crushing instrument to identify the protein form. Then, Ni-NTA affinity chromatography was used for protein purification according to the instructions. The protein was determined for concentration after purification, and the proteins were named B1-B10, respectively, corresponding to epitopes SEQ ID NO: 1-10.
[0059] 2.4 Western blot expression verification of B1-B10 proteins
[0060] SDS-PAGE loading was prepared according to 2.3, and after electrophoresis, the membrane was transferred to PVDF membrane (methanol pre-activation for 60 s). 5% skim milk (dissolved in TBST) was used for blocking at 37 °C on a horizontal shaker for 2 h (rotation speed 40 rpm), and TBST was washed 3 times (5 min each time). Mouse anti-His monoclonal antibody was added as the primary antibody (TBST dilution, dilution 1:5,000), and slowly shaken at 4 °C overnight; TBST was washed 3 times (5 min each time). HRP-labeled goat anti-mouse IgG was added as the secondary antibody (dilution 1:10,000), and incubated at 37 °C for 2 h; TBST was washed 3 times (5 min each time). The hypersensitive ECL chemiluminescence substrate was used for development. Clear bands were detected near the expected molecular weight (about 25 kDa), and the bands of interest in samples B1 and B10 were obvious; no bands of interest were observed in the empty sample (PET28a empty vector transformed BL21 after induction), as shown in Figure 3 .
[0061] The above results show that the corresponding sample proteins are successfully expressed and can be specifically recognized by anti-His antibody, and have good reactivity.
[0062] 2.5 Self-assembly identification of 10 candidate epitopes-ferritin: TEM was used to observe the purified proteins. The sample was dropped on a copper mesh, adsorbed for 5 min; the liquid was absorbed with filter paper; the copper mesh was covered with uranyl acetate staining solution, and stained for 5 min; the liquid was absorbed with filter paper, and the protein morphology was observed under a transmission electron microscope. Based on the above results, B1-B10 proteins self-assembled into approximately spherical nanoparticles, as shown in Figure 4 .
[0063] Example 3: Animal immunization and immunogenicity evaluation as shown below, including the following steps: Figure 1
[0064] 3.1 Preparation of immunogen: 50 μg of the purified proteins B1-B10 in 2.3 were mixed with Montanide ISA201 adjuvant at a volume ratio of 1:1 to prepare the immunogen.
[0065] 3.2 Animal grouping and immunization: The prepared immunogen containing B1-B10 proteins was subcutaneously immunized in the neck of SPF Balb / c mice (6 mice / group) at a dose of 100 μL / mouse, and a negative immunization group (PBS+adjuvant group, 100 μL / mouse) was set. A total of 2 immunizations were performed, with an interval of 14 days. The maximum amount of mouse blood was collected on the 14th day after the second immunization, and ELISA and neutralization test were performed.
[0066] 3.3 ELISA detection: The mouse serum collected in section 3.2 was detected for specific antibody level by the indirect ELISA method based on BCoV whole virus established in the laboratory. The specific steps are as follows:
[0067] Coating of enzyme-labeled plate: 1 mL of BCoV whole virus (virus titer 10 8 TCID 50 / mL) was diluted with PBS at a volume ratio of 1:10, shaken and mixed, and then 100 μL / well was added, and coated at 4 ℃ for 12 h. After discarding the liquid, the plate was washed with PBST for 3 times (3 min each time).
[0068] Blocking: 100 μL of 2% BSA (prepared in PBST) was added to each well, and incubated at 37 ℃ for 1 h. After discarding the liquid, the plate was washed with PBST for 3 times (3 min each time).
[0069] Primary antibody incubation: The collected immune mouse serum was used as the primary antibody, diluted by two-fold gradient from 1:100, 100 μL / well was added, and incubated at 37 ℃ for 1 h. After discarding the liquid, the plate was washed with PBST for 3 times (3 min each time).
[0070] Secondary antibody incubation: The HRP-labeled goat anti-mouse IgG was diluted with antibody diluent at 1:5,000, 100 μL / well was added, and incubated at 37 ℃ for 1 h. After discarding the liquid, the plate was washed with PBST for 3 times (3 min each time).
[0071] Color development and termination: 100 μL of TMB color developing liquid was added to each well, and incubated at 37 ℃ in the dark for 10 min; the reaction was terminated by adding the termination liquid. The absorbance value was read at 450 nm using an enzyme-labeled instrument.
[0072] Judgment standard and control: The negative control (serum of mice in the immunization PBS+adjuvant group) was detected synchronously. The positive judgment was made by P / N ratio method: P / N ≥ 2.1 was determined as positive, wherein P was the OD450 of the sample, N was the average OD450 of the negative control, and the serum titer was the average of the highest dilution of serum of each mouse in the group when P / N ≥ 2.1.
[0073] Experimental results: On the 14th day after the second immunization, the serum of mice in the B1-B10 immunization groups all reached the positive judgment standard (P / N ≥ 2.1) in the detection by the method, indicating that specific IgG antibodies against BCoV were produced in each immunization group (Table 2).
[0074] Table 2 P / N values of each group
[0075]
[0076] 3.4 Evaluation of neutralizing antibody titer: The immune mouse serum collected in 3.2 was detected for BCoV neutralizing antibody.
[0077] Specific operation as follows: HCT-8 cells full of cell culture bottle were passaged to 96-well plates, and incubated at 37 ℃ for 24-48 h, and then inactivated at 56 ℃ for 30 min, and then diluted with serum-free DMEM medium without double antibody by 2 times of gradient dilution, mixed with 200 TCID50 of BCoV (XHD4 strain GenBank accession number: OR621178), and incubated at 37 ℃ for 1 h; the 96-well plate containing HCT-8 cells was taken out, and then washed twice with Hanks, and then the mixed culture solution after incubation was added to the 96-well plate, 100 μL per well, and then incubated at 37 ℃, and then observed once every 12 h, and then recorded the pathological condition of each well, and then the titer of neutralizing antibody in serum was calculated by Reed-muech method.
[0078] Determination criteria and control: the determination of virus neutralization titer is positive, and the serum of the PBS+adjuvant group of mice without virus neutralization titer is used as negative control.
[0079] Experimental results: on the 14th day after the second immunization, the serum of the B1-B10 immunized mice was detected by the method, and 6 of them had neutralizing antibody titers, which were B1, B2, B4, B6, B7, B8, respectively, corresponding to the epitope sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively, as shown in Figure 5 .
[0080] Example 4: Construction and application of multi-epitope immunogen
[0081] Based on the 6 neutralizing epitopes identified in Examples 1-3, a multi-epitope immunogen was constructed by designing multiple copies in series and flexible connecting peptides, and its immunogenicity and neutralizing activity were verified. This example is only used to illustrate the present application, and does not constitute a limitation on the scope of protection of the present application.
[0082] 4.1 Epitope source and copy number setting: in this example, the 6 neutralizing epitopes identified in the foregoing examples were selected, and were denoted as epitopes Ep1, Ep2, Ep34, Ep6, Ep7 and Ep8 (the amino acid sequences thereof correspond to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively).
[0083] To enhance the frequency of each epitope presentation and improve the ability to induce neutralizing antibodies, each neutralizing epitope was connected in series and then connected to the N-terminus of the H. pylori subunit. Each epitope repeat unit and adjacent different epitope modules were connected by the flexible linker (GGGS)2as Linker to ensure the relative independence of each epitope in spatial conformation, which is beneficial to the full exposure of B cell epitopes.
[0084] Ep1–L–Ep2–L–Ep4–L–Ep6–L–Ep7–L–Ep8–L–H. pylori ferritin subunit, wherein L is Linker.
[0085] 4.2 Expression and purification of multi-epitope immunogen protein: The multi-epitope immunogen constructed in this example was subjected to protein expression and purification according to the method steps described in Example 2 and Example 3 above. Briefly, the recombinant plasmid encoding the “multi-epitope peptide-H. pylori ferritin” fusion protein was transformed into E. coli BL21 (DE3), and after induction of expression, the bacterial cells were collected, ultrasonically broken, and purified by Ni-NTA affinity chromatography to obtain the multi-epitope immunogen protein.
[0086] SDS-PAGE and Western blot verification showed that the multi-epitope immunogen protein was successfully expressed, the target band was clear, and its molecular weight was basically consistent with the theoretically calculated size of the target protein (about 35 kDa, as shown in Figure 6A and Figure 6B , indicating that the multi-epitope fusion protein was successfully expressed. TEM observation showed uniform nanoparticles, proving that the multi-epitope tandem H. pylori ferritin subunit was successfully self-assembled, as shown in Figure 7 .
[0087] 4.3 Animal immunization and immunogenicity evaluation of multi-epitope: The immunogen was prepared according to the methods of 3.1 and 3.2 in Example 3 above, and the multi-epitope immunogen protein obtained in this example was emulsified with adjuvant as an immunization preparation. The multi-epitope immunogen group and the PBS+adjuvant group were set up for immunization. The immunization program and blood sampling time points were performed according to the steps of 3.3 in Example 3. After immunization, the serum of each group of animals was subjected to ELISA to detect the specific antibody titer against BCoV according to the methods of 3.3 and 3.4 in Example 3, and the in vitro neutralization activity was evaluated by virus neutralization experiment.
[0088] The results showed that the specific antibody titers against the six neutralizing epitopes in the serum of the multi-epitope immunogen group animals were significantly increased, and could effectively neutralize the infection of the target virus, showing a high neutralizing antibody titer (Table 3).
[0089] The above results show that the multi-epitope immunogen constructed in the embodiment has good immunogenicity and neutralization activity, and can be used as a candidate immunogen for the development of subsequent vaccines or related prevention / treatment preparations.
[0090] Table 3 Immunogenicity evaluation of multi-epitope immunogens
[0091]
[0092] The above merely provides a specific implementation of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.
Claims
1. A method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein, wherein, The neutralizing antigen epitope is a neutralizing B-cell antigen epitope, characterized by comprising the following steps: Several candidate linear epitope peptides were obtained, and the candidate linear epitope peptides were genetically fused with Helicobacter pylori ferritin subunit in the form of single epitope or multiple epitope tandem. The fusion protein was expressed using a prokaryotic expression system and obtained. The fusion protein self-assembled to form ferritin nanoparticle immunogen. The ferritin nanoparticle immunogen was used to immunize mice, and the epitope-specific antibody response was detected based on the serum of the immunized mice by enzyme-linked immunosorbent assay (ELISA), and its neutralizing activity was evaluated by virus neutralization assay. Based on the neutralization activity results, neutralizing B-cell antigenic epitopes were screened and identified.
2. The method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein according to claim 1, characterized in that, The acquisition of several candidate linear epitope peptides is achieved through the following steps: Linear B-cell epitope prediction of BCoV S protein was performed using ABCpred or similar platforms to obtain an initial screening set. Secondary screening of highly antigenic linear B-cell epitopes was performed based on Vaxijen. The highly antigenic linear B-cell epitopes were screened using the Allertop and Toxinpred platforms to perform a third screening that was non-allergenic and non-toxic. Download the amino acid sequences of all BCoV S proteins from the GenBank database. After three rounds of screening, perform conservation analysis on the epitopes and select epitopes with conservation >70% to form the final linear B-cell epitope candidate list.
3. The method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein according to claim 1, characterized in that, The candidate linear epitope peptide is 16-20 amino acids in length.
4. The method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein according to claim 1, characterized in that, The Helicobacter pylori ferritin subunit is wild-type or a functional isomorph with ≥90% amino acid identity; The candidate linear epitope peptides are connected to the Helicobacter pylori ferritin subunits via flexible linker peptides, each linker peptide comprising two repeating units, the repeating units being GGGS.
5. The method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein according to claim 1, characterized in that, The virus neutralization test is selected from the virus neutralization test for the evaluation of antibody titer.
6. A neutralizing B-cell antigenic epitope obtained by the method for identifying neutralizing antigenic epitopes of bovine coronavirus spike protein as described in any one of claims 1-5, characterized in that, The neutralizing B-cell antigen epitope is selected from at least one of the peptides listed in SEQ ID NO:1 to SEQ ID NO:10; Or a conserved variant thereof having at least 90% amino acid identity, wherein the peptides having neutralizing activity are SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:
8.
7. An immunogen with a combination of multiple epitopes, characterized in that, It contains the neutralizing B-cell antigen epitope as described in claim 6, and adjacent epitopes are separated by flexible linking peptides.
8. A composition comprising multiple epitopes, characterized in that, The composition may further comprise a pharmaceutically acceptable carrier and / or adjuvant, and also comprises the immunogen according to claim 7.
9. Use of neutralizing B-cell antigenic epitopes, immunogens, and compositions in the preparation of medicaments for the prevention or treatment of diseases caused by BCoV.
10. Use of neutralizing B-cell antigenic epitopes, immunogens, and compositions in the preparation of in vitro diagnostic reagents for detecting neutralizing antibodies against the BCoV S protein in samples.
Citation Information
Patent Citations
Recombinant multi-epitope antigen of bovine coronavirus and application thereof
CN107033250A
Construction method and application of coronavirus antigen on the basis of mosaic strategy
CN111533790A
Bovine coronavirus indirect ELISA antibody detection kit and application thereof
CN116559439A
Construction and application of broad-spectrum new crown nanoparticle vaccine for displaying pre-stored antibody corresponding epitopes
CN117362449A
Bovine coronavirus multi-epitope polypeptide and application thereof
CN118496376A