A virus envelope chimeric receptor and related biomaterials and applications thereof

By optimizing the structure of the viral envelope chimeric receptor and the CoVSVG envelope glycoprotein, the problems of insufficient antiserum activity and target specificity in existing lentiviral vector technologies have been solved, achieving efficient and stable T cell targeted infection, reducing the non-T cell infection rate, and improving the transduction rate of the virus in human serum.

CN121405820BActive Publication Date: 2026-06-26JIANGSU HILLGENE BIOPHARMA CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU HILLGENE BIOPHARMA CO LTD
Filing Date
2025-12-29
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing lentiviral vector technologies cannot simultaneously satisfy both antiserum activity and target specificity, resulting in high non-T cell infection rates and failing to meet clinical-grade specificity requirements. Furthermore, antibodies are prone to conflict with hinge and transmembrane structures, resulting in insufficient antibody flexibility and difficulty in efficiently recognizing CD3 antigenic epitopes on the surface of T cells.

Method used

By optimizing the hinge and transmembrane regions of the viral envelope chimeric receptor and performing K47Q/R354Q mutations on the extracellular region of the CoVSVG envelope glycoprotein, replacing it with the corresponding region of vesicular stomatitis virus, the stability and infectivity of the virus in human serum are improved, and the non-T cell infection rate is reduced.

Benefits of technology

It significantly reduced the infection rate of the virus on non-T cells such as CD19+ B cells and hepatocytes, improved the virus's infectivity and stability, and provided a safety guarantee for in vivo CAR-T preparation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121405820B_ABST
    Figure CN121405820B_ABST
Patent Text Reader

Abstract

The application provides a virus envelope chimeric receptor and related biomaterials and applications thereof, and belongs to the technical field of molecular biology. Specifically disclosed is a virus envelope chimeric receptor, which comprises, in sequence, an antibody or antigen-binding fragment thereof, a hinge region, a transmembrane region and an intracellular region; the hinge region is selected from a hinge region composed of a hinge region of a CD8 molecule and a hinge region of a vesicular stomatitis virus envelope glycoprotein; the transmembrane region of the virus envelope chimeric receptor is selected from a transmembrane region of the vesicular stomatitis virus envelope glycoprotein; and the intracellular region of the virus envelope chimeric receptor is selected from an intracellular region of the vesicular stomatitis virus envelope glycoprotein. The virus envelope chimeric receptor is used for virus targeting, can improve the infection ability of viruses, reduces the infection rate of viruses on non-T cells to less than 5%, provides a safety guarantee for in-vivo CAR-T preparation, and can be used for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention patent belongs to the field of molecular biology technology, specifically relating to a viral envelope chimeric receptor and its related biomaterials and applications. Background Technology

[0002] Current in vivo lentiviral vector technologies (represented by Interius, Umoja, and EsoBiotec) employ targeting strategies that redirect natural tropism to T cell markers such as CD7, CD3, and TCR by "grafting" single-chain antibodies (scFv) or nanobodies (VHH) onto the envelope surface. Some of these lentiviral vector technologies (represented by Interius and EsoBiotec) primarily rely on the envelope glycoprotein of Indiana vesiculovirus, namely VSV-G or VSVG. Point mutations are performed on VSV-G to reduce LDL-R dependence while retaining its fusion function. However, VSV-G is easily inactivated by human serum complement, reducing its efficacy and inducing an unfavorable complement-dependent immune response against VSV-G in patients.

[0003] The technology represented by Umoja utilizes the envelope protein of wild-type cocal vesicocele virus (also known as the wild-type cocal vesicocele virus envelope glycoprotein), namely Cocal-G or CocalG. This virus belongs to the same genus as Indiana vesicocele virus, but is serologically different. It can compensate for the insufficient serum inactivation of VSV-G. However, it retains the binding ability of LDL-R, increasing the transduction capacity to non-target cells such as liver, spleen, and hematopoietic progenitor cells, showing significant safety risks.

[0004] Therefore, current lentiviral platform technologies cannot simultaneously satisfy both antiserum activity and target specificity. While some modified protocols introduce anti-CD3 single-chain antibodies (scFv) to target T cells, these are mostly simple spliced ​​structures. The spatial conformation of the antibody with the hinge and transmembrane structure is prone to conflict, resulting in the masking of the CD3 binding site. This still results in a 10%-20% non-T cell infection rate, failing to meet clinical-grade specificity requirements. Furthermore, these structures often lack a suitable hinge region, leading to insufficient antibody flexibility and difficulty in efficiently recognizing CD3 antigenic epitopes on the surface of T cells. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a viral envelope chimeric receptor, related biomaterials, and applications. First, by optimizing the structure of single-chain antibodies or nanobodies on the surface of lentiviral vector envelopes in vivo, the virus gains enhanced infectivity. Second, by optimizing viral envelope glycoproteins, the virus exhibits higher stability and infectivity in human serum. Through these dual optimizations, the viral resistance to CD19 is significantly reduced. + The infection rate of non-T cells such as B cells and hepatocytes is increased, which improves the virus's infectivity and stability, significantly reduces off-target side effects during in vivo application, and can provide a safety guarantee for in vivo CAR-T preparation.

[0006] In a first aspect, this application provides a viral envelope chimeric receptor, which sequentially comprises an antibody or its antigen-binding fragment, a hinge region, a transmembrane region, and an intracellular region; the hinge region includes hinge region 1; hinge region 1 of the viral envelope chimeric receptor is selected from the hinge region of the CD8 molecule; the transmembrane region of the viral envelope chimeric receptor is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein; and the intracellular region of the viral envelope chimeric receptor is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein.

[0007] On the other hand, this application provides a nucleic acid molecule that includes encoding a viral envelope chimeric receptor as described above.

[0008] On the other hand, this application provides a nucleic acid construct comprising the aforementioned nucleic acid molecules.

[0009] On the other hand, this application provides a vector comprising the above-mentioned nucleic acid molecule or the above-mentioned nucleic acid construct.

[0010] On the other hand, this application provides a host cell comprising the aforementioned nucleic acid molecule, the aforementioned nucleic acid construct, or the aforementioned vector.

[0011] On the other hand, this application provides viral particles having an envelope, the envelope of which has envelope proteins, including the aforementioned viral envelope chimeric receptor.

[0012] On the other hand, this application provides a viral particle having an envelope, the envelope of which has envelope proteins, the envelope proteins of which include the aforementioned viral envelope chimeric receptor, and also include the CoVSVG envelope glycoprotein, the CoVSVG envelope glycoprotein sequentially comprising an extracellular region, a hinge region, a transmembrane region, and an intracellular region; the extracellular region of the CoVSVG envelope glycoprotein is selected from the extracellular region of the vesicular vesicular virus envelope glycoprotein; the hinge region of the CoVSVG envelope glycoprotein is selected from the hinge region of the vesicular stomatitis virus envelope glycoprotein; the transmembrane region of the CoVSVG envelope glycoprotein is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein; and the intracellular region of the CoVSVG envelope glycoprotein is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein.

[0013] On the other hand, this application provides a method for preparing viral particles, the method comprising the steps of introducing the above-mentioned nucleic acid molecules, the above-mentioned nucleic acid constructs or the above-mentioned vectors, envelope plasmids and packaging plasmids into host cells, and growing and culturing them under conditions suitable for producing viral particles.

[0014] On the other hand, this application provides a pharmaceutical composition comprising the above-described viral envelope chimeric receptor, the above-described nucleic acid molecule, the above-described nucleic acid construct, the above-described vector, the above-described host cell, the above-described viral particles or viral particles prepared using the above-described method, and further comprising pharmaceutically acceptable excipients.

[0015] On the other hand, this application provides the use of the above-mentioned viral envelope chimeric receptor, the above-mentioned nucleic acid molecule, the above-mentioned nucleic acid construct, the above-mentioned vector, the above-mentioned host cell, or the above-mentioned viral particle in the preparation of a drug, the drug being used to modify T cells.

[0016] Beneficial effects:

[0017] This application provides a viral envelope chimeric receptor, which optimizes the hinge region or transmembrane region of the viral envelope chimeric receptor. The optimized viral envelope chimeric receptor is used for viral targeting and infection, and can improve viral infectivity.

[0018] Furthermore, an CoVSVG envelope glycoprotein was provided, with optimized extracellular, hinge, transmembrane, and intracellular regions. Specifically, the extracellular region of the envelope glycoprotein was replaced with the extracellular region of wild-type Cocal-G and subjected to the K47Q / R354Q mutation. Additionally, the hinge, transmembrane, and intracellular regions were all replaced with the hinge, transmembrane, and intracellular regions of VSVG. Using the optimized CoVSVG envelope glycoprotein as a viral envelope protein for viral targeting and infection improved viral transduction and infectivity in human serum. Moreover, the virus retained more than 50% of its transduction activity in 100% human serum after incubation at 37°C for 60 min.

[0019] Further combining the optimized viral envelope chimeric receptor and CoVSVG envelope glycoprotein for viral infection can significantly reduce viral resistance to non-T cells (such as CD19). + The infection rate of B cells and hepatocytes was reduced to below 5%, significantly reducing off-target side effects of in vivo application and providing a safety guarantee for in vivo CAR-T preparation. Attached Figure Description

[0020] Appendix Figure 1 The diagram shows the structure of the fusion protein targeting CD3 (scFv); where ① the structure of αCD3 is αCD3(scFv)-CD8 hinge region-CD8 transmembrane region-VSVG intracellular region, ② the structure of αCD3 is αCD3(scFv)-CD8 hinge region-VSVG transmembrane region-VSVG intracellular region, and ③ the structure of αCD3 is αCD3(scFv)-CD8 hinge region-VSVG hinge region-VSVG transmembrane region-VSVG intracellular region.

[0021] Appendix Figure 2 This is a packaging flowchart for the group 1 virus, group 2 virus, and group 3 virus in Example 1.

[0022] Appendix Figure 3 The bar chart shows the infectivity of group 1 virus, group 2 virus and group 3 virus at different serum concentrations in Example 1. In this chart, WT VSVG represents group 1 virus, αCD3-mVSVG represents group 2 virus and αCD3-CoVSVG represents group 3 virus.

[0023] Appendix Figure 4 This is a flowchart of the packaging process for viruses in group 4, group 5, and group 6 in Example 2.

[0024] Appendix Figure 5 The image shows a bar chart of virus titers in Example 2. From left to right, the bar charts represent the titers of viruses in groups 4, 5, and 6.

[0025] Appendix Figure 6 This is a flowchart illustrating the transfection of Group 1 virus, Group 2 virus, and Group 3 virus into B cells and hepatocytes in Example 3. Detailed Implementation

[0026] The specific embodiments of this application will be further described in detail below with reference to the accompanying drawings. These embodiments are only for illustrating this application and are not intended to limit the scope of the invention.

[0027] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the cell culture, molecular genetics, nucleic acid chemistry, and immunology laboratory procedures used herein are all standard procedures widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0028] In a first aspect, this application provides a viral envelope chimeric receptor, which sequentially comprises an antibody or its antigen-binding fragment, a hinge region, a transmembrane region, and an intracellular region; the hinge region includes hinge region 1; hinge region 1 of the viral envelope chimeric receptor is selected from the hinge region of the CD8 molecule; the transmembrane region of the viral envelope chimeric receptor is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein; and the intracellular region of the viral envelope chimeric receptor is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein.

[0029] In a specific embodiment, the antibody or its antigen-binding fragment targets αCD3.

[0030] In a specific embodiment, the antibody or its antigen-binding fragment comprises HCDR1-HCDR3 as shown in SEQ ID:17-SED ID NO:19, and LCDR1-LCDR3 as shown in SEQ ID:21-SED ID NO:23.

[0031] In a specific embodiment, the amino acid sequence of the heavy chain variable region of the antibody or its antigen-binding fragment is shown in SEQ ID NO:16, and the amino acid sequence of the light chain variable region of the antibody or its antigen-binding fragment is shown in SEQ ID NO:20.

[0032] In a specific embodiment, the amino acid sequence of the antibody or its antigen-binding fragment is shown as positions 1-241 of SEQ ID NO:6.

[0033] In a specific embodiment, the amino acid sequence of the vesicular stomatitis virus envelope glycoprotein is shown in SEQ ID NO:10.

[0034] In a specific embodiment, the amino acid sequence of the hinge region 1 of the viral envelope chimeric receptor is shown as positions 242-296 of SEQ ID NO:6.

[0035] In a specific embodiment, the hinge region of the viral envelope chimeric receptor further includes a hinge region 2, wherein the hinge region 2 is selected from the vesicular stomatitis virus envelope glycoprotein.

[0036] In a specific embodiment, the amino acid sequence of the CD8 molecule is shown in SEQ ID NO:24.

[0037] In a specific embodiment, the amino acid sequence of the hinge region 2 of the viral envelope chimeric receptor is shown as positions 297-314 of SEQ ID NO:6.

[0038] In a specific embodiment, the hinge region of the viral envelope chimeric receptor sequentially includes hinge region 1 and hinge region 2.

[0039] In a specific embodiment, the amino acid sequence of the transmembrane region of the viral envelope chimeric receptor is shown as positions 315-340 of SEQ ID NO:6.

[0040] In a specific embodiment, the amino acid sequence of the intracellular region of the viral envelope chimeric receptor is shown as positions 341-361 of SEQ ID NO:6.

[0041] On the other hand, this application provides a nucleic acid molecule that includes encoding a viral envelope chimeric receptor as described above.

[0042] On the other hand, this application provides a nucleic acid construct comprising the aforementioned nucleic acid molecules.

[0043] On the other hand, this application provides a vector comprising the above-mentioned nucleic acid molecule or the above-mentioned nucleic acid construct.

[0044] On the other hand, this application provides a host cell comprising the aforementioned nucleic acid molecule, the aforementioned nucleic acid construct, or the aforementioned vector.

[0045] On the other hand, this application provides viral particles having an envelope, the envelope of which has envelope proteins, including the aforementioned viral envelope chimeric receptor.

[0046] In a specific embodiment, the envelope protein of the viral particle further includes the CoVSVG envelope glycoprotein, which sequentially comprises an extracellular region, a hinge region, a transmembrane region, and an intracellular region.

[0047] In a specific embodiment, the extracellular region of the CoVSVG envelope glycoprotein is selected from the extracellular region of the vesicular vesicular virus envelope glycoprotein; the hinge region of the CoVSVG envelope glycoprotein is selected from the hinge region of the vesicular stomatitis virus envelope glycoprotein; the transmembrane region of the CoVSVG envelope glycoprotein is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein; and the intracellular region of the CoVSVG envelope glycoprotein is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein.

[0048] In a specific embodiment, the hinge region, transmembrane region, and intracellular region are all selected from the vesicular stomatitis capsule toxic glycoprotein.

[0049] In a specific embodiment, the amino acid sequence of the hinge region of the CoVSVG envelope glycoprotein is shown as positions 447-464 of SEQ ID NO: 8, the amino acid sequence of the transmembrane region of the CoVSVG envelope glycoprotein is shown as positions 465-490 of SEQ ID NO: 8, and the amino acid sequence of the intracellular region of the CoVSVG envelope glycoprotein is shown as positions 491-511 of SEQ ID NO: 8.

[0050] In a specific embodiment, the amino acid sequence of the extracellular region of the Kokar vesicular virus envelope glycoprotein has K47Q and / or R354Q mutations compared to the wild type.

[0051] In a specific embodiment, the amino acid sequence of the extracellular region of the CoVSVG envelope glycoprotein is shown as positions 1-446 of SEQ ID NO: 8.

[0052] On the other hand, this application provides a method for preparing viral particles, the method comprising the steps of introducing the above-mentioned nucleic acid molecules, the above-mentioned nucleic acid constructs or the above-mentioned vectors, envelope plasmids and packaging plasmids into host cells, and growing and culturing them under conditions suitable for producing viral particles.

[0053] In a specific embodiment, the method further includes the step of separating and purifying the virus particles.

[0054] On the other hand, this application provides a pharmaceutical composition comprising the above-described viral envelope chimeric receptor, the above-described nucleic acid molecule, the above-described nucleic acid construct, the above-described vector, the above-described host cell, the above-described viral particles or viral particles prepared using the above-described method, and further comprising pharmaceutically acceptable excipients.

[0055] On the other hand, this application provides the use of the above-mentioned viral envelope chimeric receptor, the above-mentioned nucleic acid molecule, the above-mentioned nucleic acid construct, the above-mentioned vector, the above-mentioned host cell, or the above-mentioned viral particle in the preparation of a drug, the drug being used to modify T cells.

[0056] In specific embodiments, the uses include enhancing viral infectivity, enhancing viral serum resistance, or enhancing viral infectivity in the serum environment.

[0057] In a specific embodiment, the antigen-binding fragment against αCD3 is selected from Fab, Fab', Fd, Fv, dAb, ScFv, and complementarity-determining region fragments.

[0058] In a specific embodiment, the antibody is selected from antibodies, humanized antibodies, or chimeric antibodies.

[0059] In a specific embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

[0060] In a specific embodiment, the prokaryotic cell is a bacterial cell.

[0061] In a specific embodiment, the prokaryotic cell is an Escherichia coli cell.

[0062] In a specific embodiment, the eukaryotic cells are selected from yeast cells, insect cells, and mammalian cells.

[0063] In a specific embodiment, the mammalian cells are selected from CHO, 293T, HEK293, SP2 / 0, BHK, C127, etc.

[0064] In a specific embodiment, the eukaryotic cells are 293T cells.

[0065] In a specific embodiment, the virus is selected from adeno-associated virus, lentivirus, adenovirus, retrovirus, herpes simplex virus, vaccinia virus, or baculovirus.

[0066] In a specific embodiment, the virus particle further includes nucleic acid and a protein capsid.

[0067] In a specific embodiment, the protein capsid is selected from adeno-associated virus, lentivirus, adenovirus, retrovirus, herpes simplex virus, vaccinia virus, or baculovirus.

[0068] In a specific embodiment, the virus particle further includes a lipid envelope.

[0069] In a specific embodiment, the lipid envelope is selected from adeno-associated virus, lentivirus, adenovirus, retrovirus, herpes simplex virus, vaccinia virus, or baculovirus.

[0070] In a specific embodiment, the viral particle further includes a membrane protein selected from adeno-associated virus, lentivirus, adenovirus, retrovirus, herpes simplex virus, vaccinia virus, or baculovirus.

[0071] Vector plasmids are plasmids that are encapsulated within viral particles and ultimately integrated into the host genome to express the target gene. They typically contain (1) 5′LTR (or Δ5′LTR) + 3′LTR; (2) ψ (packaging signal); (3) RRE; (4) cPPT; (5) target gene; (6) promoter; (7) polyA; (8) WPRE (enhancing mRNA stability). In specific embodiments, the backbone plasmids include pLVX-Puro, pCDH-CMV-MCS-EF1α-copGFP, pLenti-CMV-GFP-P2A-Puro, or pLEX-MCS.

[0072] Packaging plasmids refer to transviral structures / enzyme proteins that are not encapsulated within viral particles. They typically contain (1) gag (matrix + capsid + nucleocapsid); (2) pol (reverse transcriptase + integrase + protease); (3) tat (required in generation 1; removed in generation 3); and (4) REV response element (Rev gene). In specific embodiments, the backbone plasmid includes psPAX2 (Addgene#12260), pCMV-ΔR8.74, or pLP1 (Thermo triple plasmid kit). In specific embodiments, the packaging plasmid is a lentiviral packaging plasmid. The lentiviral packaging plasmid may be a third-generation lentiviral packaging plasmid. The third-generation lentiviral plasmid includes pHi002 (HillgeneHG-pHi002-G) and pHi003 (HillgeneHG-pHi003-G).

[0073] Envelope plasmids are plasmids that provide heterologous coat glycoproteins and determine the host range (tropism) of viral particles. They typically contain only one outer membrane protein, ORF, located downstream of the CMV or RSV promoter. In specific embodiments, backbone plasmids include pMD2.G (VSV-G, Addgene#12259), pCMV-RD114, pCMV-BaEV-R / TR, pCMV-GALV-TR, or pCAG-EboV-GP. In specific embodiments, the envelope plasmid includes pHi001 (HillgeneHG-pHi001-G).

[0074] On the other hand, this application provides a pharmaceutical composition comprising any of the chimeric receptors described above, the nucleic acid molecules described above, the carriers described above, the host cells described above, viral particles described above or viral particles prepared using the methods described above, or further comprising pharmaceutically acceptable excipients.

[0075] On the other hand, this application provides the use of the chimeric receptor, the nucleic acid molecule, the nucleic acid construct, the vector, the host cell, and the viral particle as described above in the preparation of a drug for modifying T cells.

[0076] In specific embodiments, the uses include improving viral serum resistance, enhancing viral infectivity, or enhancing viral infectivity in the serum environment.

[0077] In a specific embodiment, the quantitative indicators of viral infection efficacy include viral titer or viral transduction rate.

[0078] In a specific embodiment, the drug is used to modify T cells in vivo.

[0079] As used in this article, "vesicular stomatitis virus (VSV)" refers to a single-stranded negative-sense RNA virus belonging to the family Rhabdoviridae and the genus Varicavivirus. The virus particles are bullet-shaped or cylindrical, approximately three times their diameter in length, and 150-180 nm × 50-70 nm in size. The virus has an envelope, on which are uniformly and densely covered with spikes approximately 10 nm long. The interior of the virus consists of a tightly coiled, helical, symmetrical nucleocapsid.

[0080] As used in this article, "Cocal virus" belongs to the order Mononegavirales, family Rhabdoviridae, genus Vesiculovirus, and specific species of Cocal virus.

[0081] As used herein, the term "antibody" refers to an immunoglobulin molecule typically composed of two pairs of polypeptide chains (each pair consisting of one "light" (L) chain and one "heavy" (H) chain). In a general sense, the heavy chain can be understood as the larger polypeptide chain in an antibody, and the light chain as the smaller polypeptide chain. Light chains can be classified as κ and λ light chains. Heavy chains are typically classified as μ, δ, γ, α, or ε, and antibody isotypes are defined as IgM, IgD, IgG, IgA, and IgE, respectively. Within both light and heavy chains, variable and constant regions are linked by "J" regions of approximately 12 or more amino acids, and heavy chains also contain "D" regions of approximately 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The constant region of the light chain consists of a single domain, CL. The constant region of the antibody mediates the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. The VH and VL regions can be further subdivided into highly degenerated regions (called complementarity-determining regions (CDRs)) interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs arranged in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4, from the amino terminus to the carboxyl terminus. The variable regions (VH and VL) of each heavy chain / light chain pair form the antibody-binding site. In particular, the heavy chain can also contain more than three CDRs, such as six, nine, or twelve. For example, in the bifunctional antibody of the present invention, the heavy chain can be the C-terminus of the heavy chain of an IgG antibody linked to the ScFv of another antibody, in which case the heavy chain contains nine CDRs. The term "antibody" is not limited to any particular method of producing antibodies. For example, it includes, in particular, recombinant antibodies, monoclonal antibodies, and polyclonal antibodies. Antibodies can be different types of antibodies, such as IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM antibodies.

[0082] As used herein, the term "antigen-binding fragment" of an antibody refers to a polypeptide containing a fragment of a full-length antibody that retains the ability to specifically bind to the same antigen bound by the full-length antibody and / or competes with the full-length antibody for specific binding to the antigen; it is also referred to as an "antigen-binding moiety." Antigen-binding fragments of antibodies can be generated by recombinant DNA technology or by enzymatic or chemical cleavage of an intact antibody. In some cases, antigen-binding fragments include Fab, Fab', F(ab')2, Fd, Fv, dAb, and complementarity-determining region (CDR) fragments, single-chain antibodies (e.g., scFv), chimeric antibodies, diabody antibodies, and polypeptides containing at least a portion of an antibody sufficient to confer specific antigen-binding ability to the polypeptide.

[0083] As used herein, the terms “antigen binding site” or “binding portion” refer to the portion of an antibody that allows antigen binding.

[0084] As used herein, the term "Fd fragment" refers to an antibody fragment consisting of the VH and CH1 domains; the term "Fv fragment" refers to an antibody fragment consisting of the VL and VH domains of a single arm of the antibody; the term "dAb fragment" refers to an antibody fragment consisting of the VH domain; the term "Fab fragment" refers to an antibody fragment consisting of the VL, VH, CL, and CH1 domains; and the term "F(ab')2 fragment" refers to an antibody fragment containing two Fab fragments connected by a disulfide bridge on the hinge region. As used herein, "Fc region" refers to the entire portion from the hinge region to the CH2 and CH3 regions. The term "Fc fragment" specifically refers to the crystallizable fragment obtained by cleaving an intact IgG antibody with papain, which contains only the CH2 and CH3 constant regions of the two heavy chains.

[0085] As used herein, a “linker” or “connector fragment” refers to a portion capable of connecting two compounds, such as two polypeptides, for example, a polypeptide. Non-limiting examples of linkers include flexible linkers comprising a glycine-serine (e.g., (Gly4Ser)) repeat sequence, and linkers derived from: (a) an interdomain region of a transmembrane protein (e.g., a type I transmembrane protein); (b) a stem region of a type II C-lectin; or (c) an immunoglobulin hinge. As provided herein, a linker may refer to, for example, (1) a polypeptide region between the VH and VL regions of a single-chain Fv (scFv) or (2) a polypeptide region between an immunoglobulin constant region and an antigen-binding domain. In some embodiments, the linker consists of 5 to about 35 amino acids, for example, about 15 to about 25 amino acids. In some embodiments, the linker consists of at least 5 amino acids, at least 7 amino acids, or at least 9 amino acids.

[0086] In some cases, the antigen-binding fragment of an antibody is a single-chain antibody (e.g., scFv), where the VL and VH domains pair to form a monovalent molecule by enabling them to generate linkers as a single polypeptide chain. Such scFv molecules can have a general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH. Suitable prior art linkers consist of a repeating GGGGS amino acid sequence or a variant thereof. For example, a linker having the amino acid sequence (GGGGS)4 can be used, but variants thereof can also be used.

[0087] In some cases, the antigen-binding fragment of an antibody is a biantibody, i.e., a bivalent antibody, in which the VH and VL domains are expressed on a single polypeptide chain, but the linker is too short to allow pairing between the two domains on the same chain, thus forcing the domain to pair with the complementary domain of the other chain and creating two antigen-binding sites.

[0088] As used herein, the terms "monoclonal antibody" and "monoclonal antibody" have the same meaning and are used interchangeably; the terms "polyclonal antibody" and "polyclonal antibody" have the same meaning and are used interchangeably; and the terms "peptide" and "protein" have the same meaning and are used interchangeably. Furthermore, in this invention, amino acids are generally represented by single-letter and three-letter abbreviations known in the art. For example, glycine may be represented by G or Gly, and alanine may be represented by A or Ala.

[0089] As used herein, the term "pharmaceuticalally acceptable excipient" refers to a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art and includes, but is not limited to, pH adjusters, surfactants, adjuvants, and ionic strength enhancers. For example, pH adjusters include, but are not limited to, phosphate buffers; surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80; and ionic strength enhancers include, but are not limited to, sodium chloride. The pharmaceutically acceptable excipients, diluents, or carriers include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). These materials can be used to formulate various dosage forms, including, but not limited to, tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, lyophilized powders for injection, etc. It can be a conventional formulation, a sustained-release formulation, a controlled-release formulation, and various particulate delivery systems. To formulate unit dosage forms into tablets, a wide variety of carriers known in the art can be used. Examples of carriers include, for instance, diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone, etc.; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfate, methylcellulose, and ethylcellulose. Various carriers known in the art can be widely used to formulate unit dosage forms into suppositories.Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides. To formulate unit-dose dosage forms for injection, such as solutions, emulsions, lyophilized powders for injection, and suspensions, all commonly used diluents in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters. Furthermore, to prepare isotonic injections, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injection formulation. In addition, conventional solubilizers, buffers, and pH adjusters can also be added. Furthermore, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical formulation.

[0090] As used herein, the term "effective amount" means an amount sufficient to achieve, or at least partially achieve, the desired effect. An effective amount for treating a disease means an amount sufficient to cure or at least partially prevent the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is entirely within the capabilities of those skilled in the art. For example, an effective amount for therapeutic use will depend on the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general characteristics such as age, weight, and sex, the manner of administration of the drug, and other concurrent treatments, etc.

[0091] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art, and animal viruses used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0092] As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the reaction between an antibody and its target antigen. In some embodiments, an antibody that specifically binds to an antigen (or an antibody that is specific to an antigen) means that the antibody binds to an antigen at a concentration of less than about 10. -5 M, for example, less than approximately 10 -6 M, 10 -7 M, 10 -8 M, 10 -9M or 10 -10 The antigen binds to M or a lower affinity (Kd). In some embodiments of the invention, the term "targeted" refers to specific binding.

[0093] As used herein, the term "Kd" refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, which describes the binding affinity between the antibody and the antigen. A smaller equilibrium dissociation constant indicates a tighter antibody-antigen binding and a higher affinity between the antibody and the antigen. Typically, antibodies bind at a rate less than approximately 10-1. -5 M, for example, less than approximately 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 The antigen is bound by a dissociation equilibrium constant (Kd) of M or smaller, for example, as determined in a Biacore instrument using surface plasmon resonance (SPR). The drug is available in dosage forms such as injections, lyophilized powders for injection, aerosols, large-volume infusions, droplets, pills, powders, granules, tablets, capsules, oral solutions, or emulsions.

[0094] In this invention, the amino acid sequences of the CDRs listed above are all as shown in the Kabat definition rules. However, it is well known to those skilled in the art that antibody CDRs can be defined in various ways, such as Chothia based on the three-dimensional structure of the antibody and the topology of the CDR rings, Kabat, AbM, Contact, and IMGT based on antibody sequence variability, and North CDR definitions based on nearest-neighbor propagation clustering using a large number of crystal structures. Those skilled in the art should understand that, unless otherwise specified, the terms “CDR” and “complementarity-determining region” for a given antibody or its region (e.g., variable region) should be understood to encompass the complementarity-determining region defined by any of the known schemes described above. Therefore, when referring to antibodies defined with a specific CDR sequence as defined in this invention, the scope of said antibody also includes antibodies whose variable region sequence contains the specific CDR sequence, but whose claimed CDR boundaries differ from those defined in this invention due to the application of different schemes (e.g., different assignment system rules or combinations). Although the scope of protection claimed by this invention is based on the sequence defined by the Kabat definition rules, amino acid sequences corresponding to other CDR definition rules should also fall within the scope of protection of this invention, such as Chothia, IMGT, or AHo.

[0095] Example 1

[0096] The 293T cells used in this application were purchased from Sigma-Aldrich VP001.

[0097] First, lentiviruses were packaged using three different enveloped viruses: WT VSVG, mVSVG, or CoVSVG, with EF1α-BCMA as the shuttle plasmid, pHi002 as packaging plasmid-1, pHi003 as packaging plasmid-2, and pHi003 as the targeting plasmid targeting CD3 (scFv) structure ③ (as shown in Table 1). The lentivirus tested in this study was a third-generation lentivirus, packaged using a four-plasmid system (as shown in Table 1).

[0098] Table 1

[0099]

[0100] Preparation of the CD3 (scFv) structure ③ plasmid: The CD3 (scFv) structure ③ plasmid is a vector (SEQ ID NO: 25) obtained by inserting the sequence shown in SEQ ID NO: 5 between 5'GAGATCTGAATTCTGACACT3' (SEQ ID NO: 26) and 5'CTCAAATCCTGCACAACAGA3' (SEQ ID NO: 27). It can express the viral envelope chimeric receptor ③.

[0101] The EF1a-BCMA plasmid is a vector obtained by inserting the sequence shown in SEQ ID NO: 13 between the pLVX-IRES-Puro vector (TAKARA CAT NO. 632186) and the 5'TCTAGAGCGGCCGCGGATCC3' (SEQ ID NO: 28) and 5'ACGCGTCTGGAACAATCAAC3' (SEQ ID NO: 29). It can express BCMA.

[0102] The WT VSVG plasmid is a vector (SEQ ID NO: 25) obtained by inserting the sequence shown in SEQ ID NO: 9 between 5'TCTAGAGCGGCCGCGGATCC3' and 5'ACGCGTCTGGAACAATCAAC3'. It can express the WT VSVG envelope glycoprotein.

[0103] The mVSVG plasmid is a vector (SEQ ID NO: 25) obtained by inserting the sequence shown in SEQ ID NO: 11 between 5'TCTAGAGCGGCCGCGGATCC3' and 5'ACGCGTCTGGAACAATCAAC3'. It can express the mVSVG envelope glycoprotein.

[0104] The CoVSVG plasmid is a vector (SEQ ID NO: 25) obtained by inserting the sequence shown in SEQ ID NO: 7 between 5'TCTAGAGCGGCCGCGGATCC3' and 5'ACGCGTCTGGAACAATCAAC3'. It can express the CoVSVG envelope glycoprotein.

[0105] The specific structures of structure ① (also known as ①αCD3 or CD3-targeting (scFv) structure ① or viral envelope chimeric receptor ①), structure ② (also known as ②αCD3 or CD3-targeting (scFv) structure ② or viral envelope chimeric receptor ②), and structure ③ (also known as ③αCD3 or CD3-targeting (scFv) structure ③ or viral envelope chimeric receptor ③) are as follows: Figure 1 As shown, in this application, this structure (structure ①, structure ② and structure ③) is also referred to as a viral envelope chimeric receptor.

[0106] Structure ① includes αCD3(scFv)-CD8 hinge region-CD8 transmembrane region-VSVG intracellular region. The nucleotide sequence is shown in SEQ ID NO: 1. Positions 1-723 of SEQ ID NO: 1 are αCD3(scFv), positions 724-888 are the CD8 hinge region, positions 889-963 are the CD8 transmembrane region, and positions 964-1029 are the VSVG intracellular region. The encoded amino acid sequence is shown in SEQ ID NO: 2. Positions 1-241 of SEQ ID NO: 2 are αCD3(scFv), positions 242-296 are the CD8 hinge region, positions 297-321 are the CD8 transmembrane region, and positions 322-342 are the VSVG intracellular region.

[0107] Structure ② includes αCD3(scFv)-CD8 hinge region-VSVG transmembrane region-VSVG intracellular region. The nucleotide sequence is shown in SEQ ID NO: 3. Positions 1-723 of SEQ ID NO: 3 are αCD3(scFv), positions 724-888 are CD8 hinge region, positions 889-966 are VSVG transmembrane region, and positions 967-1032 are VSVG intracellular region. The amino acid sequence it encodes is shown in SEQ ID NO: 4. Positions 1-241 of SEQ ID NO: 4 are αCD3(scFv), positions 242-296 are CD8 hinge region, positions 297-322 are VSVG transmembrane region, and positions 322-343 are VSVG intracellular region.

[0108] Structure ③ includes the αCD3(scFv)-CD8 hinge region-VSVG hinge region-VSVG transmembrane region-VSVG intracellular region. The specific nucleotide sequence is shown in SEQ ID NO: 5. Positions 1-723 of SEQ ID NO: 5 are αCD3(scFv), positions 724-888 are the CD8 hinge region, positions 889-942 are the VSVG hinge region, positions 943-1020 are the VSVG transmembrane region, and positions 1021-1086 are the VSVG intracellular region. The amino acid sequence it encodes is shown in SEQ ID NO: 6. Positions 1-241 of SEQ ID NO: 6 are αCD3(scFv), positions 242-296 are the CD8 hinge region, positions 297-314 are the VSVG hinge region, positions 315-340 are the VSVG transmembrane region, and positions 341-361 are the VSVG intracellular region.

[0109] The nucleotide sequence of BCMA is shown in SEQ ID NO: 13, and the amino-selective sequence it encodes is shown in SEQ ID NO: 14.

[0110] The structure of CoVSVG (also known as CoVSVG envelope glycoprotein or CoVSVG protein) includes a Cocal-G extracellular region, a VSVG hinge region, a VSVG transmembrane region, and a VSVG intracellular region. The specific nucleotide sequence is shown in SEQ ID NO: 7. Positions 1-1338 of SEQ ID NO: 7 are the Cocal-G extracellular region, positions 1339-1392 are the VSVG hinge region, positions 1393-1470 are the VSVG transmembrane region, and positions 1471-1536 are the VSVG intracellular region. The encoded amino acid sequence is shown in SEQ ID NO: 8. Positions 1-446 of SEQ ID NO: 8 are the Cocal-G extracellular region, positions 447-464 are the VSVG hinge region, positions 465-490 are the VSVG transmembrane region, and positions 491-511 are the VSVG intracellular region. Among them, the Cocal-G extracellular region has the mutation K47Q / R354Q compared with the wild type.

[0111] The structure of WT VSVG (also known as WT VSVG envelope glycoprotein or WT VSVG protein) includes the WT VSVG extracellular region, VSVG hinge region, VSVG transmembrane region, and VSVG intracellular region. The specific nucleotide sequence is shown in SEQ ID NO: 9. Positions 1-1338 of SEQ ID NO: 9 are the WT VSVG extracellular region, positions 1339-1392 are the VSVG hinge region, positions 1393-1470 are the VSVG transmembrane region, and positions 1471-1536 are the VSVG intracellular region. The encoded amino acid sequence is shown in SEQ ID NO: 10. Positions 1-446 of SEQ ID NO: 10 are the WT VSVG extracellular region, positions 447-464 are the VSVG hinge region, positions 465-490 are the VSVG transmembrane region, and positions 491-511 are the VSVG intracellular region.

[0112] The structure of mVSVG (also known as mVSVG envelope glycoprotein or mVSVG protein) includes the mVSVG extracellular region, VSVG hinge region, VSVG transmembrane region, and VSVG intracellular region. The specific nucleotide sequence is shown in SEQ ID NO: 11. Positions 1-1338 of SEQ ID NO: 11 are the mVSVG extracellular region, positions 1339-1392 are the VSVG hinge region, positions 1393-1470 are the VSVG transmembrane region, and positions 1471-1536 are the VSVG intracellular region. The encoded amino acid sequence is shown in SEQ ID NO: 12. Positions 1-446 of SEQ ID NO: 12 are the mVSVG extracellular region, positions 447-464 are the VSVG hinge region, positions 465-490 are the VSVG transmembrane region, and positions 491-511 are the VSVG intracellular region.

[0113] αCD3(scFv) is an scFv fragment, the amino acid sequence of which is shown in SEQ ID NO:15, the amino acid sequence of the heavy chain variable region of which is shown in SEQ ID NO:16, and the amino acid sequence of the light chain variable region of which is shown in SEQ ID NO:20.

[0114] The amino acid sequences of the three CDR regions of its heavy chain variable region are as follows:

[0115] HCDR1: GYTFISY (SEQ ID NO:17);

[0116] HCDR2: LEWMGYINPRSGYTHYN(SEQ ID NO:18);

[0117] HCDR3: SAYYDYDGFA (SEQ ID NO:19);

[0118] The amino acid sequences of the three CDR regions in the light chain variable region are as follows:

[0119] LCDR1: SASSSVSYMN(SEQ ID NO:21);

[0120] LCDR2: DTSKLAS(SEQ ID NO:22);

[0121] LCDR3: QQWSSNPPT(SEQ ID NO:23).

[0122] The aforementioned CDR region is defined using Kabat.

[0123] Virus packaging process as follows Figure 2 As shown, the specific operation is as follows:

[0124] 293T cell resuscitation: Cells were resuscitated from the 293T working cell bank (WCB) according to the parameters in Table 2 to obtain resuscitated 293T cells.

[0125] Table 2 Control Parameters for Cell Processing During the Recovery Phase

[0126]

[0127] Cell passage: After resuscitation, following the process control parameters for the expansion stage in Table 3, the resuscitated 293T cells were transferred to 125mL disposable sterile Erlenmeyer flasks and expanded using HiLenti 293T suspension medium (Hillgene HG-MD001-1000) containing 6mM glutamine (the initial concentration of 293T cells was (0.5±0.1)×10⁻⁶). 6 The amplification conditions were 37℃, 5% CO2, 90 rpm. After 72 h of amplification, expanded 293T cells were obtained. Before seeding, cell viability and cell density were detected using a Countstar Rigel S2 cell technology instrument, confirming a cell density of (6.0±1.0)×10⁻⁶ cells / mL. 6 The cell count / mL should be no less than 90%, and the process control parameters for the amplification stage are shown in Table 3 below.

[0128] Table 3 Process control parameters for the amplification stage

[0129]

[0130] The expanded 293T cells were divided into 2×10 6Cells / mL were seeded in 50 ml of HiLenti 293T suspension medium (Hillgene HG-MD001-1000) containing 6 mM glutamine. Viable cell density and viability were measured daily after seeding. After 3 days of culture, the viable cell density reached (6.0 ± 1.0) × 10⁻⁶ cells / mL. 6 Cells / mL, cell viability not less than 90%, to obtain 293T cells for transfection, and then lentivirus packaging, the specific method is as follows:

[0131] Preparation of PEI solution: Add 150 μL of PEI pro (Sartorius 101000026) to 1.1 mL of HiLenti 293T suspension medium to obtain PEI solution.

[0132] Preparation of Group 1 DNA solution: According to Table 1, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, WTVSVG plasmid and CD3 (scFv) structure ③ plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 1 DNA solution.

[0133] Preparation of Group 2 DNA solution: According to Table 1, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, mVSVG plasmid and CD3 (scFv) structure ③ plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 2 DNA solution.

[0134] Preparation of Group 3 DNA solution: According to Table 1, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, CoVSVG plasmid and CD3 (scFv) structure ③ plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 3 DNA solution.

[0135] Transfection: In a biosafety cabinet, prepare PEI solution and three groups of DNA solutions (preparation method as above); after the PEI solution, group 1 DNA solution, group 2 DNA solution, and group 3 DNA solution have stood at room temperature for 5 minutes, slowly add the PEI solution to the group 1 DNA solution, group 2 DNA solution, and group 3 DNA solution respectively through the tubing at a mass ratio of 2:1. During the addition process, keep the DNA solution agitated. After standing at room temperature for 15 minutes, slowly add the solution to the reactor containing 50 ml of 293T cells to be transfected to a concentration of 2 mg DNA / L (for 293T cells to be transfected) to perform transfection.

[0136] Feeding: 6 hours after transfection, add 20% of the package volume of HiLenti® transfection enhancer (Hillgene HG-MD005-125) and 2% of the package volume of 200 mM glutamine solution (Gibco 35050061).

[0137] Harvesting: Virus was harvested 48±2 h after transfection. The solution was centrifuged at 4000 g for 5 min, and the supernatant was collected to obtain group 1 virus, group 2 virus and group 3 virus.

[0138] Jurkat cells (ATCC TIB-152) were infected with group 1, group 2, and group 3 viruses and cultured in a CO2 incubator at 37°C with 5% CO2. After 68-72 h of culture, Jurkat cells were collected and stained with FITC-Labeled Human BCMA, Fc Tag (ARCO BCA-HF254). The positivity rate was detected by flow cytometry and the titer was calculated, expressed as TU / mL. The results are shown in Table 4: the viral titers of the three different viral envelope glycoprotein packaging schemes were at the same level.

[0139] The transduction titers of group 1 virus, group 2 virus, and group 3 virus were measured as follows:

[0140] 1. Cell preparation for testing: Take Jurkat cells (ATCC TIB-152) and culture them in a 37℃, 5% CO2 incubator for 1-3 days until the cells are in good condition and sufficient in number.

[0141] 2. Prepare the infection culture medium: 90% FBS (ATCC® 30-2020™) + 1640 (ATCC® 30-2001™) + 0.1% Polybrene (10 mg / ml).

[0142] 3. Plate preparation: Add 400 μL of Jurkat cell suspension to each well of a 24-well plate, with a cell count of 1 E+05 cells per well.

[0143] 4. Virus inoculation: Dilute the virus with infection medium, at least 3 dilutions (samples were taken at serial dilution ratios of 100, 400, and 800), add 100 μl of virus dilution to each well, and add 100 μl of infection medium to the biological control.

[0144] 5. Replenishing fluids: 22±2 hours after viral infection, add 500ul of 1640 medium containing 10% FBS to each well.

[0145] 6. Harvesting: 70±2 hours after viral infection, harvest the cells and transfer them to pre-labeled 5ml flow cytometry tubes.

[0146] 7. Flow cytometry:

[0147] a) Centrifuge at 400g for 3 minutes. Discard the supernatant of the culture medium in the flow cytometry tube, and place the flow cytometry tube on a vortex mixer to disperse the cell pellet.

[0148] b) Add 1 ml of PBS to each tube, centrifuge at 400 g for 3 min. Discard the supernatant and vortex for 5 s to disperse the cells.

[0149] c) Add 2 μl of “Goat-IgG-FITC” to the ISO group and 2 μl of “FITC-Labeled Human BCMA,Fc Tag (ARCO BCA-HF254)” to the experimental group. After shaking and mixing, incubate at 4°C in the dark for 30 min.

[0150] d) Add 1 ml of PBS to each tube and mix well. Centrifuge at 400 g for 3 min. Discard the supernatant and vortex for 5 s to disperse the cells. Repeat the washing once.

[0151] e) Discard the supernatant, add 400 μl of PBS to the flow cytometer, and vortex for 2 seconds to mix.

[0152] f) On-machine detection: Based on the biological blank control, adjust the voltage and gate to detect the "CAR" positivity rate of the sample tube.

[0153] 8. Data Processing

[0154] a) Sample CAR positivity rate = Sample CAR positivity rate detection value - Blank control CAR positivity rate detection value.

[0155] b) Transduction titer (TU / ml) = dilution factor * CAR positivity rate * cell count / virus sample volume (ml).

[0156] c) The CAR positivity rate is taken as the result within the linear range (5-30%); the cell count is 1E+5; the virus sample volume is 0.1ml.

[0157] 9. Result Judgment

[0158] a) When the CAR positivity rate of the biological blank control is less than 5%, the experimental results are valid.

[0159] b) Report the results of the transduction titer test as the average titer within the linear interval of the CAR positivity rate.

[0160] Table 4

[0161]

[0162] Jurkat (ATCC TIB-152) cell infection experiments were conducted using three types of viruses (group 1 virus, group 2 virus, and group 3 virus):

[0163] Control group (also known as control (1640+10%FBS) group): Three lentiviruses (group 1 virus, group 2 virus and group 3 virus) were directly thawed and added to 24-well plates containing 1000 μl of 10%FBS (ATCC® 30-2020™) in 1640 (ATCC® 30-2001™) culture medium for Jurkat (2E5 cells) at an MOI of 2; after 24 h, an equal volume of 1640 medium (ATCC® 30-2001™) containing 10%FBS (ATCC® 30-2020™) was added.

[0164] 100% Serum + LV (1h) group (also known as non-inactivated 100% Serum + LV group): Three lentiviruses (group 1 virus, group 2 virus, and group 3 virus) were directly thawed and added to 400 μl of 100% AB serum (GeminiBio 100-512) containing 2E5 Jurkat cells at MOI=2. The specific method is as follows:

[0165] After centrifugation, Jurkat cells were resuspended in AB serum (GeminiBio 100-512) to a concentration of 2E5 / 400μl. 400μl of the resuspended cells were added to each well of a 24-well plate. Three lentiviruses (group 1 virus, group 2 virus, and group 3 virus) were added at an MOI of 2. After incubation at 37°C for 1 hour, 1640 basal medium was added to a final volume of 1000μl. After 24 hours, an equal volume of 1640 basal medium was added.

[0166] 100% Serum (inactivated) + LV (1h) group (also known as inactivated 100% Serum + LV group): Three lentiviruses (group 1 virus, group 2 virus, and group 3 virus) were directly thawed and added to 400 μl of 100% AB inactivated serum (GeminiBio 100-512, serum inactivated (65℃, 30 min)) containing 2E5 Jurkat cells at MOI=2. The specific method is as follows:

[0167] After centrifugation, Jurkat cells were resuspended in AB inactivated serum (GeminiBio 100-512, serum inactivated (65℃, 30 min)) to a concentration of 2E5 / 400 μl. 400 μl of this solution was added to each well of a 24-well plate, and three lentiviruses (group 1 virus, group 2 virus, and group 3 virus) were added at an MOI of 2. After incubation at 37℃ for 1 h, 1640 basal medium was added to a final volume of 1000 μl. After 24 h, an equal volume of 1640 basal medium was added.

[0168] Jurkat cells were cultured at 37°C with 5% CO2 for 3 days. Afterward, the CAR positivity rate in each group was detected. Cells were stained with PE-Labeled Human BCMA Protein, His Tag (ACRO BCA-HP2H2), and flow cytometry was used for analysis. BCMA cells were circled. + (CAR + Cells were analyzed, and the CAR positivity rate was calculated. Results are shown in Table 5. Figure 3 ( Figure 3 In the graph, the horizontal axis represents the control group, the 100% Serum + LV group (1h group), and the 100% Serum (inactivated at 65℃) + LV group (1h group). WT VSVG represents group 1 virus, αCD3-mVSVG represents group 2 virus, and αCD3-CoVSVG represents group 3 virus. The vertical axis represents the CAR positivity rate. As shown, after using the combination of "K47Q / R354Q mutation + VSVG transmembrane domain" for encapsulation, the vector retained >50% transduction activity after incubation in 100% human serum at 37℃ for 60 min, while the mutant VSVG (mVSVG) vector retained <17%. Compared with mVSVG and WT VSVG, CoVSVG viral particles have a higher CAR positivity rate, stronger transduction rate, and stronger infectivity in human serum.

[0169] CAR positivity rate: BCMA + (CAR + ) cells / total cells.

[0170] Table 5. CAR positivity rate of each group on day 3 post-lentiviral infection.

[0171]

[0172] Example 2

[0173] First, lentiviruses were packaged using three different CD3-targeting plasmids (targeting plasmids). The packaging cell line was 293T, the shuttle plasmid was EF1α-BCMA, the packaging plasmid-1 was pHi002, and the packaging plasmid-2 was pHi003. The targeting plasmids were targeting CD3 (scFv) structure ①, CD3 (scFv) structure ②, and CD3 (scFv) structure ③ (see Table 6 for details). The lentivirus tested was a third-generation lentivirus, packaged using a four-plasmid system (see Table 6 for details).

[0174] Table 6

[0175]

[0176] Preparation of the CD3 (scFv) structure ① plasmid: The CD3 (scFv) structure ① plasmid is a vector obtained by inserting the sequence shown in SEQ ID NO: 1 between the vector sequence (SEQ ID NO: 25) 5' TCTAGAGCGGCCGCGGATCC 3' and 5' ACGCGTCTGGAACAATCAAC 3'.

[0177] Preparation of the CD3 (scFv) structure ② plasmid: The CD3 (scFv) structure ② plasmid is a vector obtained by inserting the sequence shown in SEQ ID NO: 3 between the vector sequence (SEQ ID NO: 25) 5' TCTAGAGCGGCCGCGGATCC 3' and 5' ACGCGTCTGGAACAATCAAC 3'.

[0178] Virus packaging process as follows Figure 4 As shown, the specific operation is as follows:

[0179] 293T cell resuscitation: Cells were resuscitated from the 293T working cell bank (WCB) according to the parameters in Table 7 to obtain resuscitated 293T cells.

[0180] Table 7 Control Parameters for Cell Processing During the Recovery Phase

[0181]

[0182] Cell passage: After resuscitation, following the process control parameters for the expansion stage in Table 8, the resuscitated 293T cells were transferred to 125mL disposable sterile Erlenmeyer flasks and expanded using HiLenti 293T suspension medium (Hillgene HG-MD001-1000) containing 6mM glutamine (the initial concentration of 293T cells was (0.5±0.1)×10⁻⁶). 6 At 37℃ and amplification conditions of 5% CO2 at 90 rpm, 293T cells were obtained after 72 hours of amplification. Cell viability and density were measured using a Countstar Rigel S2 cell technology instrument before seeding, confirming a cell density of (6.0 ± 1.0) × 10⁻⁶ cells / mL. 6 The cell count / mL should be no less than 90%, and the process control parameters for the amplification stage are shown in Table 8 below.

[0183] Table 8 Process control parameters for the amplification stage

[0184]

[0185] The expanded 293T cells were divided into 2×10 6 Cells / mL were seeded in 50 ml of HiLenti 293T suspension medium (Hillgene HG-MD001-1000) containing 6 mM glutamine. Viable cell density and viability were measured daily after seeding. After 3 days of culture, the viable cell density reached (6.0 ± 1.0) × 10⁻⁶ cells / mL. 6 Cells / mL, cell viability not less than 90%, to obtain 293T cells for transfection, and then lentivirus packaging, the specific method is as follows:

[0186] Preparation of PEI solution: Add 150 μL of PEI pro (Sartorius 101000026) to 1.1 mL of HiLenti 293T suspension medium to obtain PEI solution.

[0187] Preparation of Group 4 DNA solution: According to Table 6, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, CoVSVG plasmid and CD3 (scFv) structure ① plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 4 DNA solution.

[0188] Preparation of Group 5 DNA solution: According to Table 6, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, CoVSVG plasmid and CD3 (scFv) structure ② plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 5 DNA solution.

[0189] Preparation of Group 6 DNA solution: According to Table 6, EF1α-BCMA plasmid, pHi002 plasmid, pHi003 plasmid, CoVSVG plasmid and CD3 (scFv) structure ③ plasmid were added to 1.18 ml of HiLenti 293T suspension medium in a molar ratio of 4:2:2:0.5:3.5 to make the final concentration of EF1α-BCMA plasmid 0.032 ug / ml, thus obtaining the Group 6 DNA solution.

[0190] Transfection: In a biosafety cabinet, prepare PEI solution and three groups of DNA solutions (preparation method as above); after the PEI solution, group 4 DNA solution, group 5 DNA solution, and group 6 DNA solution have stood at room temperature for 5 minutes, slowly add the PEI solution to the group 4 DNA solution, group 5 DNA solution, and group 6 DNA solution respectively through the tubing at a mass ratio of 2:1. During the addition process, keep the DNA solution agitated. After standing at room temperature for 15 minutes, slowly add the solution to the reactor containing 50 ml of 293T cells to be transfected to a concentration of 2 mg DNA / L (for 293T cells to be transfected) for transfection.

[0191] Feeding: 6 hours after transfection, add 20% of the package volume of HiLenti® transfection enhancer (Hillgene HG-MD005-125) and 2% of the package volume of 200 mM glutamine solution (Gibco 35050061).

[0192] Harvesting: Virus was harvested 48±2 h after transfection. The solution was centrifuged at 4000 g for 5 min, and the supernatant was collected to obtain group 4 virus, group 5 virus and group 6 virus.

[0193] Jurkat cells (ATCC TIB-152) were infected with group 4, group 5, and group 6 viruses and cultured in a CO2 incubator at 37°C with 5% CO2. After 68-72 hours of culture, Jurkat cells were collected and stained with FITC-Labeled Human BCMA, Fc Tag (ARCO BCA-HF254). The positivity rate was detected by flow cytometry, and the titer was calculated (the virus titer detection method is as shown in Example 1), expressed as TU / mL.

[0194] The results are shown in Table 9 and Figure 5 ( Figure 5 In the figure, the horizontal axis represents the CD3 (scFv) targeting structures ①, ②, and ③ from left to right, and the vertical axis represents the viral titer. The results show that the CD3 (scFv) targeting structure ③ (with CD8 and VSVG hinge regions) has a higher viral titer than the CD3 (scFv) targeting structure ② (with VSVG hinge region); and the CD3 (scFv) targeting structure ② (with VSVG transmembrane region) has a higher viral titer than the CD3 (scFv) targeting structure ① (with CD8 transmembrane region).

[0195] Table 9

[0196]

[0197] Example 3: Non-specific transduction of HepG2 / Nalm6

[0198] Nalm6 cell line (ATCC CRL-3273 human B lymphocytic leukemia cells) was selected as the B cells for testing, and HepG2 cell line (ATCC HB-8065) ​​was selected as the hepatocytes for testing. Different MOIs and viruses were used to transduce the two cell lines respectively.

[0199] The experimental procedure is as follows Figure 6 As shown, the specific operation is as follows:

[0200] D1: Cell seeding and lentivirus infection: Nalm6 and HepG2 cell lines were adjusted to a cell density of 1E5 cells / mL and 400 μL of medium per well in 24-well plates, respectively. Three types of viruses (group 1 virus, group 2 virus, and group 3 virus) were added according to the MOI in Table 10 for transfection.

[0201] D2: Replenishment: 24 h after transfection, add 500 μL of culture medium (RPMI-1640 Medium (ATCC®30-2001™) + 10% Fetal Bovine Serum (ATCC® 30-2020™)) to each well plate;

[0202] D3: Culture: 36 h after transfection, cultured in a carbon dioxide incubator at 37℃ with 5% CO2.

[0203] D4: Sampling and Detection: 72 hours after transfection, samples were taken and cells were stained with E-Labeled Human BCMA Protein, His Tag (ACROBCA-HP2H2) by flow cytometry to detect the BCMA positivity rate (transduction rate %), as shown in Example 1. The results are shown in Table 11. Group 1 virus showed strong infectivity against HepG2 and Nalm6, while the infection rates of HepG2 and Nalm6 in groups 2 and 3 decreased to below 5%. This indicates that targeting CD3 (scFv) structure ③ or the combination of targeting CD3 (scFv) structure ② with CoVSVG protein can significantly reduce the infectivity of viral particles against non-T cells (e.g., HepG2 and Nalm6).

[0204] Table 10

[0205]

[0206] Table 11

[0207]

[0208] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and substitutions can be made without departing from the technical principles of the present invention, and these improvements and substitutions should also be considered within the scope of protection of the present invention.

Claims

1. A viral envelope chimeric receptor, characterized in that: The viral envelope chimeric receptor comprises, in sequence, an antibody or its antigen-binding fragment, a hinge region, a transmembrane region, and an intracellular region; the hinge region comprises hinge region 1 and hinge region 2; The hinge region 1 of the viral envelope chimeric receptor is selected from the hinge region of the CD8 molecule. The hinge region 2 is selected from the envelope glycoprotein of vesicular stomatitis virus; The transmembrane region of the viral envelope chimeric receptor is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein. The intracellular region of the viral envelope chimeric receptor is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein. The antibody or its antigen-binding fragment targets αCD3; the antibody or its antigen-binding fragment comprises HCDR1-HCDR3 as shown in SEQ ID:17-SED ID NO:19, and LCDR1-LCDR3 as shown in SEQ ID:21-SED ID NO:

23. The amino acid sequence of the CD8 molecule is shown in SEQ ID NO:24; The amino acid sequence of the vesicular stomatitis virus envelope glycoprotein is shown in SEQ ID NO:

10.

2. The viral envelope chimeric receptor as described in claim 1, characterized in that: The amino acid sequence of the heavy chain variable region of the antibody or its antigen-binding fragment is shown in SEQ ID NO:16, and the amino acid sequence of the light chain variable region of the antibody or its antigen-binding fragment is shown in SEQ ID NO:

20. And / or, the amino acid sequence of hinge region 1 of the viral envelope chimeric receptor is shown as positions 242-296 of SEQ ID NO:6; And / or, the amino acid sequence of the transmembrane region of the viral envelope chimeric receptor is shown as positions 315-340 of SEQ ID NO:6; And / or, the amino acid sequence of the intracellular region of the viral envelope chimeric receptor is shown as positions 341-361 of SEQ ID NO:

6.

3. The viral envelope chimeric receptor as described in claim 1, characterized in that: The amino acid sequence of hinge region 2 of the viral envelope chimeric receptor is shown as positions 297-314 of SEQ ID NO:6; And / or, the hinge region of the viral envelope chimeric receptor sequentially includes hinge region 1 and hinge region 2.

4. A carrier, characterized in that: The vector contains a nucleic acid molecule encoding a viral envelope chimeric receptor as described in any one of claims 1-3.

5. A host cell, characterized in that: The host cell comprises the vector of claim 4, or a nucleic acid molecule integrated into its genome that encodes the viral envelope chimeric receptor of any one of claims 1-3.

6. Virus particles, characterized by: The virus particle has an envelope, and the envelope of the virus particle has an envelope protein, the envelope protein of the virus particle including the viral envelope chimeric receptor as described in claim 1 or 2.

7. The virus particle as described in claim 6, characterized in that: The viral particle's envelope protein also includes the CoVSVG envelope glycoprotein, which comprises, in sequence, an extracellular region, a hinge region, a transmembrane region, and an intracellular region. The extracellular region of the CoVSVG envelope glycoprotein is selected from the extracellular region of the Kokar vesicular virus envelope glycoprotein; The hinge region of the CoVSVG envelope glycoprotein is selected from the hinge region of the vesicular stomatitis virus envelope glycoprotein. The transmembrane region of the CoVSVG envelope glycoprotein is selected from the transmembrane region of the vesicular stomatitis virus envelope glycoprotein. The intracellular region of the CoVSVG envelope glycoprotein is selected from the intracellular region of the vesicular stomatitis virus envelope glycoprotein.

8. The virus particle as described in claim 7, characterized in that: The amino acid sequence of the extracellular region of the CoVSVG envelope glycoprotein is shown in positions 1-446 of SEQ ID NO: 8; the amino acid sequence of the hinge region of the CoVSVG envelope glycoprotein is shown in positions 447-464 of SEQ ID NO: 8; the amino acid sequence of the transmembrane region of the CoVSVG envelope glycoprotein is shown in positions 465-490 of SEQ ID NO: 8; and the amino acid sequence of the intracellular region of the CoVSVG envelope glycoprotein is shown in positions 491-511 of SEQ ID NO:

8.

9. A pharmaceutical composition, characterized in that: The composition comprises the viral envelope chimeric receptor of any one of claims 1-3, the vector of claim 4, the host cell of claim 5, and the viral particles of any one of claims 6-8, and further comprises pharmaceutically acceptable excipients.

10. Use of the viral envelope chimeric receptor of any one of claims 1-3, the vector of claim 4, the host cell of claim 5, or the viral particle of any one of claims 6-8 in the preparation of a medicament for infecting or modifying T cells.

11. The use as described in claim 10, characterized in that: The uses include enhancing viral infectivity, increasing viral serum resistance, or enhancing viral infectivity in the serum environment.

Citation Information

Patent Citations

  • Bispecific antibodies against HER2 and CD3

    CN103796677A

  • Recombinant human hepatitis B virus core protein fused protein

    CN104693309A

  • IgM Fc and J-chain mutations that affect IgM serum half-life

    CN111787951A

  • Virus vector and application thereof

    CN116497065A

  • CAR and CAR-M cells targeting hepatocellular carcinoma and construction method and application thereof

    CN118530370A