Soil conditioner and application thereof
By mixing woody peat, biochar, and aeolian sand as a conditioner into sandy black soil, the microbial community was regulated, which solved the problem of low organic matter in sandy black soil and achieved rapid improvement of soil structure and productivity.
Patent Information
- Application Number
- CN202511648467.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-11
- Publication Date
- 2026-01-27
AI Technical Summary
The sandy black soil has low organic matter content, and long-term waterlogging and extensive farming have led to low soil productivity and a lack of targeted soil conditioners.
A soil conditioner was prepared by mixing woody peat, biochar, and aeolian sand in a mass ratio of 1~8:3~7:4 and applied to sandy black soil to regulate the microbial community.
It can rapidly improve soil structure, enhance water and fertilizer retention capacity, promote organic carbon accumulation, and improve the crop growth environment. It is low in cost and has a wide range of raw materials.
Smart Images
Figure CN121406342A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of soil microbial ecological restoration technology, specifically to a soil conditioner and its application. Background Technology
[0002] In recent years, the gradual loss of soil organic carbon globally has become a pressing environmental issue, especially in regions with frequent agricultural activities. Long-term tillage, fertilizer application, and improper soil management have led to a significant decline in soil organic carbon, thereby impacting the sustainability of agricultural production. Soil conditioners, as an effective means of improving soil quality and restoring soil function, can effectively promote the accumulation of soil organic carbon, improve soil structure, enhance soil water and fertilizer retention capacity, and provide a better soil environment for crop growth through their rational application.
[0003] However, sandy black soil is a type of arable soil distributed in the Huai River basin of China. Because its cross-section shows a "black soil layer" at the top and a "sandy layer" at the bottom, it is commonly known as "sandy black soil." Unlike the black soil of Northeast China, sandy black soil has a low organic matter content, only around 1%. It not only has a high clay content, but the clay minerals are mainly montmorillonite with high exchange capacity, resulting in strong fertilizer retention. However, due to long-term waterlogging and inadequate cultivation practices, coupled with insufficient attention to the integration of fertilizer and soil management, most of it is low-yield soil. Currently, there is a lack of soil conditioners specifically for sandy black soil; therefore, there is an urgent need to research and develop a soil conditioner to improve sandy black soil. Summary of the Invention
[0004] The present invention aims to provide a soil conditioner and its application, which can regulate and improve the microbial community in sandy black soil, exert a positive influence, and has the advantages of good effect, fast results, wide availability of raw materials, and low cost.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] A soil conditioner comprising a mixture of woody peat, biochar, and aeolian sand.
[0007] Furthermore, the mass ratio of woody peat, biochar, and aeolian sand in the soil conditioner is 1~8:3~7:4.
[0008] Furthermore, the biochar is prepared by pyrolysis of agricultural waste under oxygen-limited conditions, with the pyrolysis temperature being 380-420℃ and the time being 3.5-4.5 hours.
[0009] Based on the application of the soil conditioner described above in soil improvement, the soil is sandy black soil.
[0010] The beneficial effects of the technical solution are:
[0011] This invention optimizes the formulation of the soil conditioner, which is a mixture of woody peat, biochar, and aeolian sand in a mass ratio of 1~8:3~7:4. The preparation method is simple and can be used to improve sandy black soil in the Huai River Basin, regulate the content of microorganisms in the soil, and has the advantages of wide availability of raw materials, low cost, and quick results. It is worthy of vigorous promotion and use. Attached Figure Description
[0012] Figure 1 The variation of relative abundance (phylum level) of soil bacterial (a) and fungal (b) communities in this invention;
[0013] Figure 2 The variation of relative abundance (class level) of soil bacterial (a) and fungal (b) communities in this invention;
[0014] Figure 3 This invention provides a co-occurrence network of soil bacteria at the ASVs level, represented by treatments A1 to A5.
[0015] Figure 4 This invention provides a co-occurrence network of soil fungi at the ASVs level, represented by treatments A1 to A5.
[0016] Figure 5 This is a heatmap showing the species richness clustering of fungal communities in this invention.
[0017] Figure 6 This is a heatmap showing the species richness clustering of bacterial communities in this invention. Detailed Implementation
[0018] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments:
[0019] In related technologies, in areas with frequent agricultural activities, long-term tillage, fertilizer application, and improper soil management lead to a significant decline in soil organic carbon, which in turn affects the sustainability of agricultural production.
[0020] Changes in soil microorganisms are highly beneficial for soil improvement and remediation. An increase in the number of beneficial microorganisms enables them to efficiently degrade organic pollutants, accelerating soil purification. Their secretions improve soil structure and enhance aeration, water retention, and fertilizer retention capacity. Regarding pollutant degradation, the increased numbers of common microorganisms such as Pseudomonas and Bacillus accelerate the decomposition of organic pollutants through metabolic pathways such as β-oxidation and the tricarboxylic acid cycle, converting them into carbon dioxide, water, and simple inorganic substances, thus accelerating the soil purification process. Increased microbial abundance also leads to increased secretion of extracellular polymers such as polysaccharides and proteins. These substances act like "glue," promoting the formation of more stable aggregates of soil particles, increasing the number and size of soil pores, optimizing soil structure, and improving soil aeration and water retention capacity. In nutrient cycling, the increased abundance of phosphorus-solubilizing microorganisms such as Bacillus and Pseudomonas leads to the secretion of organic acids and phosphatases, converting insoluble phosphorus in the soil into soluble phosphates, improving the availability of phosphorus nutrients in the soil, aiding plant nutrient absorption, and enhancing the plant's ability to absorb and transform soil pollutants. Furthermore, the increased numbers of beneficial bacteria such as Bacillus licheniformis and Bacillus subtilis, through competition for nutrients and space, and the secretion of antibiotics and bacteriocins, effectively inhibit the growth and reproduction of pathogens. In the soil ecosystem, beneficial bacteria form a more stable ecological relationship with pathogens, other microorganisms, and plant roots, maintaining soil ecological stability, creating a favorable environment for soil remediation, and comprehensively promoting the efficient implementation of soil remediation work.
[0021] Soil conditioners, as an effective means of improving soil quality and restoring soil function, can effectively promote the accumulation of soil organic carbon, improve soil structure, enhance soil water and fertilizer retention capacity, and provide a better soil environment for crop growth when applied rationally. Therefore, using soil conditioners to regulate and improve soil microorganisms is an important method of soil improvement.
[0022] However, sandy black soil is a type of arable soil distributed in the Huai River basin of China. Because its cross-section shows a "black soil layer" at the top and a "sandy layer" at the bottom, it is commonly referred to as "sandy black soil." Unlike the black soil of Northeast China, sandy black soil has a low organic matter content, only around 1%. It not only has a high clay content, but the clay minerals are mainly montmorillonite with high exchange capacity, resulting in strong fertilizer retention. However, due to long-term waterlogging and extensive farming practices, coupled with insufficient attention to the integration of fertilizer and soil management, most of it is low-yield soil. Currently, there is a lack of soil conditioners specifically for sandy black soil. Therefore, this invention provides a soil conditioner for improving sandy black soil.
[0023] This soil conditioner is composed of woody peat, biochar, and aeolian sand, and the mass ratio of woody peat, biochar, and aeolian sand in the soil conditioner is 1~8:3~7:4; it is applied to sandy black soil.
[0024] Woody peat refers to peat composed of woody plant remains. It is mostly formed under nutrient-rich (low-lying) swamp conditions, and its remains are primarily composed of woody plants such as birch and spruce. Peat is brown, dark brown, or tan in color and has a blocky structure. In woody peat with low decomposition, logs, roots, and bark can be identified with the naked eye. Woody peat is characterized by a high carbon content (up to 60%–65% or more), low levels of water-soluble substances, hemicellulose, and cellulose, and high levels of humic acid and peat wax.
[0025] The woody peat used in this invention is collected from the Changbai Mountains area in Northeast China. This region has abundant vegetation, and the woody peat was formed under long-term geological processes. Its degree of decomposition is moderate, and it contains abundant humic acid, cellulose, and other organic components, which can provide a large amount of active organic carbon source for the soil. After collection, the woody peat is naturally air-dried, impurities are removed, and it is crushed to a suitable particle size for later use.
[0026] The biochar used in this invention is prepared by pyrolyzing agricultural waste (such as peanut straw) under limited oxygen conditions (temperature 400℃, time 4 hours).
[0027] The aeolian sand used in this invention is a natural product composed of various fine fragments, gravel, sand and other small particles. It is commonly found in deserts, Gobi and other regions. The particle size of aeolian sand is mainly distributed between 0.074 and 0.250 mm, and its content is as high as 90% or more.
[0028] Example 1: Improvement Test of Sandy Black Soil in Panji District, Huainan
[0029] (1) Preparation of different soil conditioners
[0030] According to the experimental design, a certain mass of amendment and soil (taken from sandy black soil in Panji District, Huainan) were accurately weighed using an electronic balance, and thoroughly mixed with a shovel or stirring rod to ensure that the amendment was evenly distributed in the soil; the mass ratio of amendment to sandy black soil is shown in Table 1:
[0031] Table 1. Mass ratio of soil conditioner to sandy black soil
[0032]
[0033] The soil conditioner was prepared using an orthogonal design, with woody peat (A), biochar (B), and aeolian sand (C) as experimental factors. The experiment was conducted according to an L18 (21 32 51) orthogonal array, as shown in the table below:
[0034] Table 2 Orthogonal Experimental Design
[0035]
[0036] Table 3 Different Group Numbers
[0037]
[0038] (2) Determination of soil microbial community structure
[0039] Weigh 0.5g of soil samples from each group and extract total DNA from the soil using the E.Z.NA® Soil DNA Kit manufactured by Omega Biotek, USA, following the instructions in the kit's manual. After the DNA was confirmed to be acceptable using a Nano Drop 2000 spectrophotometer (Nano Drop Technologies, Wilmington, North Carolina, USA), the 16S rRNA gene V3-V4 region was amplified using primers 338F (5'ACTCCTACGGGAGGCAGCA3' SEQ ID NO.1) and 806R (5'GGACTACHVGGGTWTCTAAT3, SEQ ID NO.2). The fungal rRNA gene ITS region was amplified using primers ITS1F (5'GGAAGTAAAAGTCGTAACAAGG3', SEQ ID NO.3) and ITS2 (5'GCTGCGTTCTTCATCGATGC3', SEQ ID NO.4).
[0040] The PCR system consisted of: 5 μL reaction buffer (5x), 5 μL gas chromatography buffer (5x), 2 μL dNTPs (2.5 mM), 0.25 μL Q5 high-fidelity DNA polymerase (New England Biolab, England) (5 U / μL), 1 μL each primer (10 μM), 2 μL DNA template, and 8.75 μL ddH2O. The PCR reaction conditions were: initial denaturation at 95℃ for 2 min, holding at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, and final extension at 72℃ for 5 min. The purified PCR amplification products were sequenced using the Illumina MiSeq (Illumina Corporation, San Diego, USA) platform. The raw sequencing sequences were processed using QIIME to remove sequences smaller than 50 bp and erroneous sequences, and chimeric sequences were removed using the UCHIME algorithm. The remaining high-quality sequences were clustered using the UPARSE method, forming taxonomic units (ASVs) with 99% similarity. Then, the bacterial and fungal taxonomic information was annotated using the SILVA database (http: / / www.arb-silva.de) and the UNITE database (http: / / unite.ut.ee / index.php), respectively. Finally, the gene sequences were identified in the National Center for Biotechnology Information (NCBI) nucleic acid sequence database (http: / / blast.ncbi.nlm.nih.gov).
[0041] (3) Results and Analysis
[0042] Sequencing analysis of soil bacteria and fungal communities in each treatment was performed using Illumina. At a 99% similarity level, 6568 and 755 ASVs of bacteria and fungi, respectively, were obtained. In terms of systematic classification, 12 phyla, 20 classes, 22 orders, 24 families, and 21 genera were detected in the soil bacteria, while 10 phyla, 27 classes, 52 orders, 90 families, and 175 genera were detected in the soil fungal communities. The test results are as follows: Figure 1-6 As shown, Figure 1 Changes in the relative abundance (phylum level) of soil bacterial (a) and fungal (b) communities; Figure 2 Changes in the relative abundance (at the class level) of soil bacterial (a) and fungal (b) communities; Figure 3 : Co-occurrence network of soil bacteria at the ASVs level under treatment A1-A5; Figure 4 : Co-occurrence network of soil fungi at the ASVs level under treatments A1–A5; Figure 5 : Species richness clustering heatmap of fungal communities; Figure 6 : Species richness clustering heatmap of bacterial communities.
[0043] See Figure 1 At the phylum level, the soil bacterial communities of different forest ages mainly consisted of Proteobacteria (mean relative abundance: 22.83%), Acidobacteria (mean relative abundance: 18.07%), Chloroflexi (mean relative abundance: 12.80%), Verrucomicrobia (mean relative abundance: 8.61%), Crenarchaeota (mean relative abundance: 6.67%), Bacteroidetes (mean relative abundance: 6.73%), Actinobacteria (mean relative abundance: 3.24%), and Planctomycetes (mean relative abundance: 3.25%). The soil fungal community consisted of Gemmatimonadetes (mean relative abundance: 3.04%) and Myxococcota (mean relative abundance: 2.36%). The dominant phyla in the soil fungal community were Ascomycota (mean relative abundance: 48.71%), Mortierellomycota (mean relative abundance: 45.41%), and Basidiomycota (mean relative abundance: 1.91%).
[0044] In the composition of soil bacteria and fungi, the relative abundance of Proteobacteria and Mortierellomycota increased significantly with the increase of woody peat addition. Specifically, the relative abundance of Proteobacteria and Mortierellomycota in soil A5B2C2 was 4.26% and 19.07% higher, respectively, than that in the control group (A1B1C1). The relative abundance of Verrucomicrobia and Ascomycota decreased with the increase of amendment addition. The relative abundance of Verrucomicrobia and Ascomycota in soil A4B3C2 was 4.456% and 22.118% lower, respectively, than that in the control group (A1B1C1). The relative abundance of Verrucomicrobia and Ascomycota in the A5B2C2 treatment was 4.597% and 21.279% lower, respectively, than that in the control group (A1B1C1). The relative abundance of other dominant phyla did not change significantly with increasing stand age.
[0045] See Figure 2At the class level, among the annotated bacterial classes, the dominant classes are, in descending order: Gammaaproteobacteria (mean relative abundance: 12.11%), Alphaproteobacteria (mean relative abundance: 11.40%), Anaerolinease (mean relative abundance: 8.07%), Verrucomicrobiae (mean relative abundance: 8.27%), Vicinamibacteria (mean relative abundance: 5.95%), Bacteroidia (mean relative abundance: 5.81%), Nitrososphaeria (mean relative abundance: 5.64%), Acidobacteriae (mean relative abundance: 5.35%), and Blasticatellia (mean relative abundance: 3.53%). The dominant classes are Bacillus (…). The following fungi were included: Gemmatimonadetes (mean relative abundance: 2.72%), Polyangia (mean relative abundance: 1.80%), Phycisphaerae (mean relative abundance: 1.54%), Holopaga (mean relative abundance: 1.50%), and Planctomycetes (mean relative abundance: 1.44%). The relative abundances of Anaerolinease and Vicinamibacteria decreased with increasing woody peat content, with Anaerolinease reaching its lowest level in the A5B2C2 treatment group and Vicinamibacteria reaching its lowest level in the A5B3C2 treatment group. The relative abundances of Gammaaproteobacteria, Alphaproteobacteria, and Verrucomicrobiae gradually increased with increasing woody peat content. The relative abundances of Acidobacteriae, Blasticatellia, and Gemmatimonadetes gradually increased with increasing biochar content. The relative abundance of Polyangia and Phycisphaerae gradually increased with the increase of aeolian sand addition.
[0046] The dominant classes of soil fungi in different treatments were, in descending order: Mortierellomycetes (mean relative abundance: 43.44%), Sordariomycetes (mean relative abundance: 28.91%), Leotiomycetes (mean relative abundance: 10.03%), Dothideomycetes (mean relative abundance: 5.75%), Eurotiomycetes (mean relative abundance: 4.85%), and Tremellomycetes (mean relative abundance: 1.02%). The relative abundance of Soedariomycetes decreased with increasing amounts of soil amendment, with treatments A4B3C2 and A5B2C2 showing decreases of 15.98% and 8.16% compared to the control, respectively. The relative abundance of Mortierellomycetes and Leotiomycetes gradually increased with the increase of the amount of amendment added, reaching a maximum of 50.93% and 8.67% respectively in soil treated with A4B3C2.
[0047] Figure 3 The co-occurrence networks of soil bacteria at the ASVs level for treatments A1–A5 are shown in the figure. The complexity of the soil bacterial network increases with increasing woody peat addition. Furthermore, the cooperative relationships among different bacterial groups also strengthen. The addition of woody peat not only promotes bacterial community diversity but also enhances the cooperative effects among different groups. This enhanced cooperative effect is due to the fact that woody peat provides more nutrients and habitat, thereby promoting mutually beneficial symbiotic relationships among bacterial groups. Notably, with increasing woody peat addition, the number of bacterial community modules increases from four main modules in the control group to six modules in the A5 treatment. Other nodes gradually join each module, becoming closely connected to them. This further indicates that the addition of woody peat promotes the complexity and cooperative effects of the bacterial network.
[0048] Figure 4The co-occurrence networks of soil fungi at the ASVs level for treatments A1–A5 are shown in the figure. It can be seen that exogenous organic matter input drives the evolution of the fungal network from a simple star-shaped structure to a multicenter nested structure by enhancing hyphal connectivity and nutrient channel complexity. The addition of woody peat not only promotes fungal community diversity but also enhances the cooperative effects among different groups. This enhanced cooperative effect is due to the fact that woody peat provides more nutrients and habitat, thereby promoting mutually beneficial symbiotic relationships among fungal groups. Notably, with the increase of woody peat addition, the number of modules in the fungal community also increased from four main modules in the control group to six modules in the A5 treatment. Other nodes gradually joined each module, becoming closely connected to them. This further indicates that the addition of woody peat promotes the complexity and cooperative effects of the fungal network.
[0049] Based on the above test data and analysis Figures 5-6 It was found that at the phylum level of soil bacterial and fungal community composition, the relative abundance of Proteobacteria and Mortierellomycota significantly increased with increasing amounts of woody peat. This is because the addition of woody peat as organic matter to the soil brings abundant nutrients, stimulating increased bacterial community diversity and strengthening cooperative effects among bacteria. Furthermore, Proteobacteria play a crucial role in organic matter decomposition and nutrient cycling, and eutrophic environments are extremely favorable for their growth. Conversely, the relative abundance of Verrucomicrobia and Ascomycota decreased with increasing amounts of soil amendment. These two phyla may be more adapted to low-nutrient environments, and the increase in soil organic matter inhibited their growth, thus affecting the balance of the soil ecosystem. This study on the effects of woody peat addition on soil microbial communities shows that increasing organic amendments not only alters the relative abundance of microorganisms but also has a profound impact on the structure and function of the microbial community. These changes may further affect the physical and chemical properties of the soil, thus having a significant impact on the health and productivity of the entire ecosystem.
[0050] At the class level, the relative abundance and structure of soil microbial communities underwent significant changes. In the bacterial community, the relative abundance of *Gammaaproteobacteria* and *Alphaproteobacteria* was positively correlated with the amount of woody peat added. The addition of organic matter significantly increased the abundance of *Proteobacteria*, promoting bacterial community diversity and cooperation. However, the relative abundance of *Anaerolineae* and *Vicinamibacteria* decreased with increasing woody peat addition. This is because they have a clear competitive advantage in low-nutrient environments, while high-nutrient environments limit their development; increased soil organic matter leads to a decrease in their relative abundance, affecting soil ecological balance. Furthermore, the relative abundance of *Acidobacteriae*, *Blasticatellia*, and *Gemmatimonadetes* gradually increased with increasing biochar addition, thanks to the added biochar providing a suitable microenvironment, improving soil structure, and supporting the reproduction of these bacterial classes.
[0051] In the fungal community, the relative abundance of Mortierellomycetes and Leotiomycetes increased with increasing soil amendment dosage because the organic amendment provided ample nutrients for fungal growth. However, the relative abundance of Soedariomycetes decreased with increasing amendment dosage. This may be because Soedariomycetes is more adapted to low-nutrient environments, and high-nutrient conditions inhibit its growth; increasing soil organic matter may suppress the growth of some fungal groups.
[0052] In summary, this invention optimizes the formulation of the soil conditioner, which is a mixture of woody peat, biochar, and aeolian sand in a mass ratio of 1~8:3~7:4. The preparation method is simple and can be used to improve sandy black soil in the Huai River Basin, regulate the microbial content in the soil, and has the advantages of wide availability of raw materials, low cost, and quick results. It is worthy of vigorous promotion and use.
[0053] The above descriptions are merely embodiments of the present invention, and common knowledge regarding specific technical solutions or characteristics is not elaborated upon here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A soil conditioner, characterized in that, The soil conditioner is a mixture of woody peat, biochar, and aeolian sand.
2. The soil conditioner according to claim 1, characterized in that: The mass ratio of woody peat, biochar, and aeolian sand in the soil conditioner is 1~8:3~7:
4.
3. The soil conditioner according to claim 1, characterized in that: The biochar is prepared by pyrolysis of agricultural waste under limited oxygen conditions, with the pyrolysis temperature being 380-420℃ and the time being 3.5-4.5 hours.
4. The application of the soil conditioner according to any one of claims 1-3 in soil improvement, characterized in that, The soil is sandy black soil.