Recombinant pichia pastoris for producing squalene as well as construction method and application of recombinant pichia pastoris
By co-expressing multiple enzyme genes and optimizing the fermentation process in Pichia pastoris, a highly efficient squalene biosynthesis network was constructed, solving the problem of cell damage after increasing squalene yield and achieving efficient squalene production.
Patent Information
- Application Number
- CN202511795689.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-01-27
AI Technical Summary
In existing technologies, after increasing squalene production, Pichia pastoris strains suffer cell damage that prevents further yield increases, resulting in metabolic bottlenecks and the accumulation of intermediate products.
By co-expressing multiple key enzyme genes in Pichia pastoris, a highly efficient squalene biosynthesis network was constructed, including the introduction of squalene synthase, 3-hydroxy-3-methylglutaryl-CoA reductase, acetyl-CoA synthase, citrate lyase, isopentenyl pyrophosphate isomerase, farnesyl diphosphate synthase, and choline kinase. Combined with photocatalytic materials and fermentation process optimization, the squalene biosynthesis pathway and precursor supply were enhanced, rate-limiting steps were removed, and the growth capacity of the strain was improved.
A squalene yield of 174.32 mg/g was achieved in a 5L fermenter, overcoming the limitations of single gene modification, avoiding metabolic bottlenecks and intermediate product accumulation, and realizing efficient squalene synthesis.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and fermentation engineering technology, and in particular to a recombinant Pichia pastoris strain that produces squalene, its construction method, and its application. Background Technology
[0002] Pichia pastoris is a methyltrophic yeast with strong respiratory and metabolic capabilities, allowing it to grow to very high cell densities in simple culture media and easily scale up from shake flasks to large-scale bioreactors. Therefore, the comprehensive characteristics of Pichia pastoris make this strain have great potential for the production of terpenoid natural products. Recent studies have demonstrated that Pichia pastoris is suitable for producing natural products such as hyaluronic acid, carotenoids, and sesquiterpenes (+)-nocarbidones. Compared with other microorganisms, Pichia pastoris is safe and reliable, and can be used in many industries such as food and medicine; the strain grows rapidly, has strong stress resistance, is simple to cultivate, and is suitable for industrialization; the molecular manipulation platform is mature and genetic tools are well-developed, indicating broad development prospects. Existing technology includes genetically modifying Pichia pastoris to obtain recombinant Pichia pastoris that produces squalene. However, the squalene obtained after introducing the product synthesis module has a certain toxic effect on cells; while increasing squalene production, the resulting cell damage also inhibits further production growth, preventing further increases in squalene yield. Summary of the Invention
[0003] The first objective of this invention is to provide a recombinant Pichia pastoris strain that produces squalene.
[0004] To achieve the above technical objectives, the present invention adopts the following technical solution:
[0005] A recombinant Pichia pastoris strain producing squalene systematically optimizes the squalene biosynthesis pathway by co-expressing multiple key enzyme genes in Pichia pastoris. The gene combination and their synergistic functions include:
[0006] Core synthesis module: Introducing squalene synthase (sqs) and 3-hydroxy-3-methylglutaryl-CoA reductase (tHMGR) to synergistically enhance the throughput of the squalene synthesis pathway and directly increase squalene accumulation.
[0007] Precursor supply module: Introduces acetyl-CoA synthase (ACS) and citrate lyase (ACL1) to work synergistically to increase the supply of intracellular precursor acetyl-CoA, providing a sufficient raw material basis for squalene synthesis.
[0008] Rate-limiting step removal module: Introduces isopentenyl pyrophosphate isomerase (IDI) and farnesyl diphosphate synthase (ERG20) to synergistically remove key rate-limiting steps in the mevalonate (MVA) pathway, promoting the efficient conversion of intermediate metabolites into squalene precursors.
[0009] Direct precursor enhancement module: Introduces choline kinase (CK) and isopentenyl phosphokinase (IPK) to synergistically increase the intracellular level of farnesyl pyrophosphate (FPP), a direct precursor of squalene.
[0010] Strain growth aid module: The histidine gene (His) is introduced to enhance the growth ability and robustness of the strain, providing biomass assurance for high yield.
[0011] The synergistic expression of the aforementioned multi-module genes constructs an efficient and balanced squalene biosynthesis network, avoiding metabolic bottlenecks or intermediate product accumulation that may be caused by single gene modification, which is the key to achieving high squalene production.
[0012] In a preferred embodiment, the Pichia pastoris is Pichia pastoris strain GS115.
[0013] The squalene synthase sqs, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, and choline kinase CK were derived from Saccharomyces cerevisiae; acetyl-CoA synthase ACS, citrate lyase ACL1, isopentenyl pyrophosphate isomerase IDI, and farnesyl diphosphate synthase ERG20 were derived from Yersinia lipolytica; isopentenyl phosphate kinase IPK was derived from Arabidopsis thaliana; and histidine gene His was derived from Pichia pastoris.
[0014] Preferably, the Gene ID of the tHMGR gene is 854900, the Gene ID of the sqs gene is 856597, the Gene ID of the ACS gene is 2908441, the Gene ID of the ACL1 gene is 2912101, the Gene ID of the IDI gene is 2907710, the Gene ID of the ERG20 gene is 2908051, the Gene ID of the CK gene is 850824, the Gene ID of the IPK gene is 834292, and the Gene ID of the His gene is 8200978.
[0015] In this invention, the flux of the squalene synthesis pathway is synergistically enhanced by introducing squalene synthase (sqs) and 3-hydroxy-3-methylglutaryl-CoA reductase (tHMGR); the supply of precursor acetyl-CoA is synergistically increased by introducing acetyl-CoA synthase (ACS) and citrate lyase (ACL1); the rate-limiting step of the MVA pathway is synergistically removed by introducing isopentenyl pyrophosphate isomerase (IDI) and farnesyl diphosphate synthase (ERG20); the content of the direct squalene precursor FPP is increased by introducing choline kinase (CK) and isopentenyl phosphate kinase (IPK); and the growth capacity of the strain is increased by introducing the histidine gene (His). The conversion of squalene to downstream products is limited by adding terbinafine and mannitol, the supply of precursors is increased by adding sodium citrate, and the intracellular NADPH level is increased using the photocatalytic material C3N4 without interfering with cellular metabolism, thereby improving the ability of Pichia pastoris to produce squalene.
[0016] A second objective of this invention is to provide a method for constructing the above-mentioned recombinant Pichia pastoris strain, comprising:
[0017] Using BB3-aK-AC as a plasmid vector, a co-expression recombinant plasmid of sqs and tHMGR was constructed, and the recombinant plasmid was integrated into the genome of Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain SQ3.
[0018] Using BB3-aK-AE as a plasmid vector, a co-expression recombinant plasmid of sqs, tHMGR, ACS, and ACL1 was constructed. The recombinant plasmid was integrated into the genome of Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain SQ11.
[0019] Using BB3-aK-AE as a plasmid vector, a co-expression recombinant plasmid of sqs, tHMGR, IDI, and ERG20 was constructed. The recombinant plasmid was integrated into the genome of Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain SQ19.
[0020] Using BB3-aK-AE as a plasmid vector, a co-expression recombinant plasmid of sqs, tHMGR, CK, and IPK was constructed. The recombinant plasmid was integrated into the genome of Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain SQ20.
[0021] Using BB3-rN-AI as a plasmid vector, a co-expression recombinant plasmid of sqs, tHMGR, ACS, ACL1, IDI, ERG20, CK, and IPK was constructed. The recombinant plasmid was integrated into the genome of Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain Z1.
[0022] Using BB3-aK-14* as a plasmid vector, a recombinant plasmid for His expression was constructed, and the recombinant plasmid was integrated into the genome of Pichia pastoris Z1 to obtain the recombinant Pichia pastoris strain Z2.
[0023] A third objective of this invention is to provide the application of the above-mentioned recombinant Pichia pastoris strain in the fermentation production of squalene.
[0024] The recombinant Pichia pastoris strain was subjected to seed culture and fermentation culture to synthesize squalene.
[0025] Primary seed culture: Take the recombinant bacterial culture from the cryopreservation tube at an inoculation rate of 1% and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.
[0026] Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%. Culture it under the same constant temperature conditions as the primary seed culture to obtain the seed culture for fermentation culture.
[0027] Fermentation culture: The seed culture obtained from seed culture is inoculated into a fermenter containing fermentation culture medium.
[0028] Recombinant strain Z2 was subjected to fed-batch fermentation in a fermenter at 25°C, 500 rpm, and dissolved oxygen maintained at 30%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was continuously added to maintain the glucose concentration below 10 g / L. Samples were taken every 12 h to determine cell dry weight and extract squalene from the fermentation broth to determine its content. At the start of fermentation, 0.5 g / L sodium citrate and 6 mM sodium citrate were added. At 24 h, 1.5 mg / L terbinafine and 20 mg / L C3N4 / PEI were added.
[0029] The recombinant Pichia pastoris strain uses glucose as a carbon source and yeast powder as a nitrogen source during fermentation.
[0030] During the fermentation culture of the recombinant Pichia pastoris strain, one or more of sodium citrate, mannitol, terbinafine, and C3N4 / PEI are added.
[0031] Sodium citrate and mannitol are added at the start of fermentation; terbinafine and C3N4 / PEI are added after 24 hours of fermentation.
[0032] Preferably, adding sodium citrate and mannitol during fermentation, and adding terbinafine and C3N4 / PEI after 24 hours of fermentation, is more effective than adding only one or two of them.
[0033] In a preferred embodiment, the amount of glucose added is 20-100 g / L, the amount of yeast powder added is 10-20 g / L, the amount of sodium citrate added is 6-8 mM, the amount of mannitol added is 0.5-2 g / L, the amount of terbinafine added is 0.5-2 mg / L, and the amount of C3N4 / PEI added is 0-80 mg / L.
[0034] More preferably, the amount of glucose added is 20-40 g / L, the amount of yeast powder added is 10-35 g / L, the amount of sodium citrate added is 2-8 mM, the amount of mannitol added is 0.5-2 g / L, the amount of terbinafine added is 0.5-1.5 mg / L, and the amount of C3N4 / PEI added is 20-40 mg / L.
[0035] More preferably, the amount of glucose added is 40 g / L, the amount of yeast powder added is 20 g / L, the amount of sodium citrate added is 6 mM, the amount of mannitol added is 0.5 g / L, the amount of terbinafine added is 1.5 mg / L, and the amount of C3N4 / PEI added is 20 mg / L.
[0036] Beneficial Effects: This invention overcomes the limitations of single or few gene modifications. Through a multi-module synergistic metabolic engineering strategy, a highly efficient and complete squalene synthesis cell factory was constructed in Pichia pastoris. The genes of each module cooperate with each other, significantly improving the overall efficiency of metabolic flux. Through the aforementioned gene synergistic modification combined with an optimized fermentation process, the recombinant Pichia pastoris strain Z2 of this invention achieved a squalene yield of 174.32 mg / g in a 5L fermenter.
[0037] The multiple exogenous genes used in this invention are not simply superimposed, but rather, through metabolic pathway analysis and experimental verification, a synergistically enhanced squalene synthesis system has been constructed. Each gene supports and complements the others within the metabolic network, effectively avoiding metabolic bottlenecks and the accumulation of intermediate products, thus achieving highly efficient conversion from glucose to squalene.
[0038] This invention relates to recombinant Pichia pastoris, which enables the de novo synthesis of squalene from glucose, achieving highly efficient synthesis of the natural product squalene in Pichia pastoris. This invention overcomes the limitations of single-gene modification by combining gene synergistic modification with fermentation processes and photocatalytic cofactor supplementation to form a technical system of "metabolic network optimization + production condition adaptation." It achieves the synthesis of 174.32 mg / g of squalene using glucose as a substrate. Furthermore, this invention utilizes exogenous additives—sodium citrate, mannitol, and terbinafine—to further enhance the squalene production capacity of Pichia pastoris, possessing significant practical and economic value for the industrial and commercial application of high-value terpenoid products. Attached Figure Description
[0039] Figure 1 The plasmid is BB2-AB-pADH2-tHMGR-RPP1Btt, with the tHMGR promoter being pADH2 and the terminator being RPP1Btt. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0040] Figure 2 The plasmid is BB2-BC-pGAP-sqs-ScCYC1tt, with the sqs promoter being the pGAP promoter and the terminator being ScCYC1tt. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0041] Figure 3 The plasmid is BB2-CD-pPDC1-ACL1-RPS2tt, with pPDC1 as the ACL1 promoter and RPS2tt as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0042] Figure 4 The plasmid is BB2-DE-pGPM1-ACS-RPL2Att, with the ACS promoter being pGPM1 and the terminator being RPL2Att. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0043] Figure 5 The plasmid is BB2-CD-pPDC1-ERG20-RPS2tt, with pPDC1 as the ERG20 promoter and RPS2tt as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0044] Figure 6 The plasmid is BB2-DE-pGPM1-IDI-RPL2Att, with pGPM1 as the IDI promoter and RPL2Att as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0045] Figure 7 The plasmid is BB2-CD-pPDC1-IPK-RPS2tt, with pPDC1 as the IPK promoter and RPS2tt as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0046] Figure 8 The plasmid is BB2-DE-pGPM1-CK-RPL2Att, with the CK promoter being pGPM1 and the terminator being RPL2Att. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0047] Figure 9 The plasmid is BB2-EF-pPDC1-ERG20-RPS2tt, with pPDC1 as the ERG20 promoter and RPS2tt as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0048] Figure 10 The plasmid is BB2-FG-pGPM1-IDI-RPL2Att, with pGPM1 as the IDI promoter and RPL2Att as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0049] Figure 11 The plasmid is BB2-GH-pPDC1-IPK-RPS2tt, with pPDC1 as the IPK promoter and RPS2tt as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0050] Figure 12 The plasmid is BB2-HI-pGPM1-CK-RPL2Att, with pGPM1 as the CK promoter and RPL2Att as the terminator. The ampicillin gene carried by this plasmid is used as a selection marker for Escherichia coli DH5α.
[0051] Figure 13 The diagram shows the structure of plasmid BB3-aK-AC-tHMG-sqs, which carries the kanamycin sulfate gene and is used as a selection marker for Pichia pastoris.
[0052] Figure 14 The diagram shows the structure of plasmid BB3-aK-AE-tHMG-sqs-ACL1-ACS, which carries the kanamycin sulfate gene and is used as a selection marker for Pichia pastoris.
[0053] Figure 15 The diagram shows the structure of plasmid BB3-aK-AE-tHMG-sqs-ERG20-IDI, which carries the kanamycin sulfate gene and is used as a selection marker for Pichia pastoris.
[0054] Figure 16 The diagram shows the structure of plasmid BB3-aK-AE-tHMG-sqs-IPK-CK, which carries the kanamycin sulfate gene and is used as a selection marker for Pichia pastoris.
[0055] Figure 17 The diagram shows the structure of plasmid BB3-rN-AI-tHMG-sqs-ACL1-ACS-ERG20-IDI-IPK-CK. The norsinoxin gene carried by this plasmid is used as a selection marker for Pichia pastoris.
[0056] Figure 18 The diagram shows the structure of plasmid BB3-aZ-14*-pMDH3-His-RPP1Btt, which carries the bleomycin gene used as a selection marker for Pichia pastoris.
[0057] Figure 19 A comparison of squalene synthesis by different engineered bacteria without fermentation optimization.
[0058] Figure 20 The effect of different temperatures on the yield of squalene produced by Pichia pastoris.
[0059] Figure 21 The effect of different carbon sources on the yield of squalene produced by Pichia pastoris.
[0060] Figure 22 The effect of different carbon source concentrations on the yield of squalene produced by Pichia pastoris.
[0061] Figure 23 The effect of different nitrogen sources on the production of squalene by Pichia pastoris.
[0062] Figure 24 The effect of different nitrogen source concentrations on the yield of squalene produced by Pichia pastoris.
[0063] Figure 25 The effect of different sodium citrate concentrations on the yield of squalene produced by Pichia pastoris.
[0064] Figure 26 The effect of different terbinafine concentrations on the yield of squalene produced by Pichia pastoris.
[0065] Figure 27 The effect of different mannitol concentrations on the yield of squalene produced by Pichia pastoris.
[0066] Figure 28 The effect of different C3N4 / PEI concentrations on the yield of squalene produced by Pichia pastoris.
[0067] Figure 29 Effect of different isopentenol concentrations on the yield of squalene produced by Pichia pastoris.
[0068] Figure 30 Recombinant strain Z2 ferments glucose to produce squalene.
[0069] Figure 31 Recombinant strain Z2 ferments squalene using methanol as a carbon source. Detailed Implementation
[0070] The present invention will be further described below with reference to specific embodiments.
[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0072] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0073] The original strain of Pichia pastoris used in the examples was Pichia pastoris GS115, which can be purchased from commercial channels.
[0074] The primer sequences used in the examples are shown in Table 1 below.
[0075] Table 1 Primer sequences
[0076] Primer name Sequence (5'-3') tHMG-F GGTCTCCCATGGACCAATTGGTGAA tHMG-R GGTCTCGAAGCTTAGGATTTAATGC sqs-F GGTCTCccatgggaaagctattacaa sqs-R GGTCTCgaagctcacgctctgtgtaaagt ACL1-F GGTCTCccatgtctgccaacgagaacatct ACL1-R GGTCTCgaagcctatgatcgagtcttggcctt ACS-F GGTCTCccatgtctgaggaccacccagccatccaccc ACS-R GGTCTCgaagcttactttttcaacgagtga IDI-F GGTCTCccatgacgacgtcttacagcgacaaaatc IDI-R GGTCTCgaagccctacttgatccaccgccgaatct ERG20-F GGTCTCccatgtccaaggcgaaattcgaaagcg ERG20-R GGTCTCgaagccctactacttctgtcgcttgtaaat CK-F GGTCTCccatggtacaagaatcacgtccaggga CK-R GGTCTCgaagcttacaaataactagtatcgagg
[0077] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids
[0078] (I) Preparation of target gene
[0079] PCR amplification was performed using the *Saccharomyces cerevisiae* genome as a template, based on the gene sequence (Gene ID 854900) encoding 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR from *Saccharomyces cerevisiae*, provided on NCBI. PCR amplification was also performed using the *Saccharomyces cerevisiae* genome as a template, based on the nucleotide sequence (Gene ID 856597) of squalene synthase sqs from *Saccharomyces cerevisiae*, provided on NCBI. PCR amplification was also performed using the *Yarrowia lipolytica* genome as a template, based on the nucleotide sequence (Gene ID 2908441) of acetyl-CoA synthase ACS from *Yarrowia lipolytica*, provided on NCBI. PCR amplification was performed using the *Yarrowia lipolytica* genome as a template, based on the nucleotide sequence (Gene ID 2912101) of citrate lyase ACL1 from *Yarrowia lipolytica*, provided on NCBI. Finally, PCR amplification was performed using the *Yarrowia lipolytica* genome as a template, based on the nucleotide sequence (Gene ID 2907710) of isopentenyl pyrophosphate isomerase IDI from *Yarrowia lipolytica*, provided on NCBI. Based on the nucleotide sequence of farnesyl diphosphate synthase ERG20 (Gene ID 2908051) from *Yersinia lipolytica* (available on NCBI), PCR amplification was performed using the *Yersinia lipolytica* genome as a template. Based on the nucleotide sequence of choline kinase CK (Gene ID 850824) from *Saccharomyces cerevisiae* (available on NCBI), PCR amplification was performed using the *Saccharomyces cerevisiae* genome as a template. Based on the nucleotide sequence of isopentenyl phosphate kinase IPK (Gene ID 834292) from *Arabidopsis thaliana* (available on NCBI), the gene sequence of IPK was synthesized by GenScript. Based on the nucleotide sequence of histidine His (Gene ID 8200978) from NCBI, the gene sequence of His was synthesized by GenScript.
[0080] (II) Construction of recombinant plasmids
[0081] The plasmid used in the examples is BB1_23 (Plasmid #98496).
[0082] 1. Recombinant plasmid BB1-23-tHMGR was amplified by PCR using the *Saccharomyces cerevisiae* genome as a template to obtain the tHMGR gene sequence; recombinant plasmid BB1-23-sqs was amplified by PCR using the *Saccharomyces cerevisiae* genome as a template to obtain the sqs gene sequence; recombinant plasmid BB1-23-ACL1 was amplified by PCR using the *Yarrowia lipolytica* genome as a template to obtain the ACL1 gene sequence; recombinant plasmid BB1-23-ACS was amplified by PCR using the *Yarrowia lipolytica* genome as a template to obtain the ACS gene sequence; and recombinant plasmid BB1-23-IDI was amplified by PCR using the *Yarrowia lipolytica* genome as a template. The IDI gene sequence was obtained. Recombinant plasmid BB1-23-ERG20 was amplified by PCR using the *Yarrowia lipolytica* genome as a template to obtain the ERG20 gene sequence. Recombinant plasmid BB1-23-CK was amplified by PCR using the *Saccharomyces cerevisiae* genome as a template to obtain the CK gene sequence. Each gene fragment was inserted into plasmid BB1-23 using the GoldenGate method, resulting in recombinant plasmids BB1-23-tHMGR, BB1-23-sqs, BB1-23-ACL1, BB1-23-ACS, BB1-23-IDI, BB1-23-ERG20, and BB1-23-CK. Recombinant plasmids BB1-23-IPK and BB1-23-His were synthesized by GenScript after codon optimization.
[0083] Using tHMG-F and tHMGR-R as primers and the tHMGR gene sequence as a template, the tHMGR fragment was amplified. Primer sequences are shown in Table 1. Using sqs-F and sqs-R as primers and the sqs gene sequence as a template, the sqs fragment was amplified. Primer sequences are shown in Table 1. Using ACL1-F and ACL1-R as primers and the ACL1 gene sequence as a template, the ACL1 fragment was amplified. Primer sequences are shown in Table 1. Using ACS-F and ACS-R as primers and the ACS gene sequence as a template, the ACS fragment was amplified. Primer sequences are shown in Table 1. Using IDI-F and IDI-R as primers and the IDI gene sequence as a template, the IDI fragment was amplified. Primer sequences are shown in Table 1. Using ERG20-F and ERG20-R as primers and the ERG20 gene sequence as a template, the ERG20 fragment was amplified. Primer sequences are shown in Table 1. Using CK-F and CK-R as primers and the CK gene sequence as a template, the CK fragment was amplified. The primer sequences are shown in Table 1.
[0084] The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase from Nanjing Novizan Biotechnology Co., Ltd. The system is shown in Table 2.
[0085] Table 2:
[0086] system 50uL Phanta Max Super-Fidelity DNA Polymerase 1uL buffer 25uL distilled water 20uL DNTP 1uL above 1uL quoted below 1uL template 1uL
[0087] The amplified sqs and tHMGR fragments were recovered and purified by agarose gel electrophoresis.
[0088] GoldenGate was assembled using Bsa1 enzyme and T4 ligase from Shanghai Beyotime Biotechnology Co., Ltd. The reaction system is shown in Table 3.
[0089] Table 3
[0090] system 10uL BB1-23 1uL tHMGR / sqs 1uL Bsa1 0.5uL BSA 1uL T4 ligase 0.5uL T4buffer 1uL distilled water 5uL
[0091] The circular recombinant vector was transformed into E. coli DH5α competent cells. Positive recombinant plasmids BB1-23-tHMGR, BB1-23-sqs, BB1-23-ACL1, BB1-23-ACS, BB1-23-IDI, BB1-23-ERG20, BB1-23-CK, BB1-23-IPK, and BB1-23-His were obtained by screening for kanamycin sulfate resistance on plates and verifying by colony PCR and sequencing.
[0092] 2. The recombinant plasmid BB2-AB-pADH2-tHMGR-RPP1Btt was obtained by inserting plasmid BB1-23-tHMGR, plasmid BB1-12-pADH2 (Plasmid #98504), and plasmid BB1-34-RPP1Btt (Plasmid #98522) into plasmid BB2-AB (Plasmid #98534) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0093] The recombinant plasmid BB2-BC-pGAP-sqs-ScCYC1tt was obtained by inserting plasmid BB1-23-sqs, plasmid BB1-12-pGAP (Plasmid #98498), and plasmid BB1-34-ScCYC1tt (Plasmid #98519) into plasmid BB2-BC (Plasmid #98535) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0094] The recombinant plasmid BB2-CD-pPDC1-ACL1-RPS2tt was obtained by inserting plasmid BB1-23-ACL1, plasmid BB1-12-pPDC1 (Plasmid #98501), and plasmid BB1-34-RPS2tt (Plasmid #98521) into plasmid BB2-CD (Plasmid #98536) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0095] The recombinant plasmid BB2-DE-pGPM1-ACS-RPL2Att was obtained by inserting plasmid BB1-23-ACS, plasmid BB1-12-pGPM1 (Plasmid #98499), and plasmid BB1-34-RPL2Att (Plasmid #98528) into plasmid BB2-DE (Plasmid #98537) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0096] The recombinant plasmid BB2-CD-pPDC1-ERG20-RPS2tt was obtained by inserting plasmid BB1-23-ERG20, plasmid BB1-12-pPDC1 (Plasmid #98501), and plasmid BB1-34-RPS2tt (Plasmid #98521) into plasmid BB2-CD (Plasmid #98536) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0097] The recombinant plasmid BB2-DE-pGPM1-IDI-RPL2Att was obtained by inserting plasmid BB1-23-IDI, plasmid BB1-12-pGPM1 (Plasmid #98499), and plasmid BB1-34-RPL2Att (Plasmid #98528) into plasmid BB2-DE (Plasmid #98537) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0098] The recombinant plasmid BB2-CD-pPDC1-IPK-RPS2tt was obtained by inserting plasmid BB1-23-IPK, plasmid BB1-12-pPDC1 (Plasmid #98501), and plasmid BB1-34-RPS2tt (Plasmid #98521) into plasmid BB2-CD (Plasmid #98536) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0099] The recombinant plasmid BB2-DE-pGPM1-CK-RPL2Att was obtained by inserting plasmid BB1-23-CK, plasmid BB1-12-pGPM1 (Plasmid #98499), and plasmid BB1-34-RPL2Att (Plasmid #98528) into plasmid BB2-DE (Plasmid #98537) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0100] The recombinant plasmid BB2-EF-pPDC1-ERG20-RPS2tt was obtained by inserting plasmid BB1-23-ERG20, plasmid BB1-12-pPDC1 (Plasmid #98501), and plasmid BB1-34-RPS2tt (Plasmid #98538) into plasmid BB2-EF (Plasmid #98538) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0101] The recombinant plasmid BB2-FG-pGPM1-IDI-RPL2Att was obtained by inserting plasmid BB1-23-IDI, plasmid BB1-12-pGPM1 (Plasmid #98499), and plasmid BB1-34-RPL2Att (Plasmid #98528) into plasmid BB2-FG (Plasmid #98539) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0102] The recombinant plasmid BB2-GH-pPDC1-IPK-RPS2tt was obtained by inserting plasmid BB1-23-IPK, plasmid BB1-12-pPDC1 (Plasmid #98501), and plasmid BB1-34-RPS2tt (Plasmid #98521) into plasmid BB2-GH (Plasmid #98540) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0103] The recombinant plasmid BB2-HI-pGPM1-CK-RPL2Att was obtained by inserting plasmid BB1-23-CK, plasmid BB1-12-pGPM1 (Plasmid #98499), and plasmid BB1-34-RPL2Att (Plasmid #98528) into plasmid BB2-HI (Plasmid #98541) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0104] The recombinant plasmid BB3-aZ-14*-pMDH3-His-RPP1Btt was obtained by inserting plasmid BB1-23-His, plasmid BB1-12-pMDH3 (Plasmid #98503), and plasmid BB1-34-RPP1Btt (Plasmid #98522) into plasmid BB3-aZ-14* (Plasmid #98542) using the GoldenGate method with Bpi1 enzyme and T4 ligase.
[0105] The construction process of the recombinant plasmid BB2-AB-pADH2-tHMGR-RPP1Btt is as follows:
[0106] GoldenGate was assembled using Bpi1 enzyme and T4 ligase from Nanjing Fomax Biotechnology Co., Ltd., and the reaction system is shown in Table 4.
[0107] Table 4
[0108] system 10uL BB2-AB 1uL BB1-12-pADH2 1uL BB1-23- tHMGR 1uL BB1-34-RPP1Btt 1uL Bpi1 0.5uL BSA 1uL T4 ligase 0.5uL T4buffer 1uL distilled water 3uL
[0109] The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB2-AB-pADH2-tHMGR-RPP1Btt were obtained through ampicillin resistance plate screening and colony PCR and sequencing verification. The plasmid structure is shown below. Figure 1 .
[0110] The construction process of the recombinant plasmid BB2-BC-pGAP-sqs-ScCYC1tt is as follows:
[0111] GoldenGate was assembled using Bpi1 enzyme and T4 ligase from Nanjing Fomax Biotechnology Co., Ltd., and the reaction system is shown in Table 5.
[0112] Table 5
[0113] system 10uL BB2-BC 1uL BB1-12-pGAP 1uL BB1-23- sqs 1uL BB1-34- ScCYC1tt 1uL Bpi1 0.5uL BSA 1uL T4 ligase 0.5uL T4buffer 1uL distilled water 3uL
[0114] The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB2-BC-pGAP-sqs-ScCYC1tt were obtained through ampicillin resistance plate selection and colony PCR and sequencing verification. The plasmid structure is shown below. Figure 2 .
[0115] The recombinant plasmids BB2-CD-pPDC1-ACL1-RPS2tt, BB2-DE-pGPM1-ACS-RPL2Att, BB2-CD-pPDC1-ERG20-RPS2tt, BB2-DE-pGPM1-IDI-RPL2Att, BB2-CD-pPDC1-IPK-RPS2tt, BB2-DE-pGPM1-CK-RPL2Att, BB2-EF-pPDC1-ERG20-RPS2tt, BB2-FG-pGPM1-IDI-RPL2Att, BB2-GH-pPDC1-IPK-RPS2tt, and BB2-HI-pGPM1-CK-RPL2Att were constructed using the same method as above. See [link to plasmid structure chart]. Figure 3 , Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 , Figure 9 , Figure 10 , Figure 11 , Figure 12 .
[0116] 3. The recombinant plasmid BB3aK-AC-tHMG-sqs was constructed by inserting plasmids BB2-AB-pADH2-tHMGR-RPP1Btt and BB2-BC-pGAP-sqs-ScCYC1tt into plasmid BB3aK-AC (Plasmid #98530) using the GoldenGate method with Bsa1 enzyme and T4 ligase, resulting in plasmid BB3aK-AC-tHMG-sqs. The structure of the recombinant plasmid BB3aK-AC-tHMG-sqs is shown below. Figure 13 .
[0117] The construction process of the recombinant plasmid BB3aK-AC-tHMG-sqs is as follows:
[0118] GoldenGate assembly was performed using Bsa1 enzyme and T4 ligase, and the reaction system is shown in Table 6.
[0119] Table 6:
[0120] system 10uL BB3aK-AC 1uL BB2-AB- pADH2-tHMGR-RPP1Btt 1uL BB2-BC- pGAP-sqs-ScCYC1tt 1uL Bsa1 0.5uL BSA 1uL T4 ligase 0.5uL T4buffer 1uL distilled water 4uL
[0121] The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB3aK-AC-tHMG-sqs were obtained through kanamycin sulfate resistance plate screening and colony PCR and sequencing verification. The plasmid structure is shown in [link to plasmid structure]. Figure 13 .
[0122] The recombinant plasmid BB3-aK-AE-tHMG-sqs-ACL1-ACS was constructed by inserting plasmids BB2-AB-pADH2-tHMGR-RPP1Btt, BB2-BC-pGAP-sqs-ScCYC1tt, BB2-CD-pPDC1-ACL1-RPS2tt, and BB2-DE-pGPM1-ACS-RPL2Att into plasmid BB3aK-AE (Plasmid #98532) using the GoldenGate method with Bsa1 enzyme and T4 ligase, resulting in plasmid BB3-aK-AE-tHMG-sqs-ACL1-ACS. The structure of the recombinant plasmid BB3-aK-AE-tHMG-sqs-ACL1-ACS is shown below. Figure 14 .
[0123] The recombinant plasmid BB3-aK-AE-tHMG-sqs-ERG20-IDI was constructed by inserting plasmids BB2-AB-pADH2-tHMGR-RPP1Btt, BB2-BC-pGAP-sqs-ScCYC1tt, BB2-CD-pPDC1-ERG20-RPS2tt, and BB2-DE-pGPM1-IDI-RPL2Att into plasmid BB3aK-AE (Plasmid #98532) using the GoldenGate method with Bsa1 enzyme and T4 ligase, resulting in plasmid BB3-aK-AE-tHMG-sqs-ERG20-IDI. The structure of the recombinant plasmid BB3-aK-AE-tHMG-sqs-ERG20-IDI is shown below. Figure 15 .
[0124] The recombinant plasmid BB3-aK-AE-tHMG-sqs-IPK-CK was constructed by inserting plasmids BB2-AB-pADH2-tHMGR-RPP1Btt, BB2-BC-pGAP-sqs-ScCYC1tt, BB2-CD-pPDC1-IPK-RPS2tt, and BB2-DE-pGPM1-CK-RPL2Att into plasmid BB3aK-AE (Plasmid #98532) using the GoldenGate method with Bsa1 enzyme and T4 ligase, resulting in plasmid BB3-aK-AE-tHMG-sqs-IPK-CK. The structure of the recombinant plasmid BB3-aK-AE-tHMG-sqs-IPK-CK is shown below. Figure 16 .
[0125] The recombinant plasmid BB3-rN-AI-tHMG-sqs-ACL1-ACS-ERG20-IDI-IPK-CK was inserted into plasmid BB3-rN-AI using the GoldenGate method with Bpi1 enzyme and T4 ligase. The plasmids BB2-AB-pADH2-tHMGR-RPP1Btt, BB2-BC-pGAP-sqs-ScCYC1tt, BB2-CD-pPDC1-ACL1-RPS2tt, BB2-DE-pGPM1-ACS-RPL2Att, BB2-EF-pPDC1-ERG20-RPS2tt, BB2-FG-pGPM1-IDI-RPL2Att, BB2-GH-pPDC1-IPK-RPS2tt, and BB2-HI-pGPM1-CK-RPL2Att were used in combination with these plasmids. From #98557), the plasmid BB3-rN-AI-tHMG-sqs-ACL1-ACS-ERG20-IDI-IPK-CK was obtained. The structure of the recombinant plasmid BB3-rN-AI-tHMG-sqs-ACL1-ACS-ERG20-IDI-IPK-CK is shown below. Figure 17 .
[0126] The recombinant plasmid BB3-aZ-14*-pMDH3-His-RPP1Btt was obtained by inserting plasmids BB1-23-His, BB1-12-pMDH3 (Plasmid #98503), and BB1-34-RPP1Btt (Plasmid #98522) into plasmid BB3-aZ-14* (Plasmid #98542) using the GoldenGate method with Bpi1 enzyme and T4 ligase. The structure of the recombinant plasmid BB3-aZ-14*-pMDH3-His-RPP1Btt is shown below. Figure 18 .
[0127] Example 2 Construction of recombinant bacteria
[0128] Construction of recombinant bacteria SQ3, SQ11, SQ19, SQ20, and Z1:
[0129] The plasmid BB3aK-AC-tHMG-sqs containing the tHMGR-sqs gene expression cassette was introduced into Pichia pastoris to obtain recombinant strain SQ3.
[0130] The plasmid BB3aK-AC-tHMGR-sqs-ACL1-ACS containing the tHMGR-sqs-ACL1-ACS gene expression cassette was introduced into Pichia pastoris to obtain recombinant strain SQ11.
[0131] The plasmid BB3aK-AC-tHMGR-sqs-IDI-ERG20 containing the tHMGR-sqs-IDI-ERG20 gene expression cassette was introduced into Pichia pastoris to obtain recombinant strain SQ19.
[0132] The plasmid BB3aK-AC-tHMGR-sqs-CK-IPK containing the tHMGR-sqs-CK-IPK gene expression cassette was introduced into Pichia pastoris to obtain recombinant strain SQ20.
[0133] The plasmid BB3-IN-AI-tHMGR-sqs-ACL1-ACS-IDI-ERG20-IPK-CK containing the tHMGR-sqs-ACL1-ACS-IDI-ERG20-IPK-CK gene expression cassette was introduced into Pichia pastoris to obtain recombinant strain Z1.
[0134] The specific method is as follows:
[0135] ① Competent cells were prepared by overnight culture of Pichia pastoris in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).
[0136] ② Using an electroporator, BB3aK-AC-tHMG-sqs, BB3aK-AC-tHMGR-sqs-ACL1-ACS, BB3aK-AC-tHMGR-sqs-IDI-ERG20, BB3aK-AC-tHMGR-sqs-CK-IPK, and BB3-IN-AI-tHMGR-sqs-ACL1-ACS-IDI-ERG20-IPK-CK were introduced into competent Pichia pastoris cells for homologous recombination.
[0137] ③ YPD screening plates with added kanamycin sulfate were used for screening. Single colonies grew in 2-3 days. The positive clones that were correctly identified by PCR were named recombinant bacteria SQ3, SQ11, SQ19, SQ20, and Z1.
[0138] Construction of recombinant strain Z2:
[0139] The plasmid BB3-aZ-14*-pMDH3-His-RPP1Btt containing the His gene expression cassette was introduced into Pichia pastoris Z1 to obtain recombinant strain Z2.
[0140] The specific method is as follows:
[0141] ① Competent cells were prepared by overnight culture of Pichia pastoris Z1 in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).
[0142] ② BB3-aZ-14*-pMDH3-His-RPP1Btt was introduced into Pichia pastoris Z1 competent cells using an electroporator for homologous recombination.
[0143] ③ Use YPD selection plates with added bleomycin for screening. Single colonies will grow in 2-3 days. The positive clones that are correctly identified by PCR are named recombinant bacteria Z2.
[0144] Preparation method of competent cells of Pichia pastoris:
[0145] Yeast cells grow to OD 600 The concentration was 0.8–1.0; centrifuged at 4000 rpm for 5 min at room temperature; the supernatant was discarded, and the bacterial sludge was resuspended in 9 mL of BEDS solution and 1 mL of 1 M threitol; incubated on ice for 5 min; centrifuged at 4000 rpm for 5 min at room temperature; the supernatant was discarded, and the bacterial sludge was resuspended in 1 mL of BEDS solution; dispensed into 1.5 mL EP tubes and stored at -80℃.
[0146] BEDS solution: 10 mM bicine-NaOH, pH 8.3; 3% (v / v) ethylene glycol and 1M sorbitol.
[0147] Example 3: Application of recombinant bacteria in the production of squalene
[0148] 1. Cultivation of engineered bacteria
[0149] Squalene was produced using the recombinant strains SQ3, SQ11, SQ19, SQ20, Z1, and Z2 from Example 2. The specific method is as follows: Strains were taken from preservation tubes and inoculated into YPD test tubes at a 1% inoculum. The culture was carried out at 30°C for 24 hours to obtain seed culture. The seed culture was then inoculated into 50 mL of fermentation medium at a 1% inoculum and cultured at 30°C with shaking at 220 rpm for 5 days. Samples were taken every 24 hours for analysis. The fermentation medium consisted of MgSO4·7H2O: 0.5 g / L, KH2PO4: 11.93 g / L, K2HPO4·3H2O: 2.8 g / L, Yeast Extract: 10 g / L, Glucose: 20 g / L, Histidine: 0.1%, Vitamins: 0.1%, and Trace Elements: 0.2%.
[0150] 2. Extraction of squalene
[0151] Take 1 mL of the well-mixed fermentation broth and centrifuge at 12000 rpm for 2 min; resuspend the cells in pure water and wash, then centrifuge at 8000 rpm for 10 min; discard the supernatant, add 1 mL of 4 mol / L HCl, and heat in a 95℃ water bath for 30 min. Incubate on ice for 10 min, then centrifuge at 8000 rpm for 10 min; add 1 mL of pure water and vortex for 5 min, then centrifuge at 8000 rpm for 10 min; discard the supernatant, add acetone to a final volume of 1 mL, and let stand for 2-3 hours; quantification of squalene concentration was performed using high performance liquid chromatography.
[0152] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C18 column; the UV absorption wavelength was 210 nm; the mobile phase was methanol; the flow rate was controlled at 1.0 mL / min; the injection volume was 10 μL; and the column temperature was 40 °C.
[0153] The squalene yields in recombinant strains SQ3, SQ11, SQ19, SQ20, Z1, and Z2 were 648.67 mg / L, 775.41 mg / L, 983.95 mg / L, 748.66 mg / L, 1169.32 mg / L, and 1172.32 mg / L, respectively. Figure 19 ).
[0154] Example 4: Fermentation optimization of recombinant strain Z2
[0155] Effects of different fermentation temperatures on the fermentation of engineered strains
[0156] The method was the same as in Example 3. The engineered strain was inoculated into a shake flask of fermentation medium and then fermented for 5 days in shakers at 18℃, 25℃, 27℃, and 30℃. The effects of different temperatures on the yield of squalene produced by Pichia pastoris were compared. Figure 20 At a culture temperature of 25℃, Pichia pastoris Z2 showed the best squalene production, with a yield of 1452.09 mg / L.
[0157] Effects of different carbon sources on fermentation of engineered strains
[0158] The method was the same as in Example 3, but five different carbon sources—glucose, fructose, ethanol, methanol, and glycerol—were selected at an initial concentration of 20 g / L to replace glucose in the fermentation basal medium. Fermentation was carried out at 25°C and 180 rpm in a shaker for 5 days. Samples were taken every 24 hours to measure various parameters and compare the effects of different carbon sources on the production of squalene by Pichia pastoris. Figure 21 When glucose was used as the sole carbon source, Pichia pastoris Z2 showed the best squalene production, with a yield of 1454.54 mg / L.
[0159] Effects of different carbon source concentrations on fermentation of engineered strains
[0160] The method was the same as in Example 3, but glucose was selected at initial concentrations of 20, 40, 60, 80, and 100 g / L to replace the glucose concentration in the fermentation basal medium. Fermentation was carried out at 25°C and 180 rpm in a shaker for 5 days. Samples were taken every 24 hours to measure various parameters and compare the effects of different carbon source concentrations on the production of squalene by Pichia pastoris. Figure 22 At a glucose concentration of 40 g / L, Pichia pastoris Z2 showed the best squalene production, with a yield of 1571.34 mg / L.
[0161] Effects of different nitrogen sources on fermentation of engineered strains
[0162] The method was the same as in Example 3, but six different nitrogen sources—yeast powder, peptone, corn steep liquor powder, ammonium sulfate, ammonium chloride, and urea—were selected at an initial concentration of 10 g / L to replace the yeast powder in the fermentation basal medium. Fermentation was carried out at 25°C and 180 rpm in a shaker for 5 days. Samples were taken every 24 hours to measure various parameters and compare the effects of different nitrogen sources on the production of squalene by Pichia pastoris. Figure 23 When yeast extract was used as the sole nitrogen source, Pichia pastoris Z2 showed the best squalene production, with a yield of 1576.68 mg / L.
[0163] Effects of different nitrogen source concentrations on fermentation of engineered strains
[0164] The method was the same as in Example 3, but yeast powder at initial concentrations of 10, 15, 20, 25, 30, and 35 g / L was used to replace the yeast powder concentration in the fermentation basal medium. Fermentation was carried out at 25°C and 180 rpm in a shaker for 5 days. Samples were taken every 24 hours to measure various parameters and compare the effects of different nitrogen source concentrations on the production of squalene by Pichia pastoris. Figure 24 At a yeast concentration of 20 g / L, Pichia pastoris Z2 showed the best squalene production, with a yield of 1727.12 mg / L.
[0165] Effects of different sodium citrate concentrations on fermentation of engineered strains
[0166] The method was the same as in Example 3, with sodium citrate added at initial concentrations of 0, 2, 4, 6, and 8 mM at hour 0. Other fermentation medium components remained unchanged. Fermentation was carried out for 5 days at 25°C and 180 rpm in a shaker. Samples were taken every 24 hours to measure various parameters and compare the effects of different sodium citrate concentrations on the yield of squalene produced by Pichia pastoris. Figure 25 At a sodium citrate concentration of 6 mM, Pichia pastoris Z2 showed the best squalene production, with a yield of 1848.15 mg / L.
[0167] Effects of different terbinafine concentrations on fermentation of engineered strains
[0168] The method was the same as in Example 3, except that 6 mM sodium citrate was added at 0 h, and terbinafine was added at 24 h at initial concentrations of 0, 0.5, 1, 1.5, and 2 mg / L. Other fermentation medium components remained unchanged. Fermentation was carried out for 5 days at 25°C and 180 rpm in a shaker. Samples were taken every 24 h to measure various parameters and compare the effects of different terbinafine concentrations on the yield of squalene produced by Pichia pastoris. Figure 26 At a terbinafine concentration of 1.5 mg / L, engineered Pichia pastoris Z2 showed the best squalene production, with a yield of 1942.28 mg / L.
[0169] Effects of different mannitol concentrations on fermentation of engineered strains
[0170] The method was the same as in Example 3, except that 6 mM sodium citrate was added at 0 h, 1.5 mg / L terbinafine was added at 24 h, and mannitol was added at initial concentrations of 0, 0.5, 1, 1.5, and 2 g / L at 0 h. Other fermentation medium components remained unchanged. Fermentation was carried out for 5 days at 25°C and 180 rpm in a shaker. Samples were taken every 24 h to measure various parameters and compare the effects of different mannitol concentrations on the yield of squalene produced by Pichia pastoris. Figure 27 At a mannitol concentration of 0.5 g / L, Pichia pastoris Z2 showed the best squalene production, with a yield of 2123.63 mg / L.
[0171] Effects of different concentrations of the photocatalyst C3N4 / PEI on the fermentation of engineered strains
[0172] The method was the same as in Example 3, with 6 mM sodium citrate added at 0h, 1.5 mg / L terbinafine added at 24h, 0.5 g / L mannitol added at 0h, and initial concentrations of photocatalyst C3N4 / PEI of 0, 20, 40, 60, and 80 mg / L added at 24h. Other fermentation medium components remained unchanged. Simultaneously, white light irradiation was used, and fermentation was carried out for 5 days in a shaker at 25℃ and 180 rpm. Samples were taken every 24h to measure various parameters, comparing the effects of different C3N4 / PEI concentrations on the yield of squalene produced by Pichia pastoris. Figure 28 At a C3N4 / PEI concentration of 20 mg / L, engineered Pichia pastoris Z2 showed the best squalene production, with a yield of 2203.64 mg / L.
[0173] Effects of different isopentenol concentrations on fermentation of engineered strains
[0174] The method was the same as in Example 3, with 6 mM sodium citrate added at 0h, 1.5 mg / L terbinafine added at 24h, 0.5 g / L mannitol added at 0h, 20 mg / L photocatalyst C3N4 / PEI added at 24h, and isopentenol added at initial concentrations of 0.5, 1, 1.5, and 2 mM at 24h. Other fermentation medium components remained unchanged. Simultaneously, white light irradiation was used, and fermentation was carried out for 5 days in a shaker at 25℃ and 180 rpm. Samples were taken every 24h to measure various parameters, comparing the effects of different isopentenol concentrations on the yield of squalene produced by Pichia pastoris. Figure 29 At a concentration of 1 mM isopentenol, Pichia pastoris Z2 showed the best squalene production, with a yield of 2277.64 mg / L.
[0175] Example 5: Production of squalene by fermentation of recombinant strain Z2 using glucose as a carbon source.
[0176] ① Seed culture:
[0177] a. Primary seed culture: Take 1% of the recombinant strain Z2 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.
[0178] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.
[0179] ② Batch feeding fermentation:
[0180] The seed culture obtained from the seed culture was inoculated into a 5L fermenter containing fermentation medium. Recombinant strain Z2 underwent fed-batch fermentation in the 5L fermenter at 25℃ and 500 r. Dissolved oxygen was maintained at 30±5% in the first stage and 10±5% in the second stage. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was almost depleted, glucose was added to maintain the glucose concentration below 10 g / L. Samples were taken every 12 h to determine cell dry weight and extract squalene from the fermentation broth to determine its content. At the start of fermentation, 6 mM sodium citrate and 0.5 g / L mannitol were added. At 24 h, 1.5 mg / L terbinafine, 20 mg / L photocatalyst C3N4 / PEI, and 1 mM isopentenol were added while maintaining light. Cell OD... 600 The concentration reached 352.48, and the squalene content was 174.32 mg / g. Figure 30 ).
[0181] Example 6: Production of squalene by fermentation of recombinant strain Z2 using methanol as a carbon source
[0182] ① Seed culture:
[0183] a. Primary seed culture: Take 1% of the recombinant strain Z2 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.
[0184] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.
[0185] ② Batch feeding fermentation:
[0186] The seed culture was inoculated into 2 L of basal salt medium (BSM) and fermented at 25°C. The pH was maintained at 5.5 by automatically adding ammonia and phosphoric acid. During the initial fermentation stage, the stirring speed was maintained at 600-800 r / min and the aeration rate was 5 vvm. After the initial glycerol in the medium was completely consumed, a 500 g / L glycerol solution containing PTM1 trace element was added until the OD reached... 600 Stop feeding glycerol when the value reaches approximately 200. Adjust the stirring speed and control the aeration rate below 2 vvm to maintain a dissolved oxygen (DO) concentration of approximately 15%. After the glycerol is depleted, add methanol at a rate of 10 g / h for induction. Take samples periodically to detect squalene yield and OD. 600 . BSM: 26.7 mL / L 85 % H3PO4, 0.93 g / L CaSO4·2H2O, 18.2 g / L K2SO4, 11.47 g / L MgSO4, 4.13 g / L KOH, 40 g / L glycerol and 4.35 mL / L PTM1: (6 g / L CuSO4·5H2O, 0.08 g / L KI, 3 g / L MnSO4·H2O, 0.2 g / L Na2MoO4·2H2O, 0.02 g / L H3BO3, 0.92g / L CoCl2·6H2O, 20 g / L ZnCl2, 65 g / L FeSO4·7H2O, 0.2 g / L bioti and 5 mL / L H2SO4). At the start of fermentation, 6 mM sodium citrate and 0.5 g / L mannitol were added. After 24 h, 1.5 mg / L terbinafine, 20 mg / L photocatalyst C3N4 / PEI, and 1 mM isopentenol were added, while maintaining light exposure. The squalene content was 23.57 mg / g. Figure 31 ).
[0187] This invention achieves breakthroughs in three key areas: enhanced precursor supply through synergistic gene modification, innovative use of photocatalytic materials to increase intracellular NADPH levels, and precise process control to balance strain growth and squalene accumulation. Ultimately, the production capacity of the strain was comprehensively evaluated through fed-batch fermentation in a 5L fermenter, using OD values of the recombinant strain Z2 in the fermenter. 600 The monitoring of squalene production is expected to further increase squalene production in larger fermentation tanks, laying the foundation for subsequent industrialization.
Claims
1. A recombinant Pichia pastoris strain producing squalene, characterized in that, Pichia pastoris ( Pichia pastoris The enzyme was obtained by introducing squalene synthase (sqs), 3-hydroxy-3-methylglutaryl-CoA reductase (tHMGR), acetyl-CoA synthase (ACS), citrate lyase (ACL1), isopentenyl pyrophosphate isomerase (IDI), farnesyl diphosphate synthase (ERG20), choline kinase (CK), isopentenyl phosphate kinase (IPK), and histidine gene (His) into the enzyme.
2. The strain according to claim 1, characterized in that, The Pichia pastoris is Pichia pastoris strain GS115.
3. The strain according to claim 1, characterized in that, The squalene synthase sqs, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, and choline kinase CK were derived from Saccharomyces cerevisiae; acetyl-CoA synthase ACS, citrate lyase ACL1, isopentenyl pyrophosphate isomerase IDI, and farnesyl diphosphate synthase ERG20 were derived from Yersinia lipolytica; isopentenyl phosphate kinase IPK was derived from Arabidopsis thaliana; and histidine gene His was derived from Pichia pastoris.
4. The strain according to claim 1, characterized in that, The Gene ID of the 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR gene is 854900; the Gene ID of the squalene synthase sqs gene is 856597; the Gene ID of the acetyl-CoA synthase ACS gene is 2908441; the Gene ID of the citrate lyase ACL1 gene is 2912101; the Gene ID of the isopentenyl pyrophosphate isomerase IDI gene is 2907710; the Gene ID of the farnesyl diphosphate synthase ERG20 gene is 2908051; the Gene ID of the choline kinase CK gene is 850824; the Gene ID of the isopentenyl phosphate kinase IPK gene is 834292; and the Gene ID of the histidine gene His gene is 8200978.
5. The method for constructing the recombinant Pichia pastoris strain according to any one of claims 1-4, characterized in that, Using BB3-rN-AI as the plasmid vector, co-expression recombinant plasmids of sqs, tHMGR, ACS, ACL1, IDI, ERG20, CK, and IPK were constructed, and the recombinant plasmids were integrated into Pichia pastoris. GS115 The recombinant Pichia pastoris strain was obtained genomically. Z1 Using BB3-aK-14* as a plasmid vector, a recombinant plasmid for His expression was constructed, and the recombinant plasmid was integrated into Pichia pastoris. Z1 The recombinant Pichia pastoris strain was obtained genomically. Z2 .
6. The use of the recombinant Pichia pastoris strain according to any one of claims 1-4 in the fermentation production of squalene.
7. The application according to claim 6, characterized in that, The recombinant Pichia pastoris strain was subjected to seed culture and fermentation culture to synthesize squalene.
8. The application according to claim 7, characterized in that, One or more of sodium citrate, mannitol, terbinafine, and C3N4 / PEI are added during the fermentation culture of the recombinant Pichia pastoris strain.
9. The application according to claim 8, characterized in that, Sodium citrate and mannitol are added at the start of fermentation; terbinafine and C3N4 / PEI are added after 24 hours of fermentation.
10. The application according to claim 9, characterized in that, The dosage of sodium citrate is 2-8 mM, mannitol is 0.5-2 g / L, terbinafine is 0.5-2 mg / L, and C3N4 / PEI is 0-80 mg / L.