Engineering bacterium for producing 2-deoxy-D-ribose as well as preparation and application of engineering bacterium

Abstract

The invention provides an engineering bacterium for producing 2-deoxy-D-ribose as well as preparation and application thereof, plasmids for expressing deoC and yfbT genes and plasmids for expressing nox and PDC genes are respectively constructed and transferred into escherichia coli, and genetic engineering bacteria capable of simultaneously expressing deoC, yfbT, nox and PDC are constructed and obtained. According to the present invention, with the application of the recombinant plasmid, the 2-deoxy-d-ribose 5-phosphate aldolase (DERA), the sugar phosphatase, the NADH oxidase (H2O-forming NADH oxidase) and the pyruvate decarboxylase (PDC) can be subjected to the overexpression by using the recombinant plasmid, such that the recombinant plasmid can be subjected to the overexpression so as to obtain the 2-deoxy-d-ribose 5-phosphate aldolase (DERA); by adopting the engineering bacterium, the 2-deoxy-D-ribose can be stably produced at high yield through fermentation, acetaldehyde or Gap-3P does not need to be added as a substrate, the preparation process is simpler, more convenient and more efficient, the cost is low, the application prospect is wide, and a foundation is laid for green production of the 2-deoxy-D-ribose.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an engineered bacterium that produces 2-deoxy-D-ribose, its preparation, and its application. Background Technology

[0002] 2-Deoxy-D-ribose is an important deoxyglycan and a core component of DNA molecules, with wide applications in scientific research, medicine, and health products. It is a key starting material for the chemical synthesis of oligonucleotides, used in gene sequencing, molecular cloning, and gene editing; it is also an important intermediate in nucleoside analogue antiviral and anticancer drugs (such as acyclovir and gemcitabine); and it can be used as a nutritional supplement to aid in the recovery of heart health and relieve fatigue.

[0003] Currently, the main methods for producing 2-deoxy-D-ribose include chemical synthesis and enzymatic methods.

[0004] Chemical synthesis methods, such as patents CN 104004031 A and CN105732732A, disclose various chemical synthesis methods for 2-deoxy-D-ribose. Although chemical synthesis methods are mature, they have problems such as significant environmental pollution, complex processes, and harsh reaction conditions.

[0005] Enzymatic methods have attracted increasing attention due to their high catalytic efficiency and environmental friendliness. 2-Deoxy-D-ribose-5-phosphate aldolase (DERA, EC 4.1.2.4) can catalyze a reversible aldol condensation reaction between acetaldehyde and D-glyceraldehyde-3-phosphate (Gap-3P) to produce 2-deoxy-D-ribose-5-phosphate (DR5P).

[0006] Enzymatic methods, such as patent CN 105063000A, disclose a mutant of Escherichia coli 2-deoxy-D-ribose-5-phosphate aldolase and its preparation method. A random mutant library of the DERA enzyme is constructed using error-prone PCR, followed by enzyme activity assays to screen for mutants with the highest enzyme activity. Patent CN 118126992A discloses a mutant of 2-deoxy-D-ribose-5-phosphate aldolase and its applications, discovering a wild-type aldolase derived from thermophilic archaea, solving the problem of rate-limiting intermediates in the catalytic synthesis of chiral side chains of statin drugs. However, both of these engineered bacteria require the addition of acetaldehyde or Gap-3P as substrates to synthesize 2-deoxy-D-ribose.

[0007] Meanwhile, despite the versatility of DERA, several obstacles limit its large-scale application. DERA exhibits a strong preference for phosphorylated substrates and undergoes rapid, irreversible inactivation at high aldehyde concentrations. Some DERA mutants can enhance their affinity for non-phosphorylated substrates and their tolerance to higher aldehyde concentrations. Furthermore, the enzymatic preparation of deoxyribose requires expensive glyceraldehyde-3-phosphate substrates, resulting in high production costs. Additionally, enzyme production typically suffers from low soluble expression levels, poor stability, and low activity.

[0008] Direct biofermentation, with its advantages of wide availability of raw materials, high production efficiency, environmental friendliness, and sustainability, has become the mainstream method for large-scale production of most natural small molecule products. However, there is currently limited research on strains that produce 2-deoxy-D-ribose, so there is an urgent need to find a simpler method that can stably and efficiently produce high yields of 2-deoxy-D-ribose through fermentation alone, without the need for adding acetaldehyde or other substrates. Summary of the Invention

[0009] To address the aforementioned technical problems, this invention provides an engineered bacterium producing 2-deoxy-D-ribose, its preparation, and its applications. By constructing plasmids expressing the deoC and yfbT genes, and plasmids expressing the nox and PDC genes, respectively, and transforming them into *E. coli*, a genetically engineered bacterium capable of simultaneously expressing deoC, yfbT, nox, and PDC is obtained. This allows it to overexpress 2-deoxy-D-ribose 5-phosphate aldolase (DERA), sugar phosphatase, H2O-forming NADH oxidase, and pyruvate decarboxylase (PDC). Using this engineered bacterium, fermentation can stably and efficiently produce high levels of 2-deoxy-D-ribose without the need for acetaldehyde or Gap-3P as substrates. The preparation process is simple, efficient, and low-cost, with broad application prospects, laying the foundation for the green production of 2-deoxy-D-ribose.

[0010] On one hand, the present invention provides an engineered bacterium that produces 2-deoxy-D-ribose, wherein the engineered bacterium carries a foreign gene that can express an enzyme related to the synthesis of 2-deoxy-D-ribose, the enzyme including any one or more of 2-deoxy-d-ribose 5-phosphate aldolase (DERA), sugar phosphatase, NADH oxidase (H2O-forming NADH oxidase), and pyruvate decarboxylase (PDC).

[0011] Currently, there are no reports of engineered bacteria that can generate 2-deoxy-D-ribose through simple fermentation without the addition of acetaldehyde or Gap-3P as substrates. This invention, through ingenious metabolic engineering design and modification, constructs an engineered bacterium capable of producing high yields of 2-deoxy-D-ribose "from scratch," utilizing only inexpensive carbon sources (such as glucose) without relying on expensive external substrates (such as acetaldehyde or Gap-3P).

[0012] This invention designs a completely new metabolic pathway (such as...) Figure 1 By constructing plasmids containing exogenous genes and transforming them into host bacteria, the strain carries these exogenous genes. Through these genes, the strain can endogenously synthesize acetaldehyde and Gap-3P via metabolic pathways. Simultaneously, it can utilize acetaldehyde and Gap-3P to autonomously assemble the target product 2-deoxy-D-ribose (chemical structure shown in...). Figure 2 In other words, this strain can function as a "complete factory" for producing 2-deoxy-D-ribose, not only using the most basic raw materials (such as glucose) to produce all the components (including acetaldehyde and Gap-3P), but also assembling them into the target product (2-deoxy-D-ribose).

[0013] The exogenous genes in the introduced strain include genes that can express four enzymes: 2-deoxy-d-ribose-5-phosphate aldolase (DERA), sugar phosphatase, NADH oxidase, and / or pyruvate decarboxylase (ZmPDC).

[0014] according to Figure 1 The metabolic pathways show that the steps for synthesizing 2-deoxy-D-ribose by fermentation designed in this invention include the following four steps: Step 1, Gap-3P produced by glycolysis; Step 2, synthesis of acetaldehyde; Step 3, condensation of acetaldehyde and Gap-3P to generate 2-deoxy-D-ribose 5-phosphate; Step 4, dephosphate group of 2-deoxy-D-ribose 5-phosphate to obtain 2-deoxy-D-ribose.

[0015] In step one, E. coli synthesizes Gap-3P by using glucose as a raw material through its own glycolysis pathway.

[0016] Step 2: In the autoglycolysis pathway of E. coli, some Gap-3P is converted into pyruvate. To synthesize acetaldehyde, a precursor for 2-deoxy-D-ribose, this invention utilizes a strain that overexpresses pyruvate decarboxylase, which converts pyruvate into acetaldehyde, providing a precursor for the synthesis of 2-deoxy-D-ribose.

[0017] The pyruvate decarboxylase from *Fermentomonas motilityis* is not normally found in *Escherichia coli*. This invention successfully transformed *E. coli* into a highly efficient acetaldehyde fermentation cell factory by introducing an exogenous PDC gene into *E. coli*.

[0018] Theoretically, step two can be achieved simply by overexpressing pyruvate decarboxylase in the strain. However, in some methods, because E. coli glycolysis produces excess cytoplasmic NADH, which can reduce acetaldehyde to ethanol via endogenous alcohol dehydrogenase, it is necessary to optimize the strain to overexpress NADH oxidase. This can consume the excess cytoplasmic NADH, prevent the conversion of acetaldehyde to ethanol, and ensure the supply of precursor acetaldehyde.

[0019] Step 3: DERA reversibly catalyzes the aldol condensation reaction between its natural substrate acetaldehyde and Gap-3P to generate 2-deoxy-d-ribose-5-phosphate. This enzyme belongs to class I aldolases, does not require cofactors, and is the only aldolase capable of catalyzing the self-condensation of acetaldehyde or the cross-condensation between acetaldehyde and aldehydes. Wild-type DERA exhibits a strong preference for phosphorylated substrates. This invention demonstrates that overexpression of DERA derived from *E. coli* (encoded by deoC) can introduce a 2-deoxy-D-ribose-5-phosphate aldolase (DERA) into the strain, capable of catalyzing the condensation of acetaldehyde and D-glyceraldehyde to generate 2-deoxy-D-ribose-5-phosphate. This aldolase can catalyze the conversion of acetaldehyde and Gap-3P produced by glycolysis into 2-deoxy-D-ribose-5-phosphate.

[0020] Step 4: By overexpressing the yfbT gene encoding phosphorylase in the strain, sugar phosphorylase is generated. Under the action of sugar phosphorylase, the phosphate group of 2-deoxy-D-ribose-5-phosphate is removed, and the target product 2-deoxy-D-ribose is finally obtained.

[0021] Furthermore, the gene for synthesizing 2-deoxy-d-ribose-5-phosphate aldolase is deoC, the gene for synthesizing sugar phosphatase is yfbT, the gene for synthesizing NADH oxidase is nox, and the gene for synthesizing pyruvate decarboxylase is PDC.

[0022] It is understood that any deoC, yfbT, nox, or PDC gene from any source, as long as it can encode the four enzymes DERA, sugar phosphatase, NADH oxidase, and pyruvate decarboxylase in the host bacterium, can be used to construct the engineered bacterium that produces 2-deoxy-D-ribose provided by this invention.

[0023] In some embodiments, the pyruvate decarboxylase is a pyruvate decarboxylase from *M. motile fermentum*. Because *M. motile fermentum* pyruvate decarboxylase has higher substrate affinity and catalytic efficiency, higher thermal stability, and relative insensitivity to oxygen, overexpression of *M. motile fermentum* pyruvate decarboxylase in the host bacterium is preferred, as it can more efficiently convert pyruvate to acetaldehyde, effectively increasing the yield of 2-deoxy-D-ribose.

[0024] In some embodiments, the NADH oxidase is an aqueous NADH oxidase derived from *Lactococcus lactis* subsp. cremoris. The aqueous NADH oxidase from *Lactococcus lactis* subsp. cremoris exhibits high catalytic efficiency and a high affinity for NADH, without damaging cells or other enzymes. It can more effectively consume excess cytoplasmic NADH, prevent the conversion of acetaldehyde to ethanol, ensure the supply of precursor acetaldehyde, and effectively increase the yield of 2-deoxy-D-ribose.

[0025] In some embodiments, the DERA and sugar phosphorylase are enzymes derived from *E. coli*. DERA and sugar phosphorylase are naturally present in *E. coli*, but in very low amounts, making it difficult to achieve the generation and removal of 2-deoxy-D-ribose-5-phosphate. This invention, by overexpressing the deoC and yfbT genes in *E. coli*, enables the production of sufficient DERA and sugar phosphorylase, ensuring the successful generation of 2-deoxy-D-ribose-5-phosphate and converting all 2-deoxy-D-ribose-5-phosphate to 2-deoxy-D-ribose.

[0026] Further, the nucleotide sequence of deoC is shown in SEQ ID NO.1, the nucleotide sequence of yfbT is shown in SEQ ID NO.2, the nucleotide sequence of nox is shown in SEQ ID NO.3, and the nucleotide sequence of PDC is shown in SEQ ID NO.4.

[0027] Further, the exogenous genes include deoC and yfbT; or the exogenous genes include deoC, yfbT and PDC; or the exogenous genes include deoC, yfbT, nox and PDC.

[0028] On the other hand, the present invention provides a method for constructing an engineered bacterium that produces 2-deoxy-D-ribose, wherein the method overexpresses a foreign gene in a host bacterium, the foreign gene being capable of expressing an enzyme related to the synthesis of 2-deoxy-D-ribose, the foreign gene including any one or more of deoC, yfbT, nox, and PDC; the nucleotide sequences of deoC, yfbT, nox, and PDC are shown in SEQ ID NO. 1~4, respectively.

[0029] Furthermore, the method includes the following steps:

[0030] (1) Construct an overexpression plasmid for yfbT+deoC, and / or construct an overexpression plasmid for nox+PDC;

[0031] (2) Transform the overexpression plasmids of yfbT+deoC and / or nox+PDC into the host bacteria.

[0032] In some methods, step (1) is to construct an overexpression plasmid of yfbT+deoC and an overexpression plasmid of nox+PDC; step (2) is to transform the overexpression plasmid of yfbT+deoC and the overexpression plasmid of nox+PDC into the host bacteria.

[0033] This invention demonstrates that overexpression plasmids of yfbT+deoC, or both yfbT+deoC and nox+PDC, can be used to construct engineered bacteria that produce 2-deoxy-D-ribose. The most preferred method is the combination of yfbT+deoC and nox+PDC overexpression plasmids. After this plasmid combination is introduced into the host bacteria, no precursor acetaldehyde or Gap-3P needs to be added; the constructed engineered bacteria can autonomously and efficiently synthesize 2-deoxy-D-ribose using glucose.

[0034] In another aspect, the present invention provides a method for preparing 2-deoxy-D-ribose, wherein the method is obtained by fermentation with engineered bacteria as described above.

[0035] Furthermore, the exogenous genes of the engineered bacteria can express deoC, yfbT, nox and PDC, and the fermentation medium of the engineered bacteria does not require the addition of acetaldehyde or D-glyceraldehyde-3-phosphate as a substrate.

[0036] Furthermore, the fermentation medium for the engineered bacteria includes ampicillin and / or kanamycin; and IPTG (isopropyl-β-D-thiogalactoside) is added during fermentation.

[0037] The plasmids of engineered bacteria carry ampicillin and / or kanamycin resistance genes. Ampicillin and / or kanamycin are added to the fermentation medium to maintain the plasmids in the engineered bacteria, so that only bacteria containing the plasmids can survive and grow, and to prevent the plasmids from being lost during cell division.

[0038] IPTG acts as an inducer to initiate or significantly enhance the expression of exogenous genes in E. coli. IPTG binds to repressor proteins like lactose, but with a stronger and more stable binding affinity, and is not metabolized by bacteria. Therefore, it can continuously and strongly keep the gene expression switch "on".

[0039] In some methods, the fermentation of the engineered bacteria is carried out as follows:

[0040] (1) Pick a single colony of the above-mentioned 2-deoxy-D-ribose genetically engineered bacteria and inoculate it into a test tube containing LB culture medium, add ampicillin sulfate to a final concentration of 50 μg / ml, and incubate overnight at 30°C and 220 rpm; then inoculate 1% into a shake flask containing 20 ml of fermentation broth, incubate at 37°C and 220 rpm for four hours, add IPTG to a final concentration of 50 μg / ml, and then place the shake flask in a fermentation culture at 30°C and 220 rpm to produce 2-deoxy-D-ribose.

[0041] In some methods, the LB culture medium consists of: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride. The fermentation medium consists of: 6 g / L glucose, 2.5 g / L Na2HPO4, 1 g / L KH2PO4, 0.2 g / L NaCl, 0.4 g / L NH4Cl, 0.2 g / L MgSO4, 0.5 g / L CaCl2, 0.005 g / L FeSO4·7H2O, pH 7.0, with 50 mg / L ampicillin added.

[0042] In some methods, the pH of the culture medium is adjusted to 7.0 using ammonia water containing 13 mol / L of ammonia during fermentation, the fermentation temperature is maintained at 37℃ from 0 to 3 hours, IPTG is added at the 3rd hour of fermentation to a final concentration of 50 μg / ml, and the fermentation temperature is adjusted to 30℃. Glucose is fed in at a final concentration of about 0.1%, and the aeration during fermentation is set to 1.0 vvm. Dissolved oxygen is controlled at 30%-40% by linking the stirring speed and dissolved oxygen. The fermentation cycle is 72 hours.

[0043] In another aspect, the present invention provides the use of a gene combination for constructing engineered bacteria for fermentation to produce 2-deoxy-D-ribose, the gene combination including deoC, yfbT, nox and PDC; the culture medium for fermentation of the engineered bacteria does not require the addition of acetaldehyde or D-glyceraldehyde-3-phosphate as a substrate.

[0044] The beneficial effects of this invention are as follows:

[0045] 1. By overexpressing DERA, sugar phosphatase, NADH oxidase and pyruvate decarboxylase in the host bacteria using genetic engineering technology, a 2-deoxy-D-ribose-producing genetically engineered bacterium was successfully constructed. It can synthesize 2-deoxy-D-ribose autonomously through fermentation using only glucose as the culture medium, without the need to add acetaldehyde or D-glyceraldehyde-3-phosphate as a substrate.

[0046] 2. The preparation process is simple, efficient, low-cost, and has broad application prospects, laying the foundation for the green production of 2-deoxy-D-ribose and opening a new chapter in the production process of 2-deoxy-D-ribose. Attached Figure Description

[0047] Figure 1 This is a schematic diagram of the biosynthetic pathway of 2-deoxy-D-ribose.

[0048] Figure 2 The chemical structure of 2-deoxy-D-ribose is given. Detailed Implementation

[0049] The present invention will be further described in detail below with reference to embodiments. It should be noted that the embodiments described below are intended to facilitate understanding of the present invention and are not intended to limit it in any way. In this embodiment, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0050] Example 1: Construction of engineered bacteria expressing yfbT+deoC

[0051] This embodiment constructs an overexpression plasmid of the gene yfbT+deoC and transforms it into Escherichia coli BL-21 to obtain an engineered bacterium expressing yfbT+deoC. The main process is as follows:

[0052] 1. Overexpression plasmid of gene yfbT

[0053] The *E. coli* yfbT gene (gene sequence shown in SEQ ID No. 2, protein sequence) was amplified using primers YfbT-F and YfbT-R. The fragment was recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with NdeI and BglII, and then cloned into the NdeI and BglII restriction sites of pETDuet-1. The cloned plasmid was named pZH726. The primer sequences are as follows:

[0054] SEQ ID No 5: YfbT-F: gtacatatgcggtgcaaaggttttct

[0055] SEQ ID No 6: YfbT-R: catagatcttcactgaataataacatcgc

[0056] 2. Construct an overexpression plasmid for the gene yfbT+deoC.

[0057] The *E. coli* deoC gene (gene sequence shown in SEQ ID No. 1) was amplified using primers deoC-F and deoC-R, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with BglII and XhoI, and then cloned into the BglII and XhoI restriction sites of pZH726. The cloned plasmid was named pZH727. The primer sequences are as follows:

[0058] SEQ ID No 7: deoC-F: atagatctaaaggaggatatacatatgactgatctgaaagca

[0059] SEQ ID No 8: deoC-R: ggtctcgagttagtagctgctggcgct

[0060] 3. Overexpressing plasmid pZH727 in Escherichia coli BL-21

[0061] Plasmid pZH727 was transformed into Escherichia coli BL-21, plated on ampicillin plates, and incubated overnight at 37°C. Single colonies were then picked for sequencing verification (to verify whether yfbT+deoC could be expressed). The verified genetically engineered bacteria (single colony) were inoculated into a test tube containing 100 ml of LB medium, with ampicillin added to a final concentration of 50 μg / ml. The mixture was incubated overnight at 30°C and 220 rpm. Then, seed culture was inoculated into a shake flask containing 20 ml of fermentation broth at a 1% inoculation rate, with ampicillin added to a final concentration of 50 μg / ml. The mixture was incubated at 30°C and 220 rpm for 4 hours. IPTG was added to a final concentration of 50 μg / ml, and acetaldehyde was added to a final concentration of 0.2%. The mixture was then incubated at 30°C and 220 rpm for another 24 hours.

[0062] In this embodiment, the preferred composition of the LB culture medium is: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride. The fermentation medium composition is: 6 g / L glucose, 2.5 g / L Na2HPO4, 1 g / L KH2PO4, 0.2 g / L NaCl, 0.4 g / L NH4Cl, 0.2 g / L MgSO4, 0.5 g / L CaCl2, 0.005 g / L FeSO4·7H2O, pH 7.0. Additionally, 50 mg / L ampicillin and acetaldehyde are added to the medium to a final concentration of 0.2%.

[0063] Example 2: Construction of engineered bacteria expressing yfbT+deoC+nox+PDC

[0064] This embodiment constructs overexpression plasmids for the genes yfbT+deoC and nox+PDC, and transforms them into Escherichia coli BL-21 to obtain engineered bacteria expressing yfbT+deoC+nox+PDC. The main process is as follows:

[0065] 1. Overexpression plasmid of gene yfbT

[0066] The *E. coli* yfbT gene (gene sequence shown in SEQ ID No. 2, protein sequence) was amplified using primers YfbT-F and YfbT-R. The fragment was recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with NdeI and BglII, and then cloned into the NdeI and BglII restriction sites of pETDuet-1. The cloned plasmid was named pZH726. The primer sequences are as follows:

[0067] SEQ ID No 5: YfbT-F: gtacatatgcggtgcaaaggttttct

[0068] SEQ ID No 6: YfbT-R: catagatcttcactgaataataacatcgc

[0069] 2. Construct an overexpression plasmid for the gene yfbT+deoC.

[0070] The *E. coli* deoC gene (gene sequence shown in SEQ ID No. 1) was amplified using primers deoC-F and deoC-R, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with BglII and XhoI, and then cloned into the BglII and XhoI restriction sites of pZH726. The cloned plasmid was named pZH727. The primer sequences are as follows:

[0071] SEQ ID No 7: deoC-F: atagatctaaaggaggatatacatatgactgatctgaaagca

[0072] SEQ ID No 8: deoC-R: ggtctcgagttagtagctgctggcgct

[0073] 3. Construct an overexpression plasmid for the gene nox.

[0074] The nox gene (gene sequence shown in SEQ ID No 3) derived from Lactococcus lactis subsp. cremoris, after codon optimization, was synthesized by GenScript and cloned into the NdeI and BglII sites of pRSFDuet-1 to obtain plasmid pZH758.

[0075] 4. Construct an overexpression plasmid for the gene nox+PDC

[0076] The codon-optimized PDC gene from Zymomonas mobilis (gene sequence shown in SEQ ID No. 4) was synthesized by GenScript and cloned into the BglII and XhoI sites of pZH758 to obtain plasmid pZH759.

[0077] 5. Co-expression of plasmids pZH727 and pZH759 in Escherichia coli BL-21

[0078] Plasmids pZH727 and pZH759 were co-transformed into E. coli BL-21 and plated on ampicillin and kanamycin-protected plates. After incubation at 37°C overnight, single colonies were picked for sequencing verification (to verify whether they could express yfbT+deoC+nox+PDC). The verified genetically engineered bacteria (single colonies) were inoculated into test tubes containing 100 ml of LB medium, with ampicillin and kanamycin added to a final concentration of 50 μg / ml. The mixture was incubated overnight at 30°C and 220 rpm. Then, seed culture was inoculated into shake flasks containing 20 ml of fermentation broth at a 1% inoculation rate. After incubation at 37°C and 220 rpm for 4 hours, IPTG was added to a final concentration of 50 μg / ml, and the mixture was incubated at 30°C and 220 rpm for another 24 hours.

[0079] In this embodiment, the preferred composition of the LB culture medium is: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride. The fermentation medium composition is: 6 g / L glucose, 2.5 g / L Na2HPO4, 1 g / L KH2PO4, 0.2 g / L NaCl, 0.4 g / L NH4Cl, 0.2 g / L MgSO4, 0.5 g / L CaCl2, 0.005 g / L FeSO4·7H2O, pH 7.0. Additionally, 50 mg / L each of ampicillin and kanamycin are added to the medium.

[0080] Example 3: HPLC detection of 2-deoxy-D-ribose in fermentation broth

[0081] Take 1 ml of the fermentation broth obtained from Examples 1 and 2 after 24 h of further cultivation, centrifuge at 12000 rpm for 10 minutes, filter the supernatant, and perform HPLC analysis on the filtrate to determine the 2-deoxy-D-ribose content. The detection method is as follows: mobile phase: a mixture of acetonitrile, pure water, and trifluoroacetic acid (950:50:3); detector: differential refractive index detector; column: Zorbax NH3 (4.6 mm x 250 mm) 5 u; flow rate: 0.7 mL / min; injection volume: 50 μL; run time: 25 minutes. The detection results are shown in Table 1.

[0082] Table 1. 2-Deoxy-D-ribose content in fermentation broth of engineered bacteria

[0083]

[0084] As shown in Table 1, co-expression of deoC and yfbT (Example 1) resulted in the overexpression of 2-deoxy-D-ribose-5-phosphate aldolase (DERA) and glycophosphatase, respectively. DERA converts acetaldehyde (the substrate added to the fermentation medium) and Gap-3P produced by microbial glycolysis into 2-deoxy-D-ribose-5-phosphate. This 2-deoxy-D-ribose-5-phosphate then loses its phosphate group under the action of glycophosphatase, forming the target product 2-deoxy-D-ribose. Although the yield reached 5 g / L, the inability to produce acetaldehyde autonomously necessitates the addition of acetaldehyde to the fermentation medium, thus failing to achieve truly autonomous fermentation production of 2-deoxy-D-ribose.

[0085] Co-expression of deoC, yfbT, PDC, and nox (Example 2) enables the overexpression of four enzymes: DERA, glycophosphatase, pyruvate decarboxylase, and NADH oxidase. Pyruvate produced by *E. coli* glycolysis is converted to acetaldehyde under the catalysis of pyruvate decarboxylase. 2-deoxy-D-ribose-5-phosphate aldolase then converts acetaldehyde and glyceraldehyde-3-phosphate to 2-deoxy-D-ribose-5-phosphate. This 2-deoxy-D-ribose-5-phosphate is then dephosphated by glycophosphatase to form the target product, 2-deoxy-D-ribose. Simultaneously, NADH oxidase can oxidize and reduce excess NADH, preventing NADH from reducing the precursor acetaldehyde to ethanol via endogenous alcohol dehydrogenase. Compared to Example 1, Example 2 eliminates the need for additional acetaldehyde addition to the culture medium, achieving truly autonomous fermentation production of 2-deoxy-D-ribose. Although its 2-deoxy-D-ribose yield was lower than that of Example 1, the reason may be that the dual inhibition by two antibiotics, ampicillin and kanamycin, increased the fermentation difficulty. In the future, the yield of 2-deoxy-D-ribose produced by completely autonomous fermentation can be increased by optimizing the fermentation conditions.

[0086] Example 4: Optimization of Fermentation Conditions

[0087] In this embodiment, the engineered bacteria constructed in Examples 1 and 2 and the corresponding fermentation methods were used to produce 2-deoxy-D-ribose. Seed culture was inoculated at 1% and 10% of the culture volume, respectively, into 20 ml of fermentation broth for fermentation. The content of 2-deoxy-D-ribose in the fermentation broth was detected after 24 hours of further cultivation, following the method provided in Example 3. The results are shown in Table 2.

[0088] Table 2. 2-Deoxy-D-ribose content in fermentation broth of engineered bacteria

[0089]

[0090] As can be seen from Table 2, the engineered bacteria constructed using Example 2 can significantly increase the yield of 2-deoxy-D-ribose by increasing the inoculum amount. However, the engineered bacteria constructed using Example 1 cannot effectively increase the yield of 2-deoxy-D-ribose simply by increasing the inoculum amount due to the limitation of the substrate acetaldehyde content.

[0091] Example 5: Production of 2-deoxy-D-ribose by large-scale fermentation of engineered bacteria in a fermenter

[0092] This embodiment uses the engineered bacteria constructed in Example 2. Fermentation was carried out according to the fermentation method provided in Example 2, and the following fermentation method was also used: Single colonies that were correctly sequenced were picked and inoculated into seed culture medium, and cultured at 36℃ and 250rpm for 15h to obtain seed liquid. Then, according to a 10% inoculation amount (increasing the inoculation amount), 1L of seed liquid was taken into the fermentation culture medium, and the total volume of the culture medium after inoculation was 10L. The formula (g / L) of the fermentation culture medium is as follows: 6 g / L glucose, 2.5 g / L Na2HPO4, 1 g / L KH2PO4, 0.2 g / L NaCl, 0.4 g / L NH4Cl, 0.2 g / L MgSO4, 0.5 g / L CaCl2, 0.005 g / L FeSO4·7H2O, pH 7.0. In addition, 50 mg / L each of ampicillin and kanamycin were added to the culture medium. Fermentation temperature was maintained at 37℃ for 0-3 hours. IPTG was added at the 3rd hour of fermentation to a final concentration of 50 μg / ml, while the fermentation temperature was adjusted to 30℃. Glucose was fed in continuously to a final concentration of approximately 0.1%. Aeration was set at 1.0 vvm during fermentation, and dissolved oxygen was controlled at 30%-40% by linking stirring speed and dissolved oxygen levels. The fermentation cycle was 72 hours. HPLC analysis of the fermentation broth showed a final 2-deoxy-D-ribose yield of 5 g / L.

[0093] Example 7: Engineered bacteria for constructing the nox gene from different sources

[0094] This embodiment uses the method provided in Example 2 to construct engineered bacteria. The nox gene of the NADH oxidase is derived from the following four sources: 1. Aqueous NADH oxidase from *Lactococcus lactis* subsp. *cremoris* (Example 2); 2. Aqueous NADH oxidase from *Streptococcus pyogenes*; 3. Aqueous NADH oxidase from *Thermus thermophilus*; 4. Aqueous NADH oxidase from *Saccharomyces cerevisiae*. The four engineered bacteria were fermented according to the method provided in Example 2, using a 10% inoculum. The content of 2-deoxy-D-ribose in the fermentation broth after 24 hours of further cultivation was measured. The results are shown in Table 3.

[0095] Table 3. 2-Deoxy-D-ribose content in fermentation broths of four engineered bacteria

[0096]

[0097] As shown in Table 3, the nox genes of NADH oxidase from different sources can all be used to construct engineered bacteria for the fermentation production of 2-deoxy-D-ribose. However, the engineered bacteria constructed from nox genes from different sources exhibit varying abilities to produce 2-deoxy-D-ribose. It is preferable to use the nox gene of the aqueous NADH oxidase from *Lactococcus lactis* subsp. cremoris to construct engineered bacteria, as this helps to improve the fermentation yield of 2-deoxy-D-ribose.

[0098] Example 8: PDC gene-engineered bacteria from different sources

[0099] This embodiment uses the method provided in Example 2 to construct engineered bacteria. The PDC gene for pyruvate decarboxylase is derived from the following four sources: 1. Zymomonas mobilis (Example 2); 2. Saccharomyces cerevisiae; 3. Rice; 4. Acetobacter pasteurianus; 5. Sarcina ventriculi. The four engineered bacteria were constructed according to the method provided in Example 2, and fermented with seed culture at a 10% inoculum. The content of 2-deoxy-D-ribose in the fermentation broth obtained after 24 hours of further cultivation was measured. The detection results are shown in Table 4.

[0100] Table 4. 2-Deoxy-D-ribose content in fermentation broths of five engineered bacteria

[0101]

[0102] As shown in Table 4, PDC genes from different sources can be used to construct engineered bacteria for the fermentation and production of 2-deoxy-D-ribose. However, the ability of engineered bacteria constructed from PDC genes from different sources to produce 2-deoxy-D-ribose varies. It is preferable to use PDC genes from Zymomonas mobilis to construct engineered bacteria, as this helps to improve the fermentation yield of 2-deoxy-D-ribose.

[0103] The above embodiments of the present invention are merely illustrative examples and are not intended to limit the implementation of the invention. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. However, obvious variations or modifications derived from the essential spirit of the present invention still fall within the scope of protection of the present invention.

Claims

1. An engineered bacterium producing 2-deoxy-D-ribose, characterized in that, The engineered bacteria carry a foreign gene that can express an enzyme related to the synthesis of 2-deoxy-D-ribose, the enzyme including any one or more of 2-deoxy-D-ribose 5-phosphate aldolase, glycophosphatase, NADH oxidase, and pyruvate decarboxylase.

2. The engineered bacteria as described in claim 1, characterized in that, The gene for synthesizing 2-deoxy-d-ribose-5-phosphate aldolase is deoC, the gene for synthesizing sugar phosphatase is yfbT, the gene for synthesizing NADH oxidase is nox, and the gene for synthesizing pyruvate decarboxylase is PDC.

3. The engineered bacteria as described in claim 2, characterized in that, The nucleotide sequence of deoC is shown in SEQ ID NO.1, the nucleotide sequence of yfbT is shown in SEQ ID NO.2, the nucleotide sequence of nox is shown in SEQ ID NO.3, and the nucleotide sequence of PDC is shown in SEQ ID NO.

4.

4. The engineered bacteria as described in claim 3, characterized in that, The exogenous genes include deoC and yfbT, or deoC, yfbT and PDC, or deoC, yfbT, nox and PDC.

5. A method for constructing an engineered bacterium producing 2-deoxy-D-ribose, characterized in that, Overexpression of a foreign gene in a host bacterium, wherein the foreign gene is capable of expressing an enzyme related to the synthesis of 2-deoxy-D-ribose, and the foreign gene includes any one or more of deoC, yfbT, nox, and PDC; the nucleotide sequences of deoC, yfbT, nox, and PDC are shown in SEQ ID NO. 1-4, respectively.

6. The construction method as described in claim 5, characterized in that, Includes the following steps: (1) Construct an overexpression plasmid for yfbT+deoC, and / or construct an overexpression plasmid for nox+PDC; (2) Transform the overexpression plasmids of yfbT+deoC and / or nox+PDC into the host bacteria.

7. A method for preparing 2-deoxy-D-ribose, characterized in that, It is prepared by fermentation using engineered bacteria as described in any one of claims 1 to 4.

8. The preparation method according to claim 7, characterized in that, The exogenous genes of the engineered bacteria can express deoC, yfbT, nox and PDC, and the fermentation medium of the engineered bacteria does not require the addition of acetaldehyde or D-glyceraldehyde-3-phosphate as substrate.

9. The preparation method according to claim 8, characterized in that, The fermentation medium for the engineered bacteria includes ampicillin and / or kanamycin; and IPTG is added during the fermentation process.

10. The use of a gene combination for constructing engineered bacteria for fermentation production of 2-deoxy-D-ribose, characterized in that, The gene combination includes deoC, yfbT, nox, and PDC; the culture medium for fermentation by the engineered bacteria does not require the addition of acetaldehyde or D-glyceraldehyde-3-phosphate as a substrate.

Images