Method for inhibiting replication of rice stripe virus by miR-971-3p

By increasing the expression level of miR-971-3p in rice and utilizing its antiviral function in insects, gene-edited rice was constructed, solving the replication problem of rice stripe virus, significantly reducing virus proliferation and morbidity, and providing antiviral rice germplasm resources.

CN121427971BActive Publication Date: 2026-06-16INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF ZOOLOGY CHINESE ACAD OF SCI
Filing Date
2025-06-03
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Rice stripe virus (RSV) infection in rice is difficult to effectively suppress, leading to yield and quality losses. Current technologies have not been able to explore the regulatory mechanism of insect C3PO complex in the miRNA pathway.

Method used

By increasing the expression level of miRNA genes in rice, especially miR-971-3p, and utilizing its antiviral effects in insects, we constructed overexpressed gene-edited rice to inhibit RSV replication.

Benefits of technology

It significantly reduced RSV proliferation and incidence, provided antiviral rice germplasm resources, and demonstrated the application potential of miR-971-3p in plant disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a method for inhibiting replication of rice stripe virus by using miR-971-3p, and belongs to the technical field of biology. The miRNA is a miRNA as shown in A1) or A2): A1) a single-stranded RNA molecule with a nucleotide sequence of SEQ ID NO:1; A2) a miRNA with more than 90% identity with the RNA molecule shown in A1) and related to the resistance of plants to rice stripe virus, and obtained by substitution, deletion and / or addition of nucleotides on the nucleotide sequence shown in SEQ ID NO:1. The application proves by experiments that the content of rice stripe virus in the rice overexpressing the aforementioned miRNA is significantly lower than that in the wild type, the grain length, plant height and 1000-grain weight of the rice overexpressing the aforementioned miRNA are basically the same as those of the wild type, and the 1000-grain weight is slightly increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for inhibiting the replication of rice stripe virus using miR-971-3p. Background Technology

[0002] Plant virus infections are difficult to prevent and cause irreparable damage to plants, leading to a significant reduction in crop yields worldwide. Plant virus infections inhibit plant growth and development, resulting in various symptoms such as color changes, deformities, localized necrosis, and even systemic death (1). Rice is one of the world's main staple foods. As a food consumed directly, about 92% of the world's rice is produced in Asia, providing about 36% of the total human energy consumption, accounting for 20% of the global total (2). A major obstacle to global rice production is the continuous loss of crops caused by plant diseases, including rice blast, sheath blight, bacterial wilt, and especially various vector-borne rice viral diseases (3). Rice stripevirus (RSV) is considered to seriously affect rice yield and quality, causing huge losses to the agricultural economy. Therefore, continuous monitoring and control of RSV, and the cultivation of disease-resistant rice varieties are of great significance for ensuring the stable and sustainable development of rice production in Southeast Asia.

[0003] Rice stripe virus requires the vector insect, the planthopper, for transmission (4). Viruses are a huge burden for the organisms that use them. As intracellular pathogens, viruses are closely related to the host cell, hijacking the host's organelles and resources to replicate. Insects have also evolved a series of resistance pathways when pathogens invade. However, since insects do not have acquired immunity, the innate immune system plays a major role when pathogens infect them. RNA interference (RNAi) is generally considered to be the main antiviral pathway in insects. The three main small RNA (sRNA)-guided RNA silencing pathways in insects are siRNA, microRNA (miRNA), and piwi-interacting RNA (piRNA) pathways (5). In insects, the siRNA pathway is the main antiviral pathway (6). miRNAs are important participants in insect-pathogen interactions. When pathogens infect, the miRNAs produced by insects respond to viral infection and further regulate downstream genes to help insects suppress viral replication (7-9).

[0004] Besides key components such as Drosha, Pasha, Dicer, and Argonaute (Ago), the C3PO complex also plays an important regulatory role in the RNAi pathway (10). This complex is composed of Translin and Translin-associated factor X (Trax) in a 6:2 ratio, exhibiting an asymmetric octamer barrel structure (11). Translin is a DNA / RNA binding protein, while Trax is responsible for endonuclease activity (12). Trax is unstable when Translin is absent. C3PO participates in the processing of microRNA (miRNA) and small interfering RNA (siRNA) and performs different functions. C3PO promotes RISC activation by removing cleavage products of siRNA passenger chains, while enhancing RISC-mediated target cleavage (10). In contrast, C3PO inhibits miRNA production by cleaving mismatched protrusions and degrading pre-miRNA (13). However, whether the virus regulates the C3PO complex and the regulatory mechanism remain unclear.

[0005] References:

[0006] Q. Chen, T. Wei, Cell Biology During Infection of Plant Viruses inInsect Vectors and Plant Hosts. Molecular Plant-Microbe Interactions® 33,18-25 (2020).2. H. Hibino, Biology and epidemiology of Rice virus AnnualReview of Phytopathology 34, 249-274 (1996).

[0007] 3. P. Wang, J. Liu, Y. Lyu, Z. Huang, X. Zhang, B. Sun, P. Li, X.Jing, H. Li, C. Zhang, A Review of Vector-Borne Rice Viruses. Viruses 14, (2022).

[0008] 4. E. Fiallo-Olivé, L.-L. Pan, S.-S. Liu, J. Navas-Castillo,Transmission of Begomoviruses and Other Whitefly-Borne Viruses: Dependence onthe Vector Species. Phytopathology® 110, 10-17 (2020).

[0009] 5.B. C. Bonning, M.-C. Saleh, The Interplay Between Viruses and RNAiPathways in Insects. Annual Review of Entomology 66, 61-79 (2021).

[0010] 6. S.-W. Ding, RNA-based antiviral immunity. Nature ReviewsImmunology 10, 632-644 (2010).

[0011] 7. Z.-X. Chang, N. Tang, L. Wang, L.-Q. Zhang, I. A. Akinyemi, Q.-F.Wu, Identification and characterization of microRNAs in the white-backedplanthopper,Sogatella furcifera. Insect Science 23, 452-468 (2016).

[0012] 8. P. Wu, X. Jiang, Q. Sang, E. Annan, T. Cheng, X. Guo, Inhibitionof miR-274-3p increases BmCPV replication by regulating the expression ofBmCPV NS5 gene in Bombyx mori. Virus Genes 53, 643-649 (2017).

[0013] 9. Mazhar Hussain, Twyla Bradshaw, Morris Lee , S. Asgari, TheInvolvement of Atlastin in Dengue Virus and Wolbachia Infection in Aedesaegypti and Its Regulation by aae-miR-989. Microbiol Spectr 10, e0225822(2022).

[0014] 10. Y. Liu, X. Ye, F. Jiang, C. Liang, D. Chen, J. Peng, L. N. Kinch,N. V. Grishin, Q. Liu, C3PO, an Endoribonuclease That Promotes RNAi byFacilitating RISC Activation. Science 325, 750-753 (2009).

[0015] 11. X. Ye, N. Huang, Y. Liu, Z. Paroo, C. Huerta, P. Li, S. Chen, Q.Liu, H. Zhang, Structure of C3PO and mechanism of human RISC activation.Nature Structural&Molecular Biology 18, 650-657 (2011).

[0016] 12. Y. Tian, D. K. Simanshu, M. Ascano, R. Diaz-Avalos, A. Y. Park,S. A. Juranek, W. J. Rice, Q. Yin, C. V. Robinson, T. Tuschl, D. J. Patel,Multimeric assembly and biochemical characterization of the Trax–translinendonuclease complex. Nature Structural&Molecular Biology 18, 658-664 (2011).

[0017] 13. K. Asada, E. Canestrari, X. Fu, Z. Li, E. Makowski, Y.-C. Wu, Jeffrey K. Mito, DavidG. Kirsch, J. Baraban, Z. Paroo, Rescuing dicer Defectsvia Inhibition of an Anti-Dicing Nuclease. Cell Rep 9, 1471-1481 (2014). Summary of the Invention

[0018] The technical problem to be solved by this invention is to provide a method for inhibiting rice virus replication using insect-derived miRNA. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0019] Previous work by the inventors revealed that RSV infection of the planthopper had no effect on the transcriptional levels of key members of the miRNA and siRNA pathways, such as Drosha, Pasha, Dicer1 / 2, Ago1 / 2, Translin, and Trax. Protein immunoprecipitation showed that RSV's RdRp can bind to Translin, and gene interference experiments showed that reducing Translin expression was detrimental to RSV replication. These findings suggest that RSV may regulate the function of the C3PO complex in the miRNA pathway, but this hypothesis has not yet been explored in depth.

[0020] Therefore, this study used rice-planthopper-RSV as the research object to investigate the regulatory role of C3PO-regulated miRNA on virus proliferation. Based on the research results, gene-edited rice with miRNA overexpression was constructed and its antiviral activity was tested, providing potential rice germplasm resources for the prevention and control of RSV.

[0021] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0022] This invention provides a method for inhibiting the replication of rice stripe virus using miRNA, characterized by the following steps: increasing the expression level of miRNA genes in the target plant to inhibit the replication of rice stripe virus in the target plant species;

[0023] The miRNA is as shown in A1) or A2):

[0024] A1) A single-stranded RNA molecule with the nucleotide sequence of SEQ ID NO:1;

[0025] A2) miRNAs obtained by substituting and / or deleting and / or adding nucleotides to the nucleotide sequence shown in SEQ ID NO:1, which have more than 90% identity with the RNA molecule shown in A1) and are associated with plant resistance to rice stripe virus.

[0026] The above-mentioned miRNAs can be synthesized artificially, or they can be obtained by first synthesizing the DNA encoding their precursors and then expressing them biologically.

[0027] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0028] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0029] This invention provides a method for cultivating plants with enhanced resistance to rice stripe virus, comprising increasing the expression level of the aforementioned miRNA gene in a recipient plant to obtain a plant with enhanced resistance to rice stripe virus; the plant with enhanced resistance to rice stripe virus exhibits higher resistance to rice stripe virus than the recipient plant. The plant with enhanced resistance to rice stripe virus is also a plant resistant to rice stripe virus.

[0030] Furthermore, in the above method, the increase in the content of the aforementioned miRNA in the recipient plant is achieved by introducing the nucleic acid molecule of the miRNA into the recipient plant.

[0031] The gene encoding the miRNA precursor can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0032] In the above method, the plant with enhanced resistance to rice stripe virus can be understood as a transgenic plant.

[0033] In the above method, the transgenic plant is understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plant includes seeds, callus tissue, complete plants, and cells.

[0034] Furthermore, in the above method, the plant is any of the following:

[0035] G1) Monocotyledonous or dicotyledonous plants;

[0036] G2) Plants of the order Poales;

[0037] G3) Gramineae plants;

[0038] G4) Oryza genus;

[0039] G5) Rice.

[0040] Furthermore, in the above method, the nucleic acid molecule is a DNA molecule with the nucleotide sequence SEQ ID NO:2.

[0041] The present invention also provides the application of the aforementioned miRNA or a substance regulating the expression of said miRNA, wherein the application is any one of the following:

[0042] H1) The application of miRNA or substances that regulate miRNA expression in regulating plant resistance to rice stripe virus;

[0043] H2) Application of miRNA or substances that regulate miRNA expression in the preparation of products that regulate plant resistance to rice stripe virus;

[0044] Application of H3 miRNA or substances that regulate miRNA expression in plant breeding.

[0045] The above regulation can be to upregulate or enhance or increase the expression of the coding gene of the miRNA or the content or activity of the miRNA in the plant, or it can be to downregulate or inhibit or reduce the expression of the coding gene of the miRNA or the content or activity of the miRNA in the plant.

[0046] The above-mentioned regulation of plant resistance to rice stripe virus can either upregulate, enhance, or increase plant resistance to rice stripe virus, or downregulate, inhibit, or reduce plant resistance to rice stripe virus.

[0047] The plant breeding can be for cultivating plants with upregulated, enhanced, or increased resistance to rice stripe virus, or for cultivating plants with downregulated, suppressed, or reduced resistance to rice stripe virus.

[0048] Furthermore, in the above applications, regulating plant resistance to rice stripe virus means improving plant resistance to rice stripe virus.

[0049] Furthermore, in the above applications, the substance is a substance that promotes the expression of the miRNA in plants.

[0050] Furthermore, in the above applications, the substances are all one of the following:

[0051] B1) Nucleic acid molecules that produce the aforementioned miRNA;

[0052] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0053] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0054] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0055] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0056] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0057] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2).

[0058] B8) RNA molecules that inhibit the expression of the gene encoding the protein described in GenBank No. RZF45907.1 (18-JUN-2019, https: / / www.ncbi.nlm.nih.gov / protein / RZF45907.1 / ), or RNA molecules that inhibit, reduce, or downregulate the activity or content of the protein, the gene encoding the RNA molecule, an expression cassette containing the gene, a recombinant vector containing the gene, or a recombinant vector containing the expression cassette, a recombinant microorganism containing the gene, or a recombinant microorganism containing the expression cassette, or a recombinant microorganism containing the recombinant vector.

[0059] B1) The nucleic acid molecule is a DNA molecule, which can be transcribed into the precursor of the miRNA and then processed to form the miRNA.

[0060] Furthermore, in the above applications, the nucleic acid molecule described in B1) is a DNA molecule with the nucleotide sequence SEQ ID No. 2.

[0061] In the aforementioned biological materials, the expression cassette containing nucleic acid molecules described in B2) refers to a DNA molecule capable of expressing the miRNA encoded in the above applications within a host cell. This DNA molecule may include not only promoters that initiate gene expression but also terminators that terminate gene expression. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1)). 0099169.7)), seed-specific promoters for storage proteins (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0062] Recombinant expression vectors containing the encoding gene expression cassettes can be constructed using existing plant expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the carmine synthase gene Nos) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed. This can involve adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as the nptII gene for resistance to kanamycin and related antibiotics, the bar gene for resistance to the herbicide phosphinic acid, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methatrexate, and the EPSPS gene for resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0063] In the aforementioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0064] The aforementioned miRNAs or substances also fall within the scope of protection of this invention.

[0065] This invention experimentally demonstrates that the miRNA miR-971-3p provided by this invention not only proves that C3PO regulates the expression of miR-971-3p in the planthopper, but also reveals that miR-971-3p plays an antiviral role in insects. Based on these results, gene-edited rice overexpressing miR-971-3p was prepared, and it was found that this gene-edited rice significantly reduced RSV proliferation and significantly reduced the incidence of RSV in rice. Therefore, overexpression of miR-971-3p has good application potential in plant disease resistance. Thus, this application not only demonstrates for the first time that C3PO-regulated miR-971-3p inhibits RSV replication in the planthopper, but also provides a method for obtaining pathogen-resistant plants. Attached Figure Description

[0066] Figure 1 For injection dsGFP and injection dsTranslin Changes in miR-971-3p expression among planthoppers were analyzed using a t-test. P <0.05.

[0067] Figure 2 To inhibit RSV replication in the planthopper using miR-971-3p. (A) Fold change in RNA levels of miR-971-3p and RSV NP in planthoppers 6 days after injection of miR-971-3p agonist compared to injection of Negative Control (NC) agonist. (B) Western blot analysis of RSV NP protein levels in sample (A) using an anti-NP monoclonal antibody. (C) Fold change in RNA levels of miR-971-3p and RSV NP in planthoppers 6 days after injection of miR-971-3p antagonist compared to injection of NC antagonist. (D) Western blot analysis of RSV NP protein levels in sample (C) using an anti-NP monoclonal antibody. For (B) and (D), tubulin was measured using an anti-tubulin monoclonal antibody as an internal control. Gray values ​​represent the relative optical density of NP relative to tubulin. NC, negative control. A t-test was used for comparison. * P <0.05; ***, P <0.001.

[0068] Figure 3To investigate the role of miR-971-3p in inhibiting RSV replication and disease incidence in rice. (A) Relative expression levels of miR-971-3p in T1 generation transgenic rice overexpressing miR-971-3p and wild-type (WT) rice. (B) Six days after inoculation with RSV-carrying planthoppers, the relative expression levels of miR-971-3p in T1 generation transgenic rice overexpressing miR-971-3p and wild-type (WT) rice. NP The relative RNA levels. (C) Disease incidence in WT and transgenic rice overexpressing miR-971-3p after inoculation with RSV-carrying planthoppers for 3 consecutive days. Five rice seedlings per replicate, for a total of 6 replicates. A t-test was used for comparison. NS, no significant difference. * P <0.05; ***, P <0.001.

[0069] Figure 4 To detect the economic traits of miR-971-3p overexpressing lines. (A) Comparative analysis of plant height between mature wild-type and miR-971-3p overexpressing rice lines, scale bar 50 cm. (B) 1000-grain weight of wild-type and miR-971-3p overexpressing lines. (CD) Width (C) and length (D) of hulled grains of wild-type and miR-971-3p overexpressing lines. Scale bar 5 mm. NS, No significant difference; *, P <0.05. Detailed Implementation

[0070] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0072] In the quantitative experiments described below, 7-15 biological replicates were set up.

[0073] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and Student's t-test was used. P <0.05 (*) indicates a significant difference.

[0074] Example 1: Material Preparation

[0075] 1. Sample of planthopper

[0076] Both the virus-carrying and virus-free planthopper populations were derived from laboratory-conserved strains that had undergone long-term virus screening. They were divided into non-virulent (N-line, non-viruliferous insects) and virus-carrying (V-line, viruliferous insects) strains infected with RSV. Wuyujing rice seedlings were planted in 1 L glass beakers. When the seedlings reached 2-3 cm in height, planthoppers were introduced into the beakers, and the mouths were covered with fine nylon mesh. New seedlings were replaced as needed, and watering was provided appropriately. The planthoppers were reared at 25℃ with a relative humidity of 15%-25% and a photoperiod of 16 h:8 h (light: darkness).

[0077] To ensure a high virus-carrying rate in the virus-carrying strain of rice stripe virus (hereinafter referred to as virus-carrying rice stripe virus), the strain was screened every 3 months. Pregnant female virus-carrying rice stripe virus were individually reared in separate bottles. After the nymphs hatched, 5 offspring rice stripe virus from each bottle were randomly selected for testing. The presence of RSV in the rice stripe virus nymphs was detected using ELISA with an NP monoclonal antibody. Dotted enzyme-linked immunosorbent assay (ELISA) results (W. Zhao, P. Yang, L. Kang, F. Cui, Different pathogenicities of Rice stripe virus from the insect vector and from viruliferous plants. New Phytol 210, 196-207 (2016).) showed that all 5 nymphs in each bottle were virus-carrying. The offspring of the female rice stripe virus in that bottle were then cultured as a virus-carrying population for further experiments.

[0078] 2. Information related to miR-971-3p

[0079] The inventors of this application identified endogenous miRNAs derived from the planthopper through literature review and experiments, as follows:

[0080] miR-971-3p: UUGGUGUUCUACCUUACAGUG (corresponds to the sequence SEQ ID NO:1 in the sequence listing, where T represents U in SEQ ID NO:1, and the other nucleotides are the same as this sequence).

[0081] Example 2: C3PO regulates miR-971-3p expression in the planthopper

[0082] 1. RNA extraction

[0083] dsGFP:

[0084] 5'-CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC-3'.

[0085] The corresponding RNA is double-stranded, and the sequence of one strand is as follows:

[0086] 5'-CACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAAC-3'.

[0087] dsTranslin:

[0088] 5'-TGCTCGAAGGCTCGTGAAAATCTTCCAAAAATACAGAGAATCTATGAAAATATAAGAAAGGCTTTTCCTGAGGAAGATTTTTTCAAGTATAATTTTATCTGGAAGACTCACACAAGTCAAATTGCAGAATGGATATTACTTATTATATTTCTCGAGAGAGGAGATCTTTGTCTGAAGAAAGAATTTTCTGAAGTAATTGGAGTGGAAAATGACACACAACAAGGGTTTCATATAACTTTGGAAGAATACCTTTTTGGATATTTGTCTATGATCTCTGACTTGGCGAGGCTGCTTGTTGTAAGTGCCACTTATAAAGATTATGGAAGAACAGAACAGATTCATCAATTCTTGAAACGATCGAATGATTGCTTCAGTCTTCTCAATTTGAAAAATGATGCCTTGAGGAAGCGTGGTGATGCCCTGAAATACGACTTGAAAAAGGCCGAGGAAGTTGTTAGTGATTTGAAAGCACGGGGACACTTGACTTCAACGGAGAAT-3'.

[0089] The corresponding RNA is double-stranded, and the sequence of one strand is as follows:

[0090] 5'-UGCUCGAAGGCUCGUGAAAAUCUUCCAAAAAUACAGAGAAUCUAUGAAAAUAUAAGAAAGGCUUUUCCUGAGGAAGAUUUUUCAAGUAUAAUUUUAUCUGGAAGACUCACACAAGUCAAAUU GCAGAAUGGAUAUUACUUAUUAUAUUUCUCGAGAGAGGAGAUCUUUGUCUGAAGAAAGAAUUUUCUGAAAGUAAUUGGAGUGGAAAAUGACACACAACAAGGGUUUCAUAUAACUUUGGAAGAAUAC CUUUUUGGAUAUUUGUCUAUGAUCUCUGACUUGGCGAGGCCUGCUUGUUGUAAGUGCCACUUAUAAAGAUUAUGGAAGAACAGAACAGAUUCAUCAAUUCUUGAAACGAUCGAAUGAUUGCUUCAGU CUUCUCAAUUUGAAAAAUGAUGCCUUGAGGAAGCGUGGUGAUGCCCUGAAAUACGACUUGAAAAAGGCCGAGGAAGUUGUUAGUGAUUUGAAAGCACGGGGACACUUGACUUCAACGGAGAAU-3'.

[0091] RNA was extracted from planthoppers injected with dsGFP (7 biological replicates) and dsTranslin (6 biological replicates) using the Trizol method (Invitrogen, Carlsbad, CA, USA). The specific procedures are as follows:

[0092] (1) Place the prepared sample in a 1.5 mL EP tube and add 1 mL of trizol. Add two steel balls for grinding to each EP tube. Grind at 60 Hz for 80 s, lyse on ice for 15 min, add 200 μL of chloroform at a ratio of 5:1, mix well and let stand on ice for 5 min.

[0093] (2) Centrifuge at 13000 rpm and 4℃ for 15 min.

[0094] (3) Take the supernatant, add an equal amount of isopropanol and 2 μL of 5 mg / mL glycogen, and precipitate overnight at -20℃.

[0095] (4) Centrifuge at 13000 rpm and 4℃ for 30 min. Discard the supernatant.

[0096] (5) Add 1 mL of pre-cooled 75% ethanol and resuspend the precipitate by inverting the container.

[0097] (6) Centrifuge at 13000 rpm and 4℃ for 10 min. Discard the supernatant and dry in a fume hood for 30-40 min.

[0098] (7) Add an appropriate amount of RNase-free H2O to dissolve the RNA according to the size of the precipitate, and store at -80℃ for later use.

[0099] 2. Relative expression levels of miR-971-3p between dsGFP-injected and dsTranslin-injected planthoppers

[0100] miRNA cDNA was synthesized using the miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit. In a 0.2 mL RNase-free EP tube, 10 μL of 2× miRNA RT Reaction Buffer, 2 μL of miRNA RT Enzyme Mix, and 1 μg of the RNA extracted in section "1. RNA Extraction" (volume depends on concentration, maximum volume is 8 μL) were added, with the remainder being RNase-free H2O, for a total volume of 20 μL. The mixture was then briefly centrifuged to the bottom of the tube. The tube was incubated at 42℃ for 60 min and then at 95℃ for 3 min. The relative expression level of miR-971-3p was then detected using the miRcute miRNA qPCR Detection Kit (Tiangen). Table 1 shows the primers MiR-971-3p-qF and the Reverse Primer provided in the kit as primer pairs for detecting the relative expression level of miR-971-3p in the planthopper. LsU6 -F and LsU6 -R is used to detect snRNA in planthoppers. U6 Relative gene expression levels, snRNA U6 The gene was used as an internal reference for calculating the relative expression level of miR-971-3p in the planthopper. The 2×miRcute miRNA premix PCR program was as follows: 95℃ for 15 min; 94℃ for 20 s, 60℃ for 34 s, for 45 cycles. Melting curves were generated at 94℃ for 5 s, 60℃ for 1 min, and the cells were continuously exposed to light at 97℃ for 5 cycles.

[0101] The relative expression level of each gene is represented by 2. -ΔCt The method is used to calculate, where -ΔCt is EF2 or U6 The Ct value (fluorescence threshold) of the target gene is subtracted from the Ct value of the target gene. The Student's t-test is used to compare the differences between the two groups.

[0102] Table 1. Primers required for quantitative PCR

[0103]

[0104] 3. Experimental Results

[0105] The results are as follows Figure 1 As shown, compared with planthoppers injected with dsGFP, planthoppers injected with dsTranslin (i.e., Figure 1 The expression level of miR-971-3p in dsTranslin was significantly increased. This result indicates that C3PO negatively regulates the expression of miR-971-3p.

[0106] Example 3: miR-971-3p inhibits RSV replication in planthoppers

[0107] 1. Injection of miR-971-3p agonists into infected planthoppers has an effect on RSV. NP The effect of RNA levels

[0108] miR-971-3p agonist group (miR-971-3p agomir group): Third-instar infected planthoppers were injected with a miR-971-3p agonist solution (sense strand sequence 5'-UUGGUGUUCUACCUUACAGUG-3', antisense strand sequence 5'-CUGUAAGGUAGAACACCAAUU-3', synthesized by Suzhou Jima Company). The miR-971-3p agonist concentration in the solution was 250 μM, and the total injection volume was 23 nL / planthopper. The injected planthopper nymphs were then cultured in an incubator. Six days after injection, 7-8 biological replicates were collected from each group, with 5 planthoppers per replicate for the following experiments:

[0109] (1) Detecting fold changes in RNA levels

[0110] ① Detect the relative expression level of miR-971-3p in the planthopper

[0111] The relative expression level of miR-971-3p in the planthopper was detected according to Example 2.

[0112] ②Detection of planthoppers NP Relative expression level of genes

[0113] cDNA synthesis was performed according to the instructions for the M-MLV reverse transcription system (Promega, Madison, WI, USA). The detailed steps are as follows: RNA concentration was determined using NanoDrop. 1 μg of RNA (X μL, maximum volume 12 μL), 12-X μL of RNase-free H2O, and 1 μL of random primer were placed in a 0.2 mL RNase-free EP tube, mixed, and centrifuged. The mixture was incubated at 70℃ for 5 min and then at 4℃ for 10 min in a PCR instrument. The reaction product was briefly centrifuged again. Then, 5 μL of dNTP, 5 μL of M-MLV RT 5× Buffer, 1 μL of Recombinant Rnasin Ribonnuclease Inhibitor, and 1 μL of M-MLV Reverse Transcriptase (reagents can be pre-mixed) were added to the reaction product. The mixture was then centrifuged. The mixture was incubated at 42℃ for 60 min and then at 75℃ for 15 min in a PCR instrument. The relative expression levels of viral genes were detected using a LightCycler 480 SYBR GreenI Master (Roche, Basel, Switzerland). EF2 -qF and EF2 -qR was used as a primer pair to detect gray planthoppers. EF2 The relative expression level of genes. NP -F and NP -R is used as a primer pair for detecting gray planthoppers. NP The relative expression level of genes. EF2 As viral genes NP The internal reference gene was used. The qPCR reaction system consisted of 20 μL, including 4 μL cDNA template, 10 μL SYBR Green I Master Mix (Roche, Basel, Switzerland) or 2×miRcute miRNApremix (Tiangen), and 0.5 μL of 10 μM primers. The SYBR Green I Master Mix PCR program was: pre-denaturation: 95℃ for 15 min; denaturation: 95℃ for 10 s, annealing: 58℃ for 20 s; extension: 72℃ for 20 s, for 40 cycles. The melting curve generation program was: denaturation: 95℃ for 5 s, annealing: 65℃ for 60 s, 40℃ for 10 s.

[0114] (2) Western Blot

[0115] Total protein was collected from rice planthoppers 6 days after injection of miR-971-3p agonist, extracted with 1×PBS buffer, and then Western blot analysis was performed on the protein levels of NP using an anti-NP monoclonal antibody (preparation method described in the following non-patent literature "W. Zhao, P. Yang, L. Kang, F. Cui, Different pathogenicities of Rice stripe virus from the insect vector and from viruliferous plants. New Phytol 210, 196-207 (2016)"). Image J was used for grayscale analysis. The internal control was Tubulin antibody (Abcam product, catalog number ab15568).

[0116] The NC agonist group (NC antagomir group): The miR-971-3p agonist was replaced with an NC agonist (5'-UUCUCCGAACGUGUCACGUTT-3' for the sense strand and 5'-ACGUGACACGUUCGGAGAATT-3' for the antisense strand, and the rest of the procedures were the same as those in the miR-971-3p agonist group.

[0117] miR-971-3p antagonist group (miR-971-3p agomir group): miR-971-3p agonist was replaced with miR-971-3p antagonist (positive chain sequence is 5'-CACUGAAGGUAGAACACCAA-3'), and the rest of the operation was the same as miR-971-3p agonist group.

[0118] NC antagomir group: The miR-971-3p antagomir antagomir group replaced the miR-971-3p antagomir ... NP The relative expression levels of the gene and miR-971-3p were controlled, and the remaining procedures were the same as those for the miR-971-3p agonist group.

[0119] The results are as follows Figure 2 As shown, after injecting miR-971-3p agonists into infected planthoppers, the miR-971-3p content was significantly increased after 6 days compared with the negative control NC group, and RSV in infected planthoppers was also significantly increased. NP RNA levels decreased significantly ( Figure 2 In the study of NP (A), Western blot analysis revealed a significant decrease in NP protein levels. Figure 2(B) Injecting miR-971-3p antagonists into infected planthoppers, after 6 days, the levels of miR-971-3p were found to be significantly lower than those in the negative control NC group, and RSV in infected planthoppers was also significantly reduced. NP RNA levels increased significantly ( Figure 2 In the middle C), Western blot analysis revealed a significant increase in NP protein levels. Figure 2 (D).

[0120] Example 4: Antiviral effect of miR-971-3p in rice

[0121] I. Preparation of rice with miR-971-3p overexpression

[0122] Induction medium: Add ddH2O to a final volume of 1 L, adjust the pH to 5.8, and autoclave.

[0123] Table 2. Induction Culture Medium Formulation

[0124]

[0125] Co-culture medium: Add ddH2O to a final volume of 250 mL and adjust the pH to 5.6. Autoclave. Before use, add 5 mL of 50% glucose and 250 μL of Acetosringone stock solution.

[0126] Table 3. Co-culture medium formulation

[0127]

[0128] Screening medium: Add ddH2O to a final volume of 250 mL and adjust the pH to 6.0. Autoclave. When using, add 250 μL of Hygromycin B solution (50 mg / mL) and 500 μL of Carbenicillin (250 mg / mL).

[0129] Table 4. Screening medium formulation

[0130]

[0131] Differentiation medium: Add ddH2O to a final volume of 250 mL and adjust the pH to 6.0. Autoclave. When using, add 250 μL Hn (50 mg / ml) and 500 μL Cn (250 mg / ml).

[0132] Table 5. Differentiation medium formulation

[0133]

[0134] Rooting medium: Add ddH2O to a final volume of 1 L, and adjust the pH to 5.8. Autoclave.

[0135] Table 6. Rooting medium formulation

[0136]

[0137] The recombinant vector pBWA(V)HS-miR-971-ami is obtained by replacing a small fragment between BsaI and Eco31I in the pBWA(V)HS vector with DNA of SEQ ID NO:2 while keeping other nucleotide sequences unchanged. This recombinant vector can express the miRNA of SEQ ID NO:1 in rice.

[0138] SEQ ID NO:2: 5'-ttggtgttctaccttacagtgcaggagattcagtttgaagctggacttcacttttgcctctctcactgtaaggtagaacaccaa-3'. Nucleotides 1 to 21 correspond to SEQ ID NO:1, and nucleotides 22 to 63 are the common stem-loop structure of rice miRNA precursors.

[0139] The recombinant vector pBWA(V)HS-miR-971-ami was transformed into *Agrobacterium tumefaciens* to obtain recombinant *Agrobacterium tumefaciens* containing the recombinant vector pBWA(V)HS-miR-971-ami. This recombinant *Agrobacterium tumefaciens* was then transformed into callus tissue of the rice variety Nipponbare (Wuhan Boyuan Technology Co., Ltd.) to obtain transgenic plants. Specific experimental procedures and the required culture medium preparation methods are as follows:

[0140] (1) Rice callus induction: Disinfect the shelled rice seeds with 75% alcohol for 2 minutes and rinse 3 times; soak them in 0.15% mercuric chloride (containing 0.1% Tween 20) for 15 minutes and rinse 3 times; inoculate the disinfected seeds into the induction medium and culture at 32 ℃ under light for 5-10 days.

[0141] (2) Agrobacterium activation: streak on LB medium containing 50 mg / L kanamycin and incubate at 28 °C.

[0142] (3) Infection: Add activated Agrobacterium to suspension medium, shake at 28 ℃ and 180 rpm for 3 hours, and adjust the bacterial concentration to OD600=0.1; put the induced callus into Agrobacterium suspension for 1.5 minutes; pour off the bacterial solution, and use filter paper to dry the bacterial solution on the surface of the callus; cover the surface of the callus with filter paper and blow dry in a clean bench for 30 minutes; transfer the callus to co-culture medium, incubate in the dark at 20 ℃ overnight, and continue to incubate in the dark at 25 ℃ for 2 days.

[0143] (4) Cleaning: Transfer the co-cultured callus to an empty container and clean it 7-8 times with sterile distilled water. Clean the first 3 times quickly and soak for 3-5 minutes each time for the next 3-4 times. Soak in sterile distilled water containing 500 mg / L Cn for 30 minutes, pour off the solution, blot dry the surface of the callus with filter paper, cover the surface of the callus with filter paper, and dry it in a laminar flow hood for 1 hour.

[0144] (5) Screening: Place the cleaned callus on the screening medium and incubate at 32 ℃ for 14 days.

[0145] (6) Differentiation: After 14 days of screening, the resistant callus was transferred to differentiation medium and cultured at 28 ℃ (photocycle of 14h light / 10h dark).

[0146] (7) Rooting: When the resistant callus forms a 3-4 cm tall regenerated seedling on the differentiation medium, it is transferred to the rooting medium until a complete plant is formed, which is named T0 generation.

[0147] (8) The T0 generation was grown in a greenhouse under conditions of 30°C, 70% humidity, and a photoperiod of 12 hours of light / 12 hours of darkness. The T0 generation was cultivated to the T1 generation to obtain the miR-971-3p overexpression line T1 generation plant, which was named OE-miR-971-3p.

[0148] Subsequently, the expression level of miR-971-3p between wild-type rice and OE-miR-971-3p rice was detected according to the method shown in "2. Relative expression level of miR-971-3p between dsGFP injection and dsTranslin injection in planthopper" in Example 2.

[0149] The results showed that compared with wild-type rice, the expression level of miR-971-3p in OE-miR-971-3p rice was significantly increased. Figure 3 (A)

[0150] II. Inoculation of planthoppers carrying RSV

[0151] Inoculation experiments were conducted on OE-miR-971-3p seedlings with a height of 5-6 cm and wild-type Nipponbare (WT). Each rice plant was cultured in a single bottle, and 15 infected third-instar planthoppers were introduced into each bottle. After feeding for three days, the planthoppers were removed, and the rice was cultured for another six days. Whole rice plants were harvested, and the levels of miR-971-3p and [other substances] in the rice were detected according to Example 3. NP Relative gene expression levels. 15-17 biological replicates per group.

[0152] The results showed that compared with the negative control NC group, the content of miR-971-3p was significantly increased in transgenic rice overexpressing miR-971-3p, and RSV was also significantly increased. NP The RNA level also decreased significantly, proving that miR-971-3p also plays an antiviral role in rice. Figure 3 (B)

[0153] III. Incidence of RSV infection in transgenic rice overexpressing miR-971-3p

[0154] The experimental group consisted of miR-971-3p overexpressing rice, and the control group consisted of WT rice. Each group had 6 replicates, with 5 rice plants per replicate. Each replicate was as follows:

[0155] Five infected rice planthoppers were fixed to the leaves of wild-type Nipponbare (WT) and OE-miR-971-3p rice plants using micro-insect cages and fed for three days. After removing the planthoppers, the rice seedlings were placed on cultivation racks and cultured in a greenhouse at 30°C, 70% humidity, and a 12-hour light / 12-hour dark photoperiod. Disease incidence was then statistically analyzed until the disease incidence in both the control and treatment groups stabilized after 30 days. Disease incidence was calculated as: (Number of infected plants per pot / 5) * 100%.

[0156] The results showed that the disease incidence rate in rice overexpressing miR-971-3p was lower than that in wild-type rice, further demonstrating that overexpression of miR-971-3p downregulated viral replication levels in plants. Figure 3 (C)

[0157] Example 5: Analysis of economic traits of transgenic plants overexpressing miR-971-3p

[0158] Wild-type Nipponbare (WT) and OE-miR-971-3p rice were cultivated in greenhouses at 30°C, 70% humidity, and a photoperiod of 12 hours light / 12 hours dark. One rice plant was planted in each pot. After fruiting, the plant height, thousand-grain weight, and length and width of the hulled rice grains were measured.

[0159] The results showed that, compared with wild-type WT, there was no significant difference in plant height among rice plants overexpressing miR-971-3p. Figure 4 (A) The thousand-grain weight increased slightly. Figure 4 (B). The length and width of the rice grains after hulling are also similar to those of WT ( ). Figure 4 (C and D in the middle).

[0160] The above results indicate that overexpression of miR-971-3p does not affect plant height, the length and width of hulled rice grains, but the thousand-grain weight increases slightly. Based on its antiviral characteristics, this transgenic plant can be used to construct and expand [the transgenic plant].

[0161] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for inhibiting rice stripe virus replication using miRNA, characterized in that, The steps include: increasing the expression level of miRNA genes in the target rice to inhibit the replication of rice stripe virus in the target rice; The miRNA is a single-stranded RNA molecule with the nucleotide sequence SEQ ID NO:

1.

2. A method for cultivating plants with enhanced resistance to rice stripe virus, comprising increasing the expression level of the miRNA gene as described in claim 1 in a recipient plant to obtain plants with enhanced resistance to rice stripe virus; wherein the plants with enhanced resistance to rice stripe virus exhibit higher resistance to rice stripe virus than the recipient plant; wherein the plant is rice.

3. The method according to claim 2, characterized in that, The improvement in the expression level of the miRNA gene of claim 1 in the recipient plant is achieved by introducing a nucleic acid molecule that produces the miRNA of claim 1 into the target plant.

4. The method according to claim 3, characterized in that, The nucleic acid molecule is a DNA molecule with the nucleotide sequence SEQ ID NO:

2.

5. The application of the miRNA or the substance regulating the expression of said miRNA as described in claim 1, characterized in that, The application is any one of the following: Application of H1 in improving plant resistance to rice stripe virus; Application of H2 in the preparation of products that enhance plant resistance to rice stripe virus; The application of H3 in plant breeding, wherein the plant breeding is for the purpose of cultivating plants with enhanced resistance to rice stripe virus; The substance is any one of the following: B1) To produce a nucleic acid molecule containing the miRNA as described in claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); The plant in question is rice.

Citation Information

Patent Citations

  • Seed specificity highly effective promoter and its application

    CN101063139A

  • Seed specific highly effective promoter and its application

    CN101063139B

  • Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells

    US5057422A

  • Plant proteins, promoters, coding sequences and use

    US5187267A