MTAP and CDKN2A gene fluorescence in-situ hybridization joint detection probe and application thereof

By using a combined fluorescence in situ hybridization probe for MTAP and CDKN2A genes, the problem of simultaneously detecting abnormalities in MTAP and CDKN2A genes in existing technologies has been solved, enabling rapid and effective cancer diagnosis and prognostic assessment.

CN121428096APending Publication Date: 2026-01-30ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511611684.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-05
Publication Date
2026-01-30

AI Technical Summary

Technical Problem

Existing technologies cannot simultaneously and rapidly detect abnormalities in the MTAP and CDKN2A genes, affecting the accuracy of cancer diagnosis and prognostic assessment.

Method used

A fluorescence in situ hybridization probe for the MTAP and CDKN2A genes is provided. By using probes labeled with different fluorophores, abnormal states of the MTAP and CDKN2A genes can be detected simultaneously. Combined with an internal control probe, it can be used to prepare detection kits and detection systems.

Benefits of technology

It enables rapid and effective detection of gene abnormalities in various cancer samples, providing rich clinicopathological and prognostic information to support cancer diagnosis and prognostic assessment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121428096A_ABST
    Figure CN121428096A_ABST
Patent Text Reader

Abstract

The invention relates to an MTAP and CDKN2A gene fluorescence in-situ hybridization joint detection probe and application thereof, and belongs to the technical field of biological medicine. The invention provides a probe and a probe composition for tumor diagnosis and prognosis evaluation, the probe composition comprises a first probe for detecting an MTAP gene and a second probe for detecting a CDKN2A gene, and the first probe and the second probe are respectively marked with a first fluorescein and a second fluorescein which can generate different colors; the invention provides a fluorescence in situ hybridization combined detection method for simultaneously detecting MTAP and CDKN2A gene variation and a kit thereof. The application range is wide, the kit can be used for various tissue and cell samples needing to detect MTAP and CDKN2A gene states at the same time, and two results are obtained through one-time detection and accord with the targets of quality improvement and efficiency improvement of clinical examination; the method has a very wide application prospect in evaluating the malignant degree of various cancers and selecting a clinical precise treatment strategy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a fluorescence in situ hybridization detection probe for the MTAP and CDKN2A genes and its application, belonging to the field of biomedical technology. Background Technology

[0002] The MTAP gene (methylthioadenosine phosphorylase gene) is located on human chromosome 9 (9p21). It catalyzes the conversion of a molecule called 5'-deoxy-5'-methionine into methionine and adenine. Methionine is an important amino acid in protein synthesis, while adenine is a basic building block (purine base) for the synthesis of DNA and RNA. Therefore, MTAP helps cells efficiently reuse certain metabolites to regenerate the essential building blocks of life, thereby reducing the energy consumption of synthesizing these materials de novo. Studies have found that the most significant characteristic of MTAP in tumors is its frequent co-deletion and the resulting opportunity for synthetic lethal therapy. (See attached image) Figure 1 As shown, this illustrates gene abnormalities of the MTAP gene in a broad spectrum of tumors, including mutations, structural alterations, amplifications, deletions, and various other variations, with deletions being the most common. The MTAP gene is located adjacent to a crucial tumor suppressor gene, CDKN2A (or p16). CDKN2A is an important checkpoint in the cell cycle, preventing excessive cell proliferation. In various cancers (such as glioblastoma, pancreatic cancer, non-small cell lung cancer, melanoma, and leukemia), large chromosomal deletions of CDKN2A segments occur in cancer cells, leading to the loss of CDKN2A's tumor-suppressive effect and tumor progression. (See attached image.) Figure 2 As shown, the CDKN2A gene exhibits a wide range of abnormalities in tumors, including mutations, structural alterations, amplifications, deletions, and various other variations, with deletions being the most common, followed by mutations. Large deletions of the CDKN2A region often result in the simultaneous deletion of an entire gene region containing both CDKN2A and MTAP. Therefore, MTAP itself is not a typical tumor suppressor gene (its deletion does not directly drive tumorigenesis), but it is an important biomarker. The deletion of MTAP usually implies the simultaneous deletion of its adjacent CDKN2A, indicating cell cycle dysregulation and enhanced cancer cell proliferation.

[0003] Synthetic lethality is currently a hot research topic, referring to the simultaneous inactivation of two genes leading to cell death, while the inactivation of either gene alone allows cell survival. This is the most promising role of MTAP, offering new insights for precision cancer treatment. Cancer cells lack MTAP, thus lacking the MTAP enzyme and unable to generate adenine and methionine through recycling. Therefore, they rely more heavily on another pathway: de novo synthesis of purines. This makes MTAP-deficient cancer cells exceptionally sensitive to inhibitors of key enzymes in the de novo synthesis pathway. The most well-known target is protein arginine methyltransferase 5 (PRMT5). PRMT5 inhibitors have emerged to address this need. PRMT5 is an enzyme whose activity is regulated by substrates (MTAs) recycled by MTAP. In normal cells (MTAP-positive), MTA inhibits PRMT5 activity, preventing its overactivity. However, in MTAP-deficient cancer cells, MTA cannot be metabolized, leading to its accumulation and strongly inhibiting PRMT5 activity, further impairing the already weakened PRMT5 function in cancer cells. At this point, if exogenous PRMT5 inhibitor drugs are used to further inhibit PRMT5 function, it will have little effect on normal cells (with MTAP and normal PRMT5 function), but will have a significant effect on cancer cells lacking MTAP, causing cancer cells to die because they are completely unable to perform their necessary biological functions.

[0004] The CDKN2A gene (a cell cycle-dependent kinase inhibitor 2A gene) is located on the short arm (9p21) of human chromosome 9, a hotspot region frequently found in cancers due to deletions or mutations. Encoding two distinct proteins (p16INK4a and p14ARF), the CDKN2A gene acts as a cell cycle checkpoint. These proteins function through different pathways to prevent abnormal cell proliferation. CDKN2A inactivation is a critical event in the development and progression of many cancers and is one of the most common genetic alterations in cancer. When the CDKN2A gene is deleted, mutated, or epigenetically silenced (e.g., by methylation), its inhibitory function is lost, cells enter a state of sustained proliferation, leading to malignant transformation. Studies have found that over 90% of pancreatic ductal adenocarcinomas and more than 50% of glioblastomas exhibit CDKN2A inactivation. Inactivation is also commonly seen in other cancers such as melanoma, non-small cell lung cancer, esophageal cancer, head and neck squamous cell carcinoma, bladder cancer, and leukemia. The deletion / inactivation of CDKN2A is generally associated with poorer clinical prognosis, greater invasiveness, and faster disease progression. CDK4 / 6 inhibitors, such as palbociclib, have been approved for cancers including breast cancer and are undergoing clinical trials in other CDKN2A-deficient cancers. Furthermore, studies have shown that CDKN2A-deficient tumors may have a higher tumor mutational burden (TMB), which may make them more sensitive to immune checkpoint inhibitors such as PD-1 / PD-L1 inhibitors. As mentioned earlier, the neighboring gene MTAP is frequently co-deleted with CDKN2A, laying the foundation for the development of a combined MTAP and CDKN2A fluorescence in situ hybridization detection probe, which has considerable potential for application in assessing the malignancy of various cancers and selecting precision clinical treatment strategies. Summary of the Invention

[0005] One of the technical problems to be solved by this invention is how to prepare a dual-gene simultaneous fluorescence in situ hybridization joint detection probe for the MTAP gene and the CDKN2A gene and its application.

[0006] One of the technical problems to be solved by this invention is how to prepare a detection kit for MTAP gene and CDKN2A gene abnormalities and the preparation method thereof. The kit contains probes that target specific chromosomal loci or centromeres, or combinations of multiple specific chromosomal loci or centromeres, which can quickly and effectively detect a variety of cancer samples and are suitable for the development and promotion of cancer diagnosis and prognostic assessment products.

[0007] To address the aforementioned problems, the present invention provides a molecular biomarker for tumor diagnosis and prognostic assessment. This molecular biomarker is a combination of the MTAP gene and the CDKN2A gene. The MTAP gene is located at Chr9: 21,802,636-21,941,115; the CDKN2A gene is located at Chr9: 21,967,752-21,995,324. The data are sourced from PubMed.

[0008] The present invention provides a probe and a probe composition for tumor diagnosis and prognostic assessment. The probe and probe composition are used to detect the above-mentioned molecular markers, including a first probe for detecting the MTAP gene and a second probe for detecting the CDKN2A gene. The first probe and the second probe are respectively labeled with a first fluorescein and a second fluorescein that can produce different colors.

[0009] Preferably, the probe and probe composition further include an internal reference probe for detecting the centromere of chromosome 9, wherein the primers for obtaining the internal reference probe are SEQ ID NO: 1 and SEQ ID NO: 2; and the internal reference probe is labeled with a third fluorophore.

[0010] Preferably, the fluorescence colors of the first fluorescein, the second fluorescein, and the third fluorescein are red, green, and cyan, respectively; the first fluorescein, the second fluorescein, and the third fluorescein are respectively selected from tetramethylrhodamine, fluorescein isothiocyanate, and cyanin.

[0011] The present invention provides the use of the above-described molecular markers, or the above-described probes and probe compositions, in the preparation of a detection kit for tumor diagnosis and prognostic assessment.

[0012] This invention provides a detection kit for tumor diagnosis and prognostic assessment. The kit is used to detect human chromosomal abnormalities. The detected chromosomal loci include the MTAP gene and the CDKN2A gene. The detection kit contains a set of fluorescent in situ hybridization probes for detecting chromosomal loci. The target fragment of the fluorescent in situ hybridization probe set for detecting the MTAP gene is Chr9: 21,802,636-21,941,115; the target fragment of the fluorescent in situ hybridization probe set for detecting the CDKN2A gene is Chr9: 21,967,752-21,995,324.

[0013] Preferably, the test kit further includes a sample collection device and consumables; the sample collection device collects samples from blood, saliva, urine, pleural effusion, or peritoneal effusion.

[0014] Preferably, the test kit further includes several test reagents, which include at least one of digestion solution, washing solution, sample preservation solution, or organic reagent for FISH hybridization.

[0015] The present invention provides the use of the above-described detection kit in the preparation of tumor diagnostic or prognostic products.

[0016] This invention provides the application of the above-described detection kit in the risk assessment and prognosis assessment of gastrointestinal stromal tumors.

[0017] This invention provides a detection system, including a data processing device and a substance for detecting biomarkers; the data processing device includes a data input module, a data recording module, a data comparison module, and a conclusion output module; the substance for detecting biomarkers includes the aforementioned probe, probe composition, and detection reagent; the data input module is configured to input a biomarker detection image of a sample to be tested; the data recording module is configured to store the sample detection image and a judgment threshold; the data comparison module is configured to receive the biomarker detection image of the sample to be tested sent by the data input module, and retrieve the judgment threshold from the data recording module and compare it with the sample detection image; the conclusion output module is configured to receive the comparison result sent by the data comparison module, and judge the comparison result according to predetermined judgment conditions to assess the malignancy and prognostic probability of the tumor in the tested subject.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention provides a fluorescence in situ hybridization method and kit for simultaneously detecting MTAP and CDKN2A gene variants. The kit has a wide range of applications and can be used for various tissue and cell samples requiring simultaneous detection of MTAP and CDKN2A gene status, such as tumor cells, exfoliated cells from pleural and peritoneal fluid, and normal cells.

[0020] The detection method provided by this invention is simple and efficient, meeting the needs of rapid clinical diagnosis. A single test yields multiple results, aligning with the goal of improving the quality and efficiency of clinical laboratory testing. This invention provides abundant clinical pathological and prognostic information, possessing high clinical application value for disease prognosis and prediction. Attached Figure Description

[0021] Figure 1 This is a diagram showing gene abnormalities of the MTAP gene in a broad spectrum of tumors.

[0022] Figure 2 This diagram illustrates gene abnormalities of the CDKN2A gene in a broad spectrum of tumors.

[0023] Figure 3 This is a schematic diagram of the probe design of the present invention;

[0024] Figure 4 This is a fluorescence in situ hybridization diagram of normal cells in the example;

[0025] Figure 5 This is a fluorescence in situ hybridization diagram of cells with MTAP gene deletion in the examples;

[0026] Figure 6 This is a fluorescence in situ hybridization diagram of CDKN2A gene deletion case cells in the examples;

[0027] Figure 7 This is a fluorescence in situ hybridization diagram of cells with double gene deletion of MTAP gene / CDKN2A gene in the example; Detailed Implementation

[0028] To make the present invention more apparent and understandable, preferred embodiments are described in detail below:

[0029] Example 1

[0030] Preparation of a FISH probe for detecting tumor malignancy and prognosis:

[0031] This embodiment provides a FISH probe combination for detecting tumor malignancy and prognosis, involving detection probes for the MTAP gene, CDKN2A gene, and chromosome 9 centromere, such as... Figure 3 The MTAP gene, CDKN2A gene detection probes, and chromosome 9 centromere detection probes are labeled with fluorophores that produce different fluorescent colors.

[0032] 1. Preparation of the centromere probe for chromosome 9:

[0033] (1) Primer design and synthesis: Primers were designed by searching and screening the high-specificity regions of the centromere of human chromosome 9, and finally the sequence with the best fragment labeling effect was obtained.

[0034] The sequences of the probe primers are shown in Table 1 below.

[0035] Table 1

[0036] Serial Number Primer name sequence SEQ ID NO:1 CSP 9-F 5'GGAACTTCTTTGTGATGTTTG 3' SEQ ID NO:2 CSP 9-R 5'TTATATGACGATATCCCGTG 3'

[0037] (2) PCR amplification was performed using the human genome as a template. The PCR system formula is shown in Table 2.

[0038] Table 2

[0039] name per test (μL) <![CDATA[10×PCR Buffer(Mg 2+ plus)]]> 5 <![CDATA[MgCL2(25mmol / L)]]> 2 dNTP Mixture (2.5mM each) 4 Human genomic DNA (50 ng / μL) 1.6 Probe primer F (100 pmol / μL) 0.2 Probe primer R (100 pmol / μL) 0.2 TAKARA Taq enzyme (5U / μL) 0.5 Purified water Make up to 50 μL

[0040] The total volume was 50 μL. Amplification was performed using a PCR amplification instrument.

[0041] (3) Agarose gel electrophoresis: After the PCR reaction, 1 μL of the product was taken and detected by 2% agarose gel electrophoresis.

[0042] (4) Probe labeling: The amplification products are fluorescently labeled using the notch translation method. The preferred fluorescein is Cyanine. The probe labeling reaction system is shown in Table 3 below.

[0043] Table 3

[0044] Components per test (μL) 10×NT buffer 5 dATP, dCTP, and dGTP (1 mM) 1 dTTP(1mM) 0.6 DNase I (0.001 U / μL) 3 DNA polymerase I (5 U / μL) 1.5 Cyanine-labeled dATP (0.2 mM) 2 PCR products 300ng Purified water Make up to 50

[0045] The total volume of the system is 50 μL. After the system is prepared, shake to mix and centrifuge. Use a PCR gene amplification instrument to set the program, label at 25℃ for 2 hours, and incubate at 80℃ for 10 minutes to inactivate the enzyme.

[0046] (5) Purify the labeled product. The purification steps are as follows:

[0047] a) Prepare a purification solution by mixing 3M sodium acetate and anhydrous ethanol in a ratio of 1:25;

[0048] b) Precipitate and concentrate the labeled product with ethanol. Add the labeled product to a 1.5 mL centrifuge tube containing the purified solution at a product:purification solution volume ratio of 5:13. Vortex to mix, then centrifuge briefly. Place the mixture in a -80°C freezer for 30–60 minutes. Centrifuge at 13000 rpm for 2 minutes to precipitate the probe, discard the supernatant, and dry in the dark.

[0049] c) Add 200 μL of 70% ethanol to rinse the precipitate, briefly centrifuge to remove ethanol completely, and dry at 45°C for 3 minutes.

[0050] d) Finally, dissolve in 2 μL of purified water to obtain the labeled CEP9 probe, and store in the dark.

[0051] 2. The preparation steps for MTAP gene and CDKN2A gene probes are as follows:

[0052] (1) BAC clone screening: Clones containing MTAP and CDKN2A gene sequences were screened and purchased from the Invitrogen RP11 BAC clone library. BAC clones targeting the MTAP gene are shown in Table 4 below, and BAC clones targeting the CDKN2A gene are shown in Table 5 below. These BAC clones were referenced to the genome version Human Feb. 2009 (GRCh37 / hg19).

[0053] Table 4

[0054] BAC BAC region insertion fragment start and end positions RP11-70L8 chr9:21,742,609-21,911,258(2009) CTD-2240E21 chr9:21,810,144-21,929,041(2009)

[0055] Table 5

[0056] BAC BAC region insertion fragment start and end positions RP11-478M20 chr9:21,947,304-22,110,179(2009) CTD-2503E5 chr9:21.962.025-22.187,312(2009) CTD-2293J21 chr9:22,152,189-22,246,913(2009)

[0057] Plasmid extraction: Using a commercially available plasmid extraction kit, plasmids were extracted from the BAC clones according to the kit instructions to obtain plasmid DNA, which was then quantified using Nanodrop 2000.

[0058] Plasmid DNA fluorescent labeling: The plasmid DNA was fluorescently labeled using a nick-shifting method. For the MTAP gene detection probe, a mixture of two fragments as shown in Table 4 was used for fluorescent labeling, with tetramethylrhodamine (TRITC) being the preferred fluorescein. For the CDKN2A gene detection probe, a mixture of three fragments as shown in Table 5 was used for fluorescent labeling, with fluorescein isothiocyanate (FITC) being the preferred fluorescein. The PCR reaction system was prepared on ice under strictly dark conditions. The probe labeling reaction system is shown in Table 6 below.

[0059] Table 6

[0060] Components per test (μL) 10×NT buffer 5 dATP, dCTP, and dGTP (1 mM) 1 dTTP(1mM) 0.6 DNase I (0.001 U / μL) 3 DNA polymerase I (5 U / μL) 1.5 TRITC-labeled dUTP (0.2 mM) or FITC-labeled dATP (0.2 mM) 2 plasmid DNA 300ng Purified water Make up to 50

[0061] After the system is prepared, shake to mix and centrifuge, label at 25°C for 2 hours, and incubate at 80°C for 10 minutes to inactivate the enzyme.

[0062] The labeled product was precipitated with sodium acetate, centrifuged at high speed, and then purified. The probe was dissolved in purified water to obtain the labeled GSP (Gene Special Probe) MTAP gene probe and GSP CDKN2A gene probe.

[0063] To evaluate the sensitivity and specificity of the probes prepared in Example 1, human peripheral blood culture cells were tested using the probes from Example 1. Fifty metaphase cells were analyzed, and the fluorescence intensity of the hybridization signal, hybridization efficiency, and the correctness of the hybridization position were analyzed. The results are shown in [link to relevant documentation]. Figure 4 The images show fluorescence images of the centromere of chromosome 9, the MTAP gene, and the CDKN2A gene in metaphase. The corresponding chromosomal loci are marked with cyan (chromosome 9) and yellow fluorescence (the red fluorescence of the MTAP gene and the green fluorescence of the CDKN2A gene are added together to show yellow fluorescence). The signals are bright and there is no cross-hybridization between chromosomal loci.

[0064] Example 2

[0065] Prognostic kit for gastrointestinal stromal tumors (GIST):

[0066] 2.1 This embodiment provides a detection kit for the prognosis of gastrointestinal stromal tumors, enabling direct observation of signals in tissue samples. The kit contains a hybridization solution of the FISH probe combination described in Example 1. The hybridization solution includes probes, a hybridization buffer solution, placental DNA, and in situ hybridization blue staining solution.

[0067] The hybridization buffer contains sodium citrate buffer (SSC), deionized formamide, and dextran sulfate (DSS), with the concentration of deionized formamide being 40%-60% and the concentration of DSS being 0.1-0.2 g / mL. The in situ hybridization blue staining solution is 4',6-diamidinyl-2-phenylindole (DAPI).

[0068] The composition and preparation of the hybridization solution for the kit are shown in Table 7 below.

[0069] Table 7

[0070] Components per test (μL) Hybridization buffer 7 Human placental DNA (1 mg / mL) 1 CSP 9-Cyanine marker 0.8 GSP MTAP-TRITC marking 0.8 GSP CDKN2A-FITC mark 0.8 Purified water Make up to 10μL

[0071] 2.2 FISH Testing Procedure

[0072] 2.2.1 Section Pretreatment:

[0073] 1) Use a rotary microtome to cut 3-4μm tissue samples onto a 40-50℃ water surface. After spreading the slides, retrieve them onto a glass slide to prevent them from falling off. Place the glass slides in an 80±5℃ constant temperature oven for 45 minutes.

[0074] 2) After baking, the slices are immersed in xylene I and II in sequence at room temperature for 10 minutes to dewax; then they are immersed in 100% and 90% graded ethanol for 3 minutes each; and washed with water for 3 minutes.

[0075] 3) Remove the slices and wash them in sterile purified water at room temperature for 3 minutes;

[0076] 4) Remove the slides and boil them in antigen retrieval buffer at 100°C for 20 minutes. Remove the slides and air dry at room temperature.

[0077] 5) Place the slices in preheated pepsin digestion solution (proteinase K working solution (200μg / ml) at 37±1℃ and digest for 5-10 minutes; stop digestion with distilled water; dry at 37℃.

[0078] 2.2.2 Add the probe (operation in the dark)

[0079] 1) Take the hybridization probes MTAP, CDKN2A, and CEP9 out of the -20℃ freezer, shake to mix, and centrifuge briefly; add 10μl of hybridization solution to the hybridization area, quickly cover with a 10×10mm coverslip, remove air bubbles, and seal the edges with rubber.

[0080] 2) Place the glass slide on the heating plate of the in situ hybridization instrument, place the absorbent strip pre-soaked in double-distilled water into the slot on the hybridization instrument cover, close the hybridization instrument cover, and set the program: 85℃ for 5-10 minutes, hybridize overnight at 37℃.

[0081] 2.2.3 Washing and counterstaining after hybridization (operation in the dark)

[0082] 1) Remove the slide, gently peel off the rubber, remove the coverslip, and incubate in 2×SSC at 37±1℃ for 10 minutes;

[0083] 2) Remove the slice and incubate it in 0.1% NP-40 / 2×SSC at 37±1℃ for 5 minutes;

[0084] 3) Remove the slide and place it in 70% ethanol at room temperature for 3 minutes to dehydrate; remove the slide and allow it to air dry in the dark.

[0085] 4) Add 10 μL of DAPI counterstain to the hybridization area of ​​the slide at room temperature, cover with a coverslip, and observe under a microscope after 15 minutes.

[0086] 2.2.4 Observation of FISH results using fluorescence microscopy:

[0087] 1) Scan the entire slide under a 40× objective lens. A satisfactory specimen should have hybridization signals in more than 75% of the cancer cell nuclei; observe whether heterogeneity exists.

[0088] 2) Locate a clear tumor area under a 100× objective lens, observe the FISH staining results of the tumor cell nuclei, and count the signal.

[0089] 2.2.5 Results:

[0090] like Figure 4 The image shown is a fluorescence in situ hybridization (FISH) diagram of normal cells in the negative control group; (the cells in the image appear cyan and yellow).

[0091] like Figure 5 The image shown is a fluorescence in situ hybridization (FISH) diagram of cells from a case of MTAP gene deletion; (abnormal cells are shown in cyan and green).

[0092] like Figure 6 The image shown is a fluorescence in situ hybridization (FISH) diagram of cells from a CDKN2A gene deletion case; (abnormal cells are shown in cyan and red).

[0093] like Figure 7 The image shown is a fluorescence in situ hybridization (FISH) image of cells with double deletion of the MTAP gene and CDKN2A gene; (abnormal cells are only shown in cyan).

[0094] For cases with double deletion of the MTAP gene and CDKN2A gene, it can be predicted that patients should have a relatively good prognosis if a synthetic lethal treatment strategy is adopted. 2.3

[0096] Clinicopathological features and prognostic assessment of gastrointestinal stromal tumors (GISTs) with homozygous loss of CDKN2A and / or MTAP:

[0097] Methods: Targeted next-generation sequencing (NGS) was performed on primary GIST cases diagnosed at the Department of Pathology, Zhongshan Hospital Affiliated to Fudan University between January and August 2025. Fluorescence in situ hybridization was used to validate the NGS results. Statistical analysis was performed using SPSS 21 software for independent samples nonparametric tests (Mann-Whitney U rank-sum test) and chi-square test.

[0098] Results: 247 primary GIST cases underwent NGS testing, with 15 cases showing homozygous deletion mutations in the CDKN2A and / or MTAP genes (mutation rate 6.1%). Of these, 7 cases showed homozygous deletion of the CDKN2A gene, and 8 cases showed homozygous deletion of both CDKN2A and MTAP. FISH results were consistent with NGS results. 14 cases showed KIT gene mutations, and 1 case showed PDGFRA gene mutation. In the deletion group, there were 7 males and 8 females, aged 48-77 years (mean age 62 years). Surgery was performed in 13 cases, with 7 cases in the stomach, 1 case in the duodenum, and 5 cases in the small intestine; 1 case underwent abdominal and gastric biopsy. Tumor size in the deletion mutation group ranged from 3.7-15.8 cm (mean 9.7 cm), significantly larger than in the non-mutation group (0.6-25 cm, mean 5.9 cm, P<0.001). All gene deletion cases were assessed as malignant using the Zhongshan method, with both biopsies indicating malignancy. Of the remaining 13 surgical cases, 7 were assessed as moderately malignant, 5 as highly malignant, and 1 as having recurrence or metastasis. No benign, borderline, or low-grade malignant cases were found. Risk assessment determined 12 cases to be high-risk and 1 case to be low-risk.

[0099] Study Conclusion: Although homozygous deletion of CDKN2A and / or MTAP occurs in a low-incidence population in primary GIST, it suggests a poor prognosis. This mutation type can be detected in KIT or PDGFRA gene mutations, but has not been detected in wild-type GIST. Detection of homozygous deletion mutations of CDKN2A and / or MTAP can assist clinicians in making decisions regarding postoperative adjuvant imatinib therapy, especially in cases where risk assessment is not suitable, such as those requiring biopsy.

[0100] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A molecular marker for tumor diagnosis and prognosis evaluation, characterized in that, The molecular marker is a combination of MTAP gene and CDKN2A gene; the MTAP gene is located at Chr9:21,802,636-21,941,115; and the CDKN2A gene is located at Chr9:21,967,752-21,995,324.

2. A probe and probe composition for tumor diagnosis and prognosis evaluation, characterized by, The probe and probe composition are used for detecting the molecular marker of claim 1, and comprise a first probe for detecting the MTAP gene and a second probe for detecting the CDKN2A gene, wherein the first probe and the second probe are respectively labeled with a first fluorophore and a second fluorophore capable of producing different colors.

3. The probe and probe composition for diagnosis and prognosis evaluation of tumor according to claim 2, wherein, The probe and probe composition further comprise a reference probe for detecting the centromere of chromosome 9, and primers for obtaining the reference probe are SEQ ID NO:1 and SEQ ID NO:2; the reference probe is labeled with a third fluorophore.

4. The probe and probe composition for diagnosis and prognosis evaluation of tumor according to claim 3, wherein, The fluorescent colors of the first fluorophore, the second fluorophore and the third fluorophore are red, green and cyan, respectively; and the first fluorophore, the second fluorophore and the third fluorophore are selected from tetramethyl rhodamine, fluorescein isothiocyanate and cyanine, respectively.

5. Use of the molecular marker of claim 1, or the probe and probe composition of any one of claims 2-4 in the preparation of a detection kit for tumor diagnosis and prognosis evaluation.

6. A test kit for tumor diagnosis and prognosis evaluation, characterized by, The kit is used for detecting human chromosome abnormalities; the detected chromosome sites include the MTAP gene and the CDKN2A gene, and the detection kit contains a fluorescence in situ hybridization probe set for detecting the chromosome sites; wherein the target fragment of the fluorescence in situ hybridization probe set for detecting the MTAP gene is Chr9:21,802,636-21,941,115; and the target fragment of the fluorescence in situ hybridization probe set for detecting the CDKN2A gene is Chr9:21,967,752-21,995,324.

7. The test kit according to claim 6, characterized in that The detection kit further comprises a sample collection device and consumables; the sample collected by the sample collection device is from blood, saliva, urine, pleural effusion or peritoneal effusion; and the detection kit further comprises several detection reagents, which include at least one of a digestive fluid, a cleaning fluid, a sample preservation fluid, or an organic reagent for FISH hybridization.

8. Use of the detection kit of any one of claims 6-7 in the preparation of a tumor diagnosis or prognosis product.

9. Use of the detection kit of any one of claims 6-7 in the risk assessment and prognosis evaluation of gastrointestinal stromal tumor.

10. A detection system characterized by, The device comprises a data processing device and a substance for detecting biomarkers; the data processing device comprises a data input module, a data recording module, a data comparison module and a conclusion output module; the substance for detecting biomarkers comprises the probes, probe compositions and detection reagents as described in claims 2-4 and 7; the data input module is configured to input the biomarker detection image of the sample to be detected; the data recording module is configured to store the detection image of the sample to be detected and the judgment threshold; the data comparison module is configured to receive the biomarker detection image of the sample to be detected sent by the data input module, call the judgment threshold from the data recording module and compare it with the detection image of the sample to be detected; the conclusion output module is configured to receive the comparison result sent by the data comparison module, judge the comparison result according to the predetermined judgment condition, and evaluate the malignant degree and prognosis possibility of the detected person suffering from tumor.