Nitrilase mutant and application thereof in preparation of (S)-3-methylheptanoic acid

Abstract

The invention discloses a nitrilase mutant and an application of the nitrilase mutant in preparation of (S)-3-methylheptanoic acid. The nitrilase mutant disclosed by the invention has high catalytic activity and stereoselectivity, and can overcome the defects of low substrate concentration, low stereoselectivity, high cost, environmental pollution and the like in the existing method, so that 3-methylheptonitrile can be quickly catalyzed to generate (S)-3-methylheptanoic acid under high substrate concentration. In addition, the method also has the effects of good enzyme catalysis effect, high product purity, high recovery rate, simple steps, greenness, environmental protection and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering, in particular to a nitrilase mutant and its application in preparing (S)-3-methylheptanoic acid. BACKGROUND

[0002] Nitrilase (EC 3.5.5.1) belongs to the superfamily of nitrilases, which can catalyze the conversion of nitriles to the corresponding carboxylic acids and ammonia. Since the first plant and bacterial nitrilases were discovered in 1964, nitrilases from many bacteria (e.g. Pseudomonas, Rhodococcus, Alcaligenes, Rhodobacter, etc.), fungi (e.g. Gibberella, Aspergillus, Fusarium, etc.), and plants (e.g. Brassica rapa, Arabidopsis thaliana, Sinapis alba, etc.) have been reported.

[0003] Chiral carboxylic acids are key building blocks for the synthesis of many chiral drugs (e.g. anti-inflammatory drugs, antihypertensive drugs, etc.). Chemical hydrolysis of nitriles usually requires harsh conditions (strong acid / strong base, high temperature) and is not enantioselective, while using nitrilases can efficiently and selectively hydrolyze prochiral nitriles or racemic nitriles at neutral pH and room temperature to produce optically pure carboxylic acids. For example, in the industrial synthesis of the antihypertensive drug olmesartan medoxomil, a nitrilase was used to catalyze the hydrolysis of a specific nitrile intermediate to obtain the desired chiral carboxylic acid with high yield and optical purity, avoiding the problems of complicated procedures and serious pollution in traditional methods. Therefore, more and more researchers and enterprises have shown great interest in nitrilases, and many successful cases have been developed, making nitrilases widely used in the production of high-value-added products such as drugs, pesticides, feed additives, and polymers.

[0004] Limaprost is a derivative of prostaglandin E1, which was marketed in 1988 under the trade names OPALMON and PRORENAL. Similar to prostaglandin E1, limaprost can promote the secretion of adenylyl cyclase in cells, thereby inhibiting the aggregation and adhesion of platelets. Through specific structural modification, the activity of limaprost in this aspect is significantly enhanced, and its ability to inhibit platelet aggregation and adhesion is more than ten times that of prostaglandin E1. In addition, limaprost can also increase the blood flow of neural tissue, which helps to improve neural function. Literature also reports that this compound also has the effects of inhibiting thromboxane A2 and active oxygen generation, and can effectively enhance the deformability of red blood cells.

[0005] In the synthesis of limaprost, (4S)-4-methyl-2-oxooctyl phosphonic acid dimethyl ester is a key structural unit of the omega side chain. This unit can be prepared by reacting (S)-3-methylheptanoic acid methyl ester (obtained by esterification of (S)-3-methylheptanoic acid) with dimethyl methylphosphonate, therefore, (S)-3-methylheptanoic acid is an important chiral intermediate for the synthesis of limaprost.

[0006] The main synthetic challenge of (S)-3-methylheptanoic acid lies in the presence of a tertiary carbon chiral center with an S configuration at the β-position of the carbonyl group. Although various synthetic routes have been reported, these methods are typically complex and difficult to obtain chiral sources, hindering large-scale production. For example, Teruaki Mukaiyama of the University of Tokyo developed a method to prepare (S)-3-methylheptanoic acid using a Grignard reagent via Michael addition to an unsaturated amide; Kenji Mori's group synthesized (S)-3-methylheptanoic acid via a multi-step reaction using ethyl (S)-3-butyrate as a starting material; Chiu's group reported a six-step method to prepare (S)-3-methylheptanoic acid using the natural chiral source (S)-citronellol as a starting material; and Dolores Bada's group in Spain synthesized (S)-3-methylheptanoic acid via an asymmetric conjugate addition reaction using (S,S)-(+)-pseudoephedrine as a chiral cofactor. However, these methods generally have significant drawbacks, such as expensive and rare starting materials, the need for high temperature and high pressure conditions for the reaction, and the unavoidable use of toxic and harmful reagents. Therefore, developing a green, efficient, and simple method for the synthesis of (S)-3-methylheptanoic acid remains of great research significance and application value. Summary of the Invention

[0007] This invention aims to at least solve one of the aforementioned technical problems existing in the prior art. Therefore, the objective of this invention is to provide a method for the biosynthesis of (S)-3-methylheptanoic acid. This method utilizes the high catalytic activity and stereoselectivity of the nitrile hydrolase mutant developed in this invention to overcome the shortcomings of existing methods, such as low substrate concentration, poor stereoselectivity, high cost, and environmental pollution. It enables the synthesis of (S)-3-methylheptanoic acid based on 3-methylheptanilide, achieving rapid substrate catalysis at high substrate concentrations, good enzyme catalysis effect, high product purity, high recovery rate, simple steps, and environmental friendliness.

[0008] In a first aspect, the present invention provides a nitrile hydrolase mutant, the nitrile hydrolase mutant comprising:

[0009] (1) A nitrile hydrolase mutant obtained by substituting, deleting, or adding 1-7 amino acid residues in the sequence shown in SEQ ID NO: 2; or

[0010] (2) A nitrile hydrolase mutant with at least 95% sequence identity and retaining catalytic activity compared to the one shown in SEQ ID NO: 2.

[0011] In some embodiments of the present invention, the number of amino acid residues replaced, deleted, or added is 1-5.

[0012] In some embodiments of the present invention, the number of amino acid residues replaced, deleted, or added is 1, 2, 3, 4, or 5.

[0013] In some embodiments of the present invention, the nitrile hydrolase mutant is a nitrile hydrolase mutant obtained by replacing 1, 2, 3, 4 or 5 amino acid residues in the sequence shown in SEQ ID NO: 2.

[0014] In some embodiments of the present invention, the nitrile hydrolase mutant has at least 98% or 99% sequence identity.

[0015] In this invention, the term "retaining catalytic activity" refers to protecting the catalytic activity against the substrate, which in this invention is 3-methylheptanenitrile. In this invention, "retaining catalytic activity" includes having catalytic activity similar to or stronger than that of the nitrile hydrolase shown in SEQ ID NO: 2, including having a catalytic efficiency or catalytic capacity of 50%-10000% compared to the nitrile hydrolase shown in SEQ ID NO: 2.

[0016] In some embodiments of the present invention, the nitrile hydrolase mutant has at least 99% sequence identity.

[0017] In some embodiments of the present invention, the positions where the amino acid residues are replaced, deleted, or added include: amino acid residues at positions 18, 69, 108, 202, and 225, based on the sequence shown in SEQ ID NO: 2.

[0018] In some embodiments of the present invention, the amino acid residue substitutions include at least one of A18I, V69M, V108I, F202L, and T225S.

[0019] In some embodiments of the present invention, the amino acid residue substitutions include combinations of A18I, V69M, V108I, F202L, and T225S.

[0020] In some embodiments of the present invention, the nitrile hydrolase mutant includes: a nitrile hydrolase mutant having the sequence shown in SEQ ID NO:17-22.

[0021] In some embodiments of the present invention, the mutant Nit-2-A18I of nitrile hydrolase Nit-2 is mutated from A to I at position 18, and the amino acid sequence is shown in SEQ ID NO:17.

[0022] In some embodiments of the present invention, the mutant Nit-2-V69M of nitrile hydrolase Nit-2 has a mutation of V to M at position 69, and the amino acid sequence is shown in SEQ ID NO:18.

[0023] In some embodiments of the present invention, the mutant Nit-2-A18I / V69M of nitrile hydrolase Nit-2 has an A mutation at position 18 to I and a V mutation at position 69 to M, and the amino acid sequence is shown in SEQ ID NO:19.

[0024] In some embodiments of the present invention, the mutant Nit-2-A18I / V69M / V108I of nitrile hydrolase Nit-2 has an A mutation at position 18 to I, a V mutation at position 69 to M, and a V mutation at position 108 to I, with the amino acid sequence as shown in SEQ ID NO:20.

[0025] In some embodiments of the present invention, the mutant Nit-2-A18I / V69M / V108I / F202L of nitrile hydrolase Nit-2 has the following amino acid sequence: A at position 18 is mutated to I, V at position 69 is mutated to M, V at position 108 is mutated to I, and F at position 202 is mutated to L. The amino acid sequence is as shown in SEQ ID NO:21.

[0026] In some embodiments of the present invention, the mutant Nit-2-A18I / V69M / V108I / F202L / T225S of nitrile hydrolase Nit-2 has the following amino acid sequence: A at position 18 is mutated to I, V at position 69 is mutated to M, V at position 108 is mutated to I, F at position 202 is mutated to L, and T at position 225 is mutated to S.

[0027] Compared with the parent Nit-2, the catalytic activities of the above mutants were increased by 1.54, 1.32, 1.86, 3.72, 7.26 and 10.41 times, respectively.

[0028] Conservative substitutions, additions or deletions of one or more amino acids, amino-terminal truncation, and carboxyl-terminal truncation of other amino acid sites of the above-mentioned nitrile hydrolases are also included within the scope of this invention.

[0029] In a second aspect, the present invention provides a nucleic acid molecule encoding the esterase mutant described above.

[0030] In some embodiments of the present invention, the nucleic acid molecule has the sequence shown in SEQ ID NO:23-28.

[0031] In some embodiments of the present invention, the nucleic acid molecule is further linked with a modifying sequence and / or a functional sequence.

[0032] In some embodiments of the present invention, the modified sequence and / or functional sequence includes at least one of the following: signal peptide, promoter, enhancer, terminator, tool enzyme recognition site, ribozyme, self-cleaving intron, miRNA binding site or ribosome binding site (RBS).

[0033] A third aspect of the present invention provides a biomaterial comprising any one of the following (1)-(3):

[0034] (1) An expression unit containing the nucleic acid molecules described above;

[0035] (2) Transformants containing the nucleic acid molecules described above;

[0036] (3) Transformers containing the expression in (1).

[0037] In some embodiments of the present invention, the expression unit includes a plasmid.

[0038] In this invention, the term "expression vector" refers to a vector or expression system used to integrate or insert a targeted exogenous gene.

[0039] In some embodiments of the present invention, the transformants include bacteria, fungi, viruses, plant cells, or animal cells.

[0040] In this invention, the term "transformant" refers to a recipient cell that acquires a new genetic marker after incorporation or introduction of a foreign gene.

[0041] In some embodiments of the present invention, the transformant does not involve plant or animal reproductive materials.

[0042] In some embodiments of the present invention, the transformants include common cell vectors such as Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, and Pichia pastoris.

[0043] In some embodiments of the present invention, the construction of the expressants and transformants can be achieved based on any conventional techniques in the art.

[0044] In this invention, the genetically engineered bacteria producing nitrile hydrolase are obtained by inserting the encoding nucleotide sequence of nitrile hydrolase into a plasmid vector to form a recombinant vector, which is then transformed into host cells. The plasmid vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, animal cell viruses, retroviruses, or other vectors well-known in the art. The vectors used in this invention include, but are not limited to, the pET-28a vector expressed in *E. coli*. Any vector that can stably replicate and exist in host cells can be used to construct a recombinant expression vector.

[0045] In some embodiments of the present invention, the recombinant vector is obtained by inserting the nitrile hydrolase DNA fragment into the multiple cloning site of the pET-28a vector to obtain the recombinant plasmid pET-28a-Nit. Optionally, the cloning site is an NdeI restriction site and a SalI restriction site.

[0046] In some embodiments of the present invention, the host cell includes prokaryotic cells, such as archaea cells, bacterial cells, or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells.

[0047] In some embodiments of the present invention, the genetically engineered bacteria that produce nitrile hydrolase are recombinant engineered bacteria constructed from Escherichia coli BL21.

[0048] A fourth aspect of the present invention provides a composition comprising at least one of the nitrile hydrolase mutant, nucleic acid molecule, and biological material described in the above aspects.

[0049] In some embodiments of the present invention, the composition further includes excipients.

[0050] In some embodiments of the present invention, the excipients are rationally selected based on factors such as the product form of the composition, its intended use, and the route of administration, and include, but are not limited to: diluents (such as starch, dextrin, sucrose, lactose, mannitol, etc.), absorbents (such as calcium sulfate, dicalcium phosphate, etc.), wetting agents (such as ethanol), binders (such as hydroxypropyl methylcellulose, povidone, etc.), disintegrants (such as sodium hydroxymethyl starch, crospovidone, etc.), lubricants (such as talc, hydrogenated vegetable oil, polyethylene glycol, etc.), colorants (such as titanium dioxide, methylene blue, etc.), coating materials, solvents, pH adjusters, antibacterial agents (such as sodium sulfite, sodium thiosulfate, etc.), isotonic adjusters (such as glucose, sodium chloride, etc.), and chelating agents (such as disodium EDTA).

[0051] A fifth aspect of the invention provides the use of at least one of the nitrile hydrolase mutants, nucleic acid molecules, biomaterials, and compositions described above in biosynthesis.

[0052] In some embodiments of the present invention, the biosynthesis includes at least one of biocatalytic reaction, biofermentation and bioenzymatic hydrolysis.

[0053] In some embodiments of the present invention, the biosynthesis is a biocatalytic reaction.

[0054] In some embodiments of the present invention, at least one of the nitrile hydrolase mutant, nucleic acid molecule, biomaterial and composition is used in the preparation of lima prostaglandin or an intermediate thereof during the biocatalytic reaction.

[0055] In some embodiments of the present invention, the intermediate includes (S)-3-methylheptanoic acid.

[0056] In some embodiments of the present invention, the ee value of the product (S)-3-methylheptanoic acid is greater than 99%; or

[0057] The product (S)-3-methylheptanoic acid has a purity greater than 99% and a single impurity of less than 0.5%.

[0058] A sixth aspect of the present invention provides a method for preparing (S)-3-methylheptanoic acid, comprising the following steps:

[0059] At least one of the nitrile hydrolase mutants, nucleic acid molecules, biomaterials and compositions described above is used to catalyze 3-methylheptanonitrile.

[0060] In some embodiments of the present invention, the catalytic conditions include: a catalytic temperature of 15-50°C and a catalytic time of 2-30 h.

[0061] In some embodiments of the present invention, the catalytic conditions include: a catalytic temperature of 28-37°C and a catalytic time of 18-30 h.

[0062] In some embodiments of the present invention, the catalytic temperature is 30-35°C.

[0063] In some embodiments of the present invention, the catalytic temperature is 30°C.

[0064] In some embodiments of the present invention, the catalytic time is 20-26 hours.

[0065] In some embodiments of the present invention, the catalytic time is 24 hours.

[0066] In some embodiments of the present invention, the catalytic system further contains a solvent.

[0067] In some embodiments of the present invention, the solvent includes a buffer solution.

[0068] In some embodiments of the present invention, the buffer solution comprises a phosphate buffer solution.

[0069] In some embodiments of the present invention, the pH of the catalytic system is 6-10.

[0070] In some embodiments of the present invention, the pH of the catalytic system is 6-8.

[0071] In some embodiments of the present invention, at least one of the nitrile hydrolase mutant, nucleic acid molecule, biomaterial, and composition is used as a catalyst.

[0072] In some embodiments of the present invention, the form of the catalyst is not limited, and may include wet bacterial cells, wet bacterial cells immobilized with cells, enzymes extracted from wet bacterial cells after ultrasonic disruption, or immobilized enzymes. When it is a wet bacterial cell, the water content is 70-90% by mass.

[0073] In some embodiments of the present invention, the culture medium for the bacteria may be any suitable culture medium in the art, including but not limited to LB medium.

[0074] In some embodiments of the present invention, the catalytic reaction is carried out in a single aqueous phase system.

[0075] In some embodiments of the present invention, the substrate dosage is 50-120 g / L.

[0076] In some embodiments of the present invention, the substrate dosage is 120 g / L.

[0077] Nitrile hydrolase is added in the form of wet cells of genetically engineered bacteria that produce nitrile hydrolase, with a wet cell concentration of 5-30 g / L.

[0078] In this invention, the nitrile hydrolase can be a culture of the aforementioned recombinant nitrile hydrolase genetically engineered bacteria, or it can be bacterial cells obtained by centrifuging the culture medium or its processed products. The processed products refer to extracts obtained from bacterial cells, lysates, or isolated products obtained by separating and / or purifying the nitrile hydrolase from the extract, or immobilized products obtained by immobilizing the extract or processed products.

[0079] In some embodiments of the present invention, the weight ratio of substrate to catalyst is 5-15:40-60.

[0080] In some embodiments of the present invention, the weight ratio of substrate to catalyst is approximately 1:5.

[0081] In this invention, the term "about" means a deviation of less than or equal to 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.

[0082] A seventh aspect of the present invention provides a method for preparing limaprost, comprising the following steps:

[0083] (1) Using at least one of the nitrile hydrolase mutants, nucleic acid molecules, biological materials and compositions described above, 3-methylheptanonitrile is catalyzed to obtain (S)-3-methylheptanonic acid;

[0084] (2) Limaprost was prepared using (S)-3-methylheptanoic acid.

[0085] In some embodiments of the present invention, the preparation method in step (2) is not limited and can be prepared by any known preparation method in the art.

[0086] In some embodiments of the present invention, the catalytic conditions are limited as defined above.

[0087] In some embodiments of the present invention, the catalytic system is defined as described above.

[0088] In some embodiments of the present invention, the weight ratio of substrate to catalyst is limited as defined above.

[0089] The beneficial effects of this invention are:

[0090] 1. This invention has developed a variety of nitrile hydrolase mutants, which are obtained by codon optimization and mutation of the original nitrile hydrolase. By constructing expression vectors and transforming host cells to form recombinant engineered bacteria, these mutants can be used for the preparation of (S)-3-methylheptanoic acid after fermentation.

[0091] 2. The nitrile hydrolase mutant and the method for preparing (S)-3-methylheptanoic acid based on the nitrile hydrolase mutant in this invention have many advantages, such as high efficiency and high regioselectivity in hydrolyzing 3-methylheptanilide to generate (S)-3-methylheptanoic acid, good enzyme catalytic effect, high product purity, simple route, convenient subsequent purification, and suitability for industrial production. Attached Figure Description

[0092] Figure 1 This is a schematic diagram of the nitrile hydrolase Nit-2 molecular docking.

[0093] Figure 2 This is a flowchart of the reaction process of nitrile hydrolase Nit-2-M5 in a 30L system. Detailed Implementation

[0094] The present invention will be further described in detail below through specific embodiments. Unless otherwise specified, the raw materials, reagents, or apparatus used in the embodiments and comparative examples are all available from conventional commercial sources or can be obtained by existing technical methods. Unless otherwise specified, the test or experimental methods are conventional methods in the art.

[0095] Example 1

[0096] In this embodiment, recombinant expression vectors were constructed and tested using different existing nitrile hydrolases, and suitable nitrile hydrolases templates for subsequent mutation modification were screened.

[0097] In this embodiment, a total of 6 nitrile hydrolases from different sources were included. The full genome sequences of the 6 nitrile hydrolases were synthesized by Beijing Qingke Biotechnology Co., Ltd. (specific sequence information is shown in Table 1), and they were named nitrile hydrolases Nit-1, Nit-2, Nit-3, Nit-4, Nit-5 and Nit-6, respectively.

[0098] Codon optimization was performed on six nitrile hydrolases, and corresponding restriction sites were added to both ends of the optimized sequences. These were then constructed into the corresponding vectors (pET28a) to obtain recombinant plasmid vectors for the nitrile hydrolases. Following the technical manual, the obtained recombinant plasmid vectors were transformed into *E. coli* BL21 using conventional methods (such as CaCl2 transformation or electroporation) to obtain the recombinant genetically engineered bacteria: *E. coli* BL21(DE3) / pET28a-Nit-1, *E. coli* BL21(DE3) / pET28a-Nit-2, *E. coli* BL21(DE3) / pET28a-Nit-3, *E. coli* BL21(DE3) / pET28a-Nit-4, *E. coli* BL21(DE3) / pET28a-Nit-5, and *E. coli* BL21(DE3) / pET28a-Nit-6.

[0099] Table 1 Information on Nitrile Hydrolases

[0100]

[0101]

[0102] The six recombinant genetically engineered bacteria obtained in the above steps were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, they were inoculated at a 2% inoculation rate (v / v) into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C and 150 rpm until the bacterial concentration (OD600) reached approximately 0.6. Isopropyl-β-D-thiogalactoside (IPTG, as an inducer to induce the expression of the target protein) was added to a final concentration of 0.1 mM, and the culture was induced at 28°C for 12 h. The cells were then collected by centrifugation at 4°C and 12000 rpm for 10 min. The collected wet cells were washed with 0.85% physiological saline and then stored at -20°C for later use. The final wet cells (or resting cells) can be used for the subsequent hydrolysis reaction of 3-methylheptanonitrile.

[0103] The wet bacterial cells obtained in the above steps (i.e., recombinant Escherichia coli containing nitrile hydrolases Nit-1, Nit-2, Nit-3, Nit-4, Nit-5, and Nit-6) were used as catalysts to carry out the hydrolysis reaction of 3-methylheptanilonitrile. The reaction system is shown in the table below.

[0104] Table 2. Hydrolysis reaction system of 3-methylheptanenitrile

[0105] Ingredients Amount Phosphate buffer (100 mM, pH 8.0) 10 mL 3-methyl heptanonitrile 0.5g Wet cell mass 0.3g

[0106] The reaction system was reacted at 30℃ for 2 h. After the reaction was completed, 0.5 mL of the reaction product was taken as a sample, and 100 μL of 1M HCl was added to terminate the reaction. Extraction was performed using 0.5 mL of ethyl acetate. Then, the mixture was centrifuged at 12000 rpm for 1 min to separate the layers. The upper organic phase was dried with anhydrous sodium sulfate, and the concentrations of 3-methylheptanilonitrile and (S)-3-methylheptanoic acid were determined.

[0107] The results are shown in the table below.

[0108] Table 3 Effect of different nitrile hydrolase templates on the yield of 3-methylheptannitrile

[0109] Cyanohydrin lyase template Substrate peak area percentage (%) Product peak area percentage (%) Nit-1 88 12 Nit-2 14 86 Nit-3 95 5 Nit-4 92 8 Nit-5 97 3 Nit-6 94 6

[0110] It was observed that Nit-1, Nit-3, Nit-4, Nit-5, and Nit-6 exhibited only weak enzyme activity towards 3-methylheptanonitrile, leaving a significant amount of substrate unreacted. In contrast, Nit-2 showed high substrate activity, with most of the substrate hydrolyzed and a substantial amount of the desired product produced. Further analysis of the product revealed an ee value greater than 98%. Therefore, Nit-2 was selected as the template for the nitrile hydrolase.

[0111] Example 2

[0112] In this embodiment, a method for constructing a nitrile hydrolase mutant library based on Nit-2 is provided, specifically as follows:

[0113] To enhance the catalytic activity of the nitrile hydrolase Nit-2, the inventors investigated the selection of mutation sites for the nitrile hydrolase. Specifically, this was achieved through molecular docking and kinetic simulations (such as...). Figure 1 The energy of key sites on the nitrile hydrolase was calculated (as shown), and some reasonable sites were selected for site-directed mutagenesis. Preferred mutations included: A at position 18 changing to I, V at position 69 changing to M, V at position 108 changing to I, F at position 202 changing to L, and T at position 225 changing to S. Corresponding primers were designed for each mutation site to facilitate the mutation.

[0114] The specific primer information is shown in the table below.

[0115] Table 4 Primer information for nitrile hydrolase mutation sites.

[0116] Primer name Primer sequence (5’-3’) A18I-F AACATTCGCGCGGCGATCGCGCAGATT (SEQ ID NO: 7) A18I-R AATCTGCGCGATCGCCGCGCGAATGTT (SEQ ID NO: 8) V69M-F CTTTGTGGAACCGCCGATGCTGATGGGCAAAAGC (SEQ ID NO: 9) V69M-R GCTTTTGCCCATCAGCATCGGCGGTTCCACAAAG (SEQ ID NO: 10) V108I-F ATGGTGGTGGTGCTGGGCATCAACGAACGCGAAGAA (SEQ ID NO: 11) V108I-R TTCTTCGCGTTCGTTGATGCCCAGCACCACCACCAT (SEQ ID NO: 12) F202L-F TGGGCCAGATTCTGGCGGATCAGATGGAAGTGACCATG (SEQ ID NO: 13) F202L-R CATGGTCACTTCCATCTGATCCGCCAGAATCTGGCCCA (SEQ ID NO: 14) T225S-F GTGATTAACGCGAGCGGCTGGCTGACCGCGG (SEQ ID NO: 15) T225S-R CCGCGGTCAGCCAGCCGCTCGCGTTAATCAC (SEQ ID NO: 16)

[0117] Using the recombinant plasmid pET28a-Nit-2 containing Nit-2 as a template, the template was amplified using the overlap extension PCR method. The amplification system is shown in the table below.

[0118] Table 5 PCR amplification system

[0119] Ingredients Amount Template 0.1 ng - 1 ng 2x Phanta Max Buffer (New England Biolabs) 25 μL dNTPs (10 mM each) 1 μL Upstream and downstream primers 1 μL each Phanta Max Super-Fidelity DNA Polymerase (New England Biolabs) 1U ddH2O q.s. 50 μL

[0120] The reaction procedure was as follows: pre-denaturation at 95℃ for 30 seconds; denaturation at 95℃ for 30 seconds, annealing at 65℃ for 30 seconds, extension at 72℃ for 6 minutes, repeated 30 times; complete extension at 72℃ for 7 minutes, and storage at 16℃.

[0121] After the PCR product was positive by 0.9% agarose gel electrophoresis, 20 μL of PCR reaction solution was taken, and 1 μL of restriction enzyme Dpn I was added. The DNA in the template was removed by digestion at 37℃ for 3 h, followed by inactivation at 65℃ for 10 min. The reaction product was heat-shocked and transformed into E. coli BL21(DE3) competent cells. After recovery, the cells were plated on LB agar plates containing 50 μg / mL kanamycin and cultured overnight. Each plate yielded a mutant library of approximately 300 clones. Subsequently, 4-5 clones were picked and cultured on LB medium at 37℃ for 8 h. Sequencing was then performed to verify the nitrile hydrolase recombinant engineered bacteria E. coli BL21(DE3) / pET28a-Nit-2-A18I and E. coli BL21(DE3) / pET28a-Nit-2-V69M. Then, using the same method, multi-mutant recombinant E. coli was prepared based on the single-mutant recombinant engineered bacteria.

[0122] BL21(DE3) / pET28a-Nit-2-A18I / V69M, E.coli BL21(DE3) / pET28a-Nit-2-A18I / V69M / V108I, E.coli

[0123] BL21(DE3) / pET28a-Nit-2-A18I / V69M / V108I / F202L, E. coli BL21(DE3) / pET28a-Nit-2-A18I / V69M / V108I / F202L / T225S.

[0124] The amino acid sequences of the nitrile hydrolase mutants are shown in SEQ ID NO: 17-22 and SEQ ID NO: 23-28.

[0125] Example 3

[0126] Using the nitrile hydrolase mutant obtained in Example 2 as a catalyst, a catalytic reaction of 3-methylheptanenitrile was carried out to test the effect of each mutant.

[0127] The specific experimental steps were as follows: various nitrile hydrolase mutants were resuspended in 10 mL of phosphate buffer (0.1 M, pH 7.0) (final concentration 10 g / L), and then 0.5 g of 3-methylheptanonitrile was added to the reaction system (final substrate concentration 50 g / L). The reaction was carried out at 30 °C and 1200 rpm for 0.5 h. Samples were taken for analysis, and the results are shown in the table below.

[0128] Table 6. Effects of different nitrile hydrolase mutants on the yield of 3-methylheptannitrile.

[0129] Enzyme Relative activity (%) NIT-2 100 NIT-2-A18I 154 NIT-2-V69M 132 NIT-2-A18I / V69M 186 NIT-2-A18I / V69M / V108I 372 NIT-2-A18I / V69M / V108I / F202L 726 NIT-2-A18I / V69M / V108I / F202L / T225S 1041

[0130] It was found that, compared to the parental Nit-2, the single mutants A18I and V69M exhibited increased activity of 154% and 132%, respectively, and the combined activity (i.e., the double mutant) was 186% of the wild type. Further modification by adding mutations at three sites—V108I, F202L, and T225S—to the double mutant resulted in a significant further increase in activity. The Nit-2-A18I / V69M / V108I / F202L / T225S (referred to as Nit-2-M5) showed the highest activity, at 1041% of the parental activity. Therefore, it was chosen as Nit-2-M5 for subsequent experiments.

[0131] Example 4

[0132] In this embodiment, the substrate concentration was further optimized based on recombinant Escherichia coli containing nitrile hydrolase Nit-2-M5.

[0133] The specific steps are as follows: Using the recombinant *E. coli* containing nitrile hydrolase Nit-2-M5 prepared in Example 3 as a catalyst, catalytic reactions were tested at different substrate concentrations (50 g / L-120 g / L). Specifically, 0.05-0.3 g of recombinant *E. coli* containing nitrile hydrolase Nit-2-M5 was resuspended in 10 mL of phosphate buffer (100 mM, pH 8.0), and then 0.5-1.2 g of 3-methylheptanonitrile was added to the reaction system. The reaction was carried out at 30 °C for 24 h. 0.5 mL of the sample was taken, and 100 μL of 1 M HCl was added to terminate the reaction. Extraction was performed using 0.5 mL of ethyl acetate. The mixture was then centrifuged at 12000 rpm for 1 min to separate the layers. The upper organic phase was dried with anhydrous sodium sulfate, and the concentrations and ee values ​​of 3-methylheptanonitrile and (S)-3-methylheptanonic acid were determined.

[0134] The results are shown in the table below.

[0135] Table 7. Effects of Nit-2-M5 recombinant E. coli catalyzing different substrate concentrations.

[0136] Cell mass concentration (g / L) Substrate concentration (g / L) Conversion rate (%) ee p (%)]] 5 50 41.2 99.3 10 50 49.5 98.7 15 60 49.6 98.5 15 70 49.1 98.9 20 80 49.4 98.6 25 100 49.0 98.9 30 120 48.5 98.8

[0137] It was observed that the nitrile hydrolase mutant Nit-2-M5 failed to completely catalyze a substrate concentration of 50 g / L at a cell concentration of 5 g / L. Increasing the cell concentration to 10 g / L resulted in near-complete reaction of the 50 g / L substrate after 24 hours. However, at substrate concentrations of 60, 70, 80, 100, and 120 g / L, 15, 15, 20, 25, and 30 g / L cells were required for complete substrate catalysis, respectively, with product chirality exceeding 98%. Considering that further increasing the substrate concentration would require excessive cell volume, which would be detrimental to subsequent processing, a substrate concentration of 120 g / L was chosen as the optimal substrate loading.

[0138] Example 5

[0139] In this embodiment, the catalytic synthesis of two different scale systems was verified using the nitrile hydrolase mutant Nit-2-M5 under the optimal conditions explored in the above embodiments.

[0140] (1) Catalytic synthesis in a small-scale system (1L):

[0141] The recombinant *E. coli* containing the nitrile hydrolase Nit-2-M5 prepared in Example 3 was used as a catalyst for the catalytic synthesis of (S)-3-methylheptanilic acid. Specifically, 30 g of the recombinant *E. coli* containing the nitrile hydrolase Nit-2-M5 was resuspended in 1 L of phosphate buffer (100 mM, pH 8.0), and then 120 g of 3-methylheptanilic acid was added to the reaction system. The reaction was carried out at 30 °C for 24 h. 0.5 mL of the sample was taken, and 100 μL of 1 M HCl was added to terminate the reaction. Extraction was performed using 0.5 mL of ethyl acetate. The mixture was centrifuged at 12000 rpm for 1 min to separate the layers. The upper organic phase was analyzed to determine the reaction progress. It was found that the substrate was almost completely consumed. All products were extracted, centrifuged, and the organic phase was separated. A small amount of anhydrous sodium sulfate was added to remove water. The dehydrated organic phase was rotary evaporated at 45°C, yielding 58.3 g of crude product with an ee value of 98.8% and a yield of 42.2% (theoretical yield 50%, 69.0 g).

[0142] (2) Catalytic synthesis in a large-scale system (30L):

[0143] The recombinant *E. coli* containing the nitrile hydrolase Nit-2-M5 prepared in Example 3 was used as a catalyst for the catalytic synthesis of (S)-3-methylheptanilic acid. Specifically, 900 g of the recombinant *E. coli* containing the nitrile hydrolase Nit-2-M5 was resuspended in 30 L of phosphate buffer (100 mM, pH 8.0), and then 3600 g of 3-methylheptanilic acid was added to the reaction system. The reaction was carried out at 30 °C for 24 h. During this period, 0.5 mL of the sample was taken at regular intervals, and 100 μL of 1 M HCl was added to terminate the reaction. Extraction was performed using 0.5 mL of ethyl acetate. The mixture was centrifuged at 12000 rpm for 1 min to separate the layers, and the upper organic phase was analyzed to determine the reaction progress. It was found that the substrate was almost completely consumed after 24 h (e.g., ...). Figure 2 As shown in the figure, the conversion rate of 0.5 mL sample was 49.2%, and the ee value of the product was 98.8%. All products were extracted, centrifuged, and the organic phase was separated. A small amount of anhydrous sodium sulfate was added to remove water. The dehydrated organic phase was rotary evaporated at 45 °C, and 1743 g of crude product was harvested, with an ee value of 99.0% and a yield of 42.1%.

[0144] Therefore, the biocatalytic synthesis method of the present invention can be effectively used for the synthesis of (S)-3-methylheptanoic acid on any scale, and thus can be effectively used for the preparation of related drugs.

[0145] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A nitrile hydrolase mutant, characterized in that, The nitrile hydrolase mutant includes: (1) A nitrile hydrolase mutant obtained by substituting, deleting, or adding 1-7 amino acid residues in the sequence shown in SEQ ID NO: 2; or (2) A nitrile hydrolase mutant that has at least 95% sequence identity with SEQ ID NO: 2 and retains catalytic activity; Preferably, the number of amino acid residues replaced, deleted, or added is 1-5; Preferably, the nitrile hydrolase mutant has at least 98% sequence identity.

2. The nitrile hydrolase mutant according to claim 1, characterized in that, The positions where the amino acid residues are replaced, deleted, or added include: amino acid residues at positions 18, 69, 108, 202, and 225, based on the sequence shown in SEQ ID NO: 2; Preferably, the amino acid residue substitution includes at least one of A18I, V69M, V108I, F202L, and T225S.

3. The nitrile hydrolase mutant according to claim 1 or 2, characterized in that, The nitrile hydrolase mutant includes: Nitrile hydrolase mutants having the sequences shown in SEQ ID NO:17-22.

4. A nucleic acid molecule encoding the esterase mutant according to any one of claims 1-3; Preferably, the nucleic acid molecule has the sequence shown in SEQ ID NO:23-28.

5. A biomaterial, characterized in that, The biomaterial includes any one of the following (1)-(3): (1) Contains an expression unit of the nucleic acid molecule of claim 4; (2) A transformant containing the nucleic acid molecule of claim 4; (3) Transformants containing the expression in (1); Preferably, the expression unit includes a plasmid; Preferably, the transformant includes bacteria, fungi, viruses, plant cells, or animal cells.

6. A composition, characterized in that, The composition contains at least one of the following: the nitrile hydrolase mutant according to any one of claims 1-3, the nucleic acid molecule according to claim 4, and the biomaterial according to claim 5; Preferably, the composition further includes excipients.

7. The use of at least one of the nitrile hydrolase mutants according to any one of claims 1-3, the nucleic acid molecule according to claim 4, the biomaterial according to claim 5, and the composition according to claim 6 in biosynthesis; Preferably, the biosynthesis includes at least one of biocatalytic reaction, biofermentation and bioenzymatic hydrolysis.

8. The use of at least one of the nitrile hydrolase mutant of any one of claims 1-3, the nucleic acid molecule of claim 4, the biomaterial of claim 5, and the composition of claim 6 in the preparation of lima prostol or an intermediate thereof; Preferably, the intermediate comprises (S)-3-methylheptanoic acid.

9. A method for preparing (S)-3-methylheptanoic acid, comprising the following steps: At least one of the nitrile hydrolase mutants of any one of claims 1-3, the nucleic acid molecule of claim 4, the biomaterial of claim 5, and the composition of claim 6 is used to catalyze 3-methylheptanenitrile.

10. A method for preparing limaprost, comprising the following steps: (1) Using at least one of the nitrile hydrolase mutants of any one of claims 1-3, the nucleic acid molecule of claim 4, the biomaterial of claim 5, and the composition of claim 6 to catalyze the production of (S)-3-methylheptane; (2) Limaprost was prepared using (S)-3-methylheptanoic acid.

Images