Atgaloxs gene and its application in regulating plant organ size development

Abstract

This invention belongs to the field of plant breeding and genetic engineering technology, specifically involving AtGalOxs Genes and their application in regulating plant organ size and development. Specifically, this invention screened a gene that regulates plant organ size and development. AtGalOxs It was identified as a key gene regulating the size and development of organs in Arabidopsis thaliana plants, and this was confirmed through cytological observation and transcriptome analysis. AtGalOxs Genes function by regulating cell proliferation and auxin signaling pathways, providing new theoretical basis for elucidating the molecular network regulating plant organ size; AtGalOxs The gene can be directly applied to the regulation of Arabidopsis plant architecture, and its homologous genes are conserved in crops such as Brassicaceae. This provides key gene resources for improving crop plant architecture and increasing yield, which is of great significance for promoting the development of plant molecular breeding technology and improving agricultural production efficiency.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and genetic engineering technology, specifically involving AtGalOxs Genes and their application in regulating the size and development of plant organs. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Arabidopsis thaliana ( Arabidopsis thaliana As a "model plant" for plant molecular biology and genetics research, the research results on gene function and regulatory mechanisms can be widely applied to basic research and breeding practices in cruciferous crops (such as Chinese cabbage, kale, and rapeseed) and even other plants. The size of plant organs is a core trait that determines plant biomass and crop agronomic yield. Its development process depends on the dynamic balance of cell proliferation and cell expansion and is precisely regulated by a complex signaling network centered on auxin, gibberellin, and cytokinin.

[0004] In recent years, several genes controlling leaf size have been isolated from Arabidopsis thaliana and rice, regulating two main processes: cell expansion and cell proliferation. Regarding cell expansion... ARL , TOR Genes play a positive regulatory role. AtKIN-13A , ARF8 Genes, on the other hand, provide negative regulation. Cell proliferation regulation is more complex, with the ANT and TCP-GRF pathways at its core: In the ANT pathway, plants receive auxin signals to induce ARGOS expression, which in turn regulates... ANT Genes ultimately regulate cell cycle proteins CYCD3 Horizontal influence on proliferation, Arabidopsis thaliana ARGOS , ANT Increases or decreases in miR319 expression significantly alter the size of organs such as leaves and inflorescences; in the TCP-GRF pathway, miR319 regulates... TCP2 / 3 / 4 / 10 / 24 (Class II), miR319 increases in the jaw-D mutant, inhibiting these... TCP Genes cause leaf edge cells to divide more rapidly and form a wavy shape, and GRF Gibberellin-induced cell number control in leaves is achieved by regulating cell cycle genes. Furthermore, Class I... TCP , SWP , CYP78A7 Positive regulation of cell proliferation, DA , ROT4 , NGA It then has a negative regulatory effect.

[0005] The Galactose oxidase / kelch repeat superfamily of proteins, possessing both a galactose oxidase domain (responsible for catalyzing the oxidation of galactose residues) and a kelch repeat domain (mediating protein-protein interactions), has become a key molecule connecting glucose metabolism remodeling and cell cycle regulation. This gene family exhibits multidimensional regulatory potential in plant growth and development, but research on its role in regulating plant size development is scarce. Furthermore, plant size development is a complex network regulated by multiple genes, with diverse regulatory pathways and unclear regulatory mechanisms. Identifying key genes regulating plant development in model plants such as Arabidopsis thaliana, clarifying their regulatory mechanisms, and applying them to other crops, especially cruciferous crops, to improve crop yield is of great significance. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide... AtGalOxs Genes and their application in regulating plant organ size and development. Specifically, the applicant screened a mutant plant (named...) in an Arabidopsis thaliana population using EMS mutagenesis, resulting in a mutant plant with overall smaller plant organs (including roots, stems, and leaves). so We constructed an F2 population by crossing a mutant with wild-type Arabidopsis thaliana. Then, using BSA (Bulked segregation analysis), we located a candidate gene, AT2G03460, which regulates plant organ size development. GalOxs (Galactose oxidase / kelchrepeat protein) family genes, hence the name AtGalOxs Studies have shown that... GalOxs Primarily located in the cytoplasm, it may exhibit biochemical activities similar to RUBY, promoting adhesion between seed coat epidermal cells. The applicant, through constructing an F2 population, found it to meet a 3:1 segregation ratio. This result indicates that the organ-shrinking mutant trait is controlled by a single dominant nuclear gene, consistent with the single candidate gene previously identified through BSA localization. AtGalOxs The genetic mapping results showed a high degree of agreement, further confirming... AtGalOxs This gene is highly likely a key functional gene regulating the size and development of organs in Arabidopsis thaliana plants. A gene function complementation verification experiment was conducted by constructing... AtGalOxsThe gene overexpression vector (pCAMBIA1300-AtGalOxs-GFP) was transformed into mutant plants using Agrobacterium-mediated inflorescence staining. The results showed that the organ size of the transgenic progeny recovered to the wild-type level, further demonstrating the direct function of this gene in regulating plant organ size and development. Simultaneously, a CRISPR / Cas9 knockout vector for this gene was constructed and transformed into wild-type Arabidopsis. The organ phenotypes of homozygous knockout plants (ko-atgaloxs) were identified, revealing that the knockout plants exhibited a smaller organ (root, stem, and leaf) phenotype consistent with the EMS-induced mutant, further validating the gene's role. AtGalOxs The regulatory role of genes in the size and development of plant organs. Based on the above research findings, this invention was completed.

[0007] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution: The first aspect of the present invention provides a gene, which is named AtGalOxs The gene is selected from: (a1) The nucleotide sequence shown in SEQ ID NO.1; (a2) and (a1) are nucleotide sequences that encode proteins with the same amino acid sequence, but are different in sequence due to the degeneracy of the genetic code; (a3) has ≥90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence identity) with the nucleotide sequence shown in (a1) or (a2) and encodes a nucleotide sequence having the same or similar functional protein; The nucleotide sequence that is complementary to either (a4) or (a1)-(a3).

[0008] A second aspect of the present invention provides a protein, said protein being derived from the above-described gene. AtGalOxs Obtained through encoding. Specifically, the protein is selected from: (b1) The amino acid sequence shown in SEQ ID NO.2; (b2) A protein derived from the amino acid sequence shown in SEQ ID NO.2 by substitution and / or deletion and / or addition of one or more amino acid residues, and having the same function as the amino acid sequence shown in SEQ ID NO.2; (b3) Other genes that encode proteins that have 90% or more (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence similarity to the amino acid sequence shown in SEQ ID NO.2 and have the protein activity shown in SEQ ID NO.2.

[0009] In a third aspect, the present invention provides a recombinant expression vector containing the above-mentioned genes, a host bacterium, a transgenic cell, or a transgenic plant.

[0010] In one specific embodiment of the present invention, the recombinant expression vector is obtained by effectively ligating the above-mentioned gene to a vector. The vector can be a cloning vector or an expression vector, and the vector can be any one or more of a viral vector, plasmid, phage particle, or artificial chromosome. In one specific embodiment of the present invention, the vector can be pCAMBIA1300.

[0011] In this invention, the host bacterium refers to a host bacterium whose function has been altered by manipulating and modifying the genes of the target bacterium. This includes host bacteria obtained by introducing a foreign target gene or recombinant expression vector into the target bacterium, or host bacteria obtained by directly editing the endogenous genes of the target bacterium.

[0012] The target bacteria can be eukaryotic bacteria or prokaryotic bacteria.

[0013] The target bacteria can be bacteria, fungi, actinomycetes, etc. Specifically, the bacteria can be from genera such as *Escherichia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*, and more specifically, *Escherichia coli*, *Agrobacterium tumefaciens*, *Bacillus subtilis*, or *Bacillus pumilus*. The fungi can be yeasts. The fungi can be from genera such as *Fusarium*, *Verticillium*, *Penicillium*, *Aspergillus*, and *Cephalosporium*. The actinomycetes can be from genera such as *Streptomyces*, *Nocardia*, and *Micromonospora*.

[0014] In this invention, the transgenic cells can be isolated, ex vivo, cultured, or preferably part of a plant; wherein, the plant cells can be seed plant cells, specifically dicotyledonous plants, further cruciferous plants, and even more specifically Arabidopsis thaliana.

[0015] A fourth aspect of the present invention provides the above-described... AtGalOxs Genes, proteins, and those containing the above AtGalOxs The use of recombinant gene expression vectors, host bacteria, or transgenic cells in any one or more of the following: (c1) Regulates plant traits; (c2) Improve and cultivate plants.

[0016] In this invention, the plant is any plant at any developmental stage. In particular, the plant can be a seed plant, further a dicotyledonous plant, and even further a cruciferous plant, with Arabidopsis thaliana being the most preferred.

[0017] Specifically, (c1) regulation of plant traits manifests as regulation of Arabidopsis organ size, including but not limited to roots, stems, and leaves. As mentioned above, this invention has discovered through research that knocking out… AtGalOxs Following the gene deletion, all organs (roots, stems, and leaves) of homozygous knockout Arabidopsis plants became smaller; while AtGalOxs Overexpression effectively restored the smaller organ (root, stem and leaf) phenotype of the so mutant, and the size of each organ in the restored line was restored to the wild type level.

[0018] A fifth aspect of the invention provides a method for reducing plant organs, the method comprising inhibiting a target plant. AtGalOxs Gene expression.

[0019] In one specific embodiment of the present invention, the suppression AtGalOxs Gene expression can make AtGalOxs Gene expression is 0. Specifically, the gene can be knocked out using vectors such as CRISPR / Cas9 knockout vectors.

[0020] In this invention, the plant may be a seed plant, which is a dicotyledonous plant, further a cruciferous plant, and even further a Arabidopsis thaliana.

[0021] A sixth aspect of the invention provides a method for increasing plant organs, the method comprising promoting the growth of target plants. AtGalOxs Gene expression.

[0022] In this invention, the plant may be a seed plant, which is a dicotyledonous plant, further a cruciferous plant, and even further a Arabidopsis thaliana.

[0023] The plant organs include, but are not limited to, roots, stems, and leaves.

[0024] The beneficial technical effects of one or more of the above technical solutions are as follows: The above technical solution screened a gene that regulates the size and development of plant organs. AtGalOxs It was identified as a key gene regulating the size and development of organs in Arabidopsis thaliana plants, and this was confirmed through cytological observation and transcriptome analysis. AtGalOxs Genes function by regulating cell proliferation and auxin signaling pathways, providing new theoretical basis for elucidating the molecular network regulating plant organ size; AtGalOxs The gene can be directly applied to the regulation of Arabidopsis plant architecture, and its homologous genes are conserved in crops such as Brassicaceae. This provides key gene resources for improving crop plant architecture and increasing yield, which is of great significance for promoting the development of plant molecular breeding technology and improving agricultural production efficiency. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0026] Figure 1 As described in the embodiments of the present invention so Phenotypic analysis of mutant and wild-type Arabidopsis thaliana. A: Phenotypic comparison of wild-type (WT) and mutant (so) plants; B: Phenotypic comparison of wild-type (WT) and mutant (so) seedlings; C: Phenotypic comparison of wild-type (WT) and mutant (so) hypocotyls; D: Phenotypic comparison of wild-type (WT) and mutant (so) seeds; E: Phenotypic comparison of wild-type (WT) and mutant (so) mature plants (including inflorescences); F: Phenotypic diagram of wild-type (WT) flowers (scale bar 0.2cm); G: Phenotypic comparison of wild-type (WT) siliques and mutant (so) siliques (scale bar 1cm).

[0027] Figure 2 This is a phenotypic diagram of Arabidopsis thaliana plants and the structural diagram of the At2g03460 gene region in an embodiment of the present invention. A: Phenotypic analysis of Arabidopsis thaliana plants. WT: Wild type; so : Mutant; F1:WT and so Mutant hybrid generation; B: WT, so Phenotypic analysis of mutants and F1 leaves; C: WT, so Phenotypic analysis of mutants and F1 fruit cheeks; D: segregation ratio of F2 population; E: schematic diagram of the Arabidopsis thaliana At2g03460 gene region structure and deleted fragment.

[0028] Figure 3 Phenotypic analysis of wild-type (WT), mutant (so), and complementary lines (C-1, C-2) in embodiments of the present invention. A: Comparison of phenotypes of wild-type (WT), mutant (so), and complementary lines (C-1, C-2) seedlings; B: Comparison of phenotypes of mature plants (inflorescences) of wild-type (WT), mutant (so), and complementary lines (C-1, C-2); C: Comparison of silique phenotypes of wild-type (WT), mutant (so), and complementary lines (C-1, C-2) (scale bar 1cm).

[0029] Figure 4 Phenotypic analysis was performed on wild-type (WT), mutant (so), and homozygous knockout plants (ko-atgaloxs) for this invention.

[0030] Figure 5 This is a scanning electron microscope image from an embodiment of the present invention.

[0031] Figure 6 This is a KEGG pathway analysis of differentially expressed genes in this embodiment of the invention. Detailed Implementation

[0032] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0033] It should be noted that the terminology used herein is for descriptive purposes only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. This invention utilizes techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art can employ other conventional techniques, methods, and reagents in the art based on the embodiments provided in this invention, without being limited to the specific embodiments of this invention.

[0034] In this invention, the term "identity" or "consistency" refers to sequence similarity to an amino acid / nucleotide sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0035] For sequence comparison, a sequence is typically used as a reference sequence and compared with the detection sequence. When using a sequence comparison algorithm, the detection and reference sequences are input into the computer, the coordinates of the subsequences are specified if necessary, and the parameters of the sequence algorithm program are specified. Then, based on the selected program parameters, the sequence comparison algorithm calculates the percentage sequence identity (consistency) of the detection sequence relative to the reference sequence.

[0036] Genes (nucleic acid molecules) can be DNA, such as cDNA, genomic DNA, or recombinant DNA, etc., without specific limitations.

[0037] Furthermore, a large number of transformation vectors available for plant transformation are known to those skilled in the art, and the nucleic acid molecules of this invention can be used in conjunction with any such vector. The choice of vector will depend on the preferred transformation technology and target plant species used for transformation.

[0038] Unless otherwise specified, all materials, reagents, strains, plasmids, enzymes, kits, etc. used in the following examples were obtained commercially.

[0039] Example I. Experimental Materials Plant materials: Arabidopsis thaliana wild type (Col-0 ecotype), obtained by EMS mutagenesis so Mutants; Vectors and strains: pCAMBIA1300 vector, CRISPR / Cas9 vector, Agrobacterium strain GV3101, Escherichia coli DH5α competent cells; Reagents: restriction endonucleases (BamHI, SacHI), homologous recombinase, Taq DNA polymerase, RNA extraction kit, reverse transcription kit, qRT-PCR kit, LB medium, MS medium, hygromycin, Silwet L-77, sucrose, etc.

[0040] II. Test Methods 1. Gene cloning and expression vector construction 1) Using genomic cDNA as a template, specific primers (3460-F:ATGGCACCATCAAGAAGTCAAG; 3460-R: GGAGAAGGTTCTTGATGTTACTCTTTGA) were designed based on the sequence of the target gene to perform PCR amplification and obtain the target gene fragment.

[0041] 2) Digest the vector plasmid according to the restriction endonuclease reaction temperature.

[0042] 3) Use homologous recombinase to ligate the linearized vector with the PCR product of the target fragment.

[0043] 4) The ligation product was transformed into DH5α competent cells and plated onto LB medium for resistance screening to obtain positive clones containing recombinant plasmids.

[0044] 5) Positive clones were identified by PCR and sequenced, and plasmids were extracted from the correctly sequenced positive clones.

[0045] 2. Transformation of Arabidopsis thaliana by dipping flowers 1) Select a suitable Agrobacterium strain (GV3101), introduce the recombinant plasmid containing the target gene into Agrobacterium, and screen for positive clones using antibiotics. Culture Agrobacterium to the logarithmic growth phase, collect the cells, and resuspend them in infection medium (MS liquid medium containing surfactant Silwet L-77 and sucrose), adjusting the bacterial concentration to OD. 600 It is approximately 0.8.

[0046] 2) During the peak flowering period of Arabidopsis thaliana, immerse the entire inflorescence with the fruit cheeks removed into Agrobacterium tumefaciens solution, gently shake to ensure the inflorescence is evenly contacted with the solution, and soak for 5 minutes.

[0047] 3) After dipping, Arabidopsis plants were placed in the dark for 16-24 hours for co-culture, and then transferred to the growth chamber for normal temperature and light culture.

[0048] 3. Identification of Arabidopsis thaliana transformed plants 1) qRT-PCR Total RNA was extracted from transgenic Arabidopsis thaliana and reverse transcribed into cDNA according to the kit instructions. Using the cDNA as a template, specific quantitative primers and fluorescent dyes were added for qRT-PCR. The expression levels of the target gene in transgenic and non-transgenic plants were compared to identify the expression levels of the transgenic plant.

[0049] 2) Phenotypic level identification Using WT as a control, positive transgenic plants were transplanted into nutrient soil and cultured normally in a growth chamber. The morphological characteristics of various organs of the transgenic Arabidopsis plants were then observed.

[0050] 3) Construction and functional verification of CRISPR / Cas9 knockout vectors according to AtGalOxs Gene sequence design sgRNA (target sequence: 5'-GCACCATCAAGAAGTCAAGCGGG-3', construct CRISPR / Cas9 knockout vector).

[0051] The knockout vector was transferred into wild-type Arabidopsis plants, and identification was performed. AtGalOxs The homozygous knockout plants (named ko-atgaloxs)

[0052] III. Test Results To clarify AtGalOxs In this study, we first used pCAMBIA1300 as the basic vector to construct the biological function of the gene in the regulation of organ size in Arabidopsis thaliana through enzyme digestion and ligation. AtGalOxs The overexpression vector (with sequence correctness confirmed by double enzyme digestion and sequencing) was then transformed into an *So* *Arabidopsis thaliana* mutant (a mutant known to exhibit significantly smaller roots, stems, and leaves) using Agrobacterium-mediated flower infusion method for functional complementation verification. After hygromycin resistance screening and PCR identification, two genetically stable vectors were finally obtained. AtGalOxs The reintroduced strains (named C-1 and C-2) were used for systematic analysis. AtGalOxs The regulatory effect on organ size, for wild-type (WT) so The size of the mutant and two reinjected lines at the seedling and maturity stages, as well as the size of the mature fruit, were observed and compared. The results showed that... AtGalOxs Overexpression effectively restored the organ miniaturization phenotype of the so mutant, and the size of all organs in the restored lines was restored to the WT level. Figure 3), directly prove AtGalOxs It is a key functional gene that regulates the size of organs in Arabidopsis thaliana; loss of gene function is the cause of... so The core reason for the mutant phenotype. Further gene editing... AtGalOxs Gene knockout revealed that, compared to WT, the knockout plants ko-atgaloxs were significantly smaller (their roots, stems, and leaves were all significantly smaller), and their size was similar to... so The mutants are basically the same ( Figure 4 This further validates the positive regulatory role of the AtGalOxs gene in the organ size development of Arabidopsis thaliana.

[0053] Further observation using scanning electron microscopy revealed that within a unit area so Compared to WT, the mutant so The mutants did not show a significant difference in cell volume, but the number of cells per unit area was reduced. AtGalOxs It works by regulating cell proliferation. Figure 5 Transcriptome analysis revealed that... so Differentially expressed genes between mutants and WTs are mainly enriched in plant hormone signal transduction pathways. Figure 6 Further analysis revealed that it is primarily involved in the auxin metabolism pathway. AtGalOxs It may regulate the development of Arabidopsis organ size through the auxin signaling pathway.

[0054] Nucleotide and amino acid sequence information used in this invention AtGalOxs CDS gene ATGGCACCATCAAGAAGTCAAGCGGGATCCAGCTACCTAGAGTCCTCTTCAAGCGTCTCCATTCTTGATTGTCGGTCTCACACGTGGCGCGAGGCTCCAAGCTTGCGTGAGGGGCTATGTTCTGTTTCTTCTAGTGTCCTTGATCGAAAGATATACGTAGCAGGAAGTTGCTTGGATGGTGATTCTTACACCTATAAGAATTCGTTCGAGGTGTTTGACACTGAAACACAATTTTGGGATCCTGATACCATTACTTGCAGCAAGACGGAAGGCGATTTTTACGGATGCGGAACCGCATGCATTGACGGAGAGTTCCATGTGGTGCCTGTAGGTCAAAAAAGAGAGGCGGTTGCTTACAATTCCAAGGAAGGTAGATGGGACATGGTTGGCCAACAAATGGATCATTATAAGTTTTCAGCTTCTTGCGAGATACAGAATGTTTTGTACTCTTGTACTCATGGAGTGTTCAGATGGTATGACACTAACGCAATGATGTGGAGAGATTTGAAGGGTTTGGTAGGACTACCTATGTTCGGTTCTGGTGCCAATGTTAAGTTGGCTGATTATGGAGGAAAATTAACGGTTTTGTGGGAGGAGGAGTTGCCTTCTCGTGGACCTGATAGCGGCTATAAGAAGATGATTCGGTGTGCAGAGATTGCGCTTGAAAGGCGCAAAAGTTGTGAAATTTGGGGGATTGTTGAGTGGTTTGGTGATGTGCTTACCGAACCTGTAGGATATGTTGTTTTGGAGAAGGTTCTTGATGTTACTCTTTGA (SEQ ID NO.1) AtGalOxs protein MAPSRSQAGSSYLESSSSVSILDCRSHTWREAPSLREGLCSVSSSVLDRKIYVAGSCLDGDSYTYKNSFEVFDTETQFWDPDTITCSKTEGDFYGCGTACIDGEFHVVPVGQKREAVAYNSKEGRWDMVGQQMDHYKFSASCEIQNVLYSCTHGVFRWYDTNAMMWRDLKGLVGLPMFGSGANVKLADYGGKLTVLWEEELPSRGPDSGYKKMIRCAEIALERRKSCEIWGIVEWFGDVLTEPVGYVVLEKVLDVTL (SEQ ID NO.2) AtGalOxs Full gene sequence The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of the AtGalOxs gene in regulating organ size in Arabidopsis thaliana, characterized in that, The AtGalOxs The nucleotide sequence of the gene is shown in SEQ ID NO.1; increasing the expression of the AtGalOxs gene in Arabidopsis thaliana increases the size of Arabidopsis organs, namely roots, stems and leaves.

2. The application as described in claim 1, characterized in that, The amino acid sequence of the protein encoded by the AtGalOxs gene is shown in SEQ ID NO.

2.

3. Contains AtGalOxs The application of recombinant gene expression vectors, host bacteria, transgenic cells, or transgenic plants in regulating organ size in Arabidopsis thaliana; AtGalOxs The nucleotide sequence of the gene is shown in SEQ ID NO.1; increasing the expression of the AtGalOxs gene in Arabidopsis thaliana increases the size of Arabidopsis organs, namely roots, stems and leaves.

4. The application as described in claim 3, characterized in that, The recombinant expression vector is transmitted through AtGalOxs Genes are obtained by effectively linking them to a vector, which is an expression vector.

5. The application as described in claim 4, characterized in that, The vector can be either a viral vector or a plasmid.

6. The application as described in claim 3, characterized in that, The transgenic cells were isolated.

7. The application as described in claim 3, characterized in that, The genetically modified cells are isolated.

8. The application as described in claim 3, characterized in that, The transgenic cells were cultured.

9. The application as described in claim 3, characterized in that, The transgenic cells are a part of Arabidopsis thaliana.

10. A method for reducing the size of Arabidopsis organs, characterized in that, The method includes inhibiting the growth of [something] in Arabidopsis thaliana. AtGalOxs Gene expression, the AtGalOxs The nucleotide sequence of the gene is shown in SEQ ID NO.1; the organs are roots, stems and leaves.

11. A method for enlarging Arabidopsis organs, characterized in that, The method includes increasing the content of Arabidopsis thaliana in... AtGalOxs Gene expression, the AtGalOxs The nucleotide sequence of the gene is shown in SEQ ID NO.1; the organs are roots, stems and leaves.

Images