GREM1 inhibitor and application thereof in preparation of medicine for treating cancer

Abstract

The invention relates to a GREMLIN-1 (GREM1) inhibitor, a preparation containing the inhibitor, a composition of the preparation and an immunotherapeutic drug, and application of the preparation, the preparation and the immunotherapeutic drug in preparation of drugs for treating cancers.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. Specifically, this invention relates to GREM1 (Gremlin-1) inhibitors and the application of GREM1 as a target in the preparation of cancer therapeutic drugs. Background Technology

[0002] Although immune checkpoint inhibitors (ICIs), represented by anti-PD-1 and anti-PD-L1 monoclonal antibodies, have been proven to be an effective cancer immunotherapy strategy, sustained and complete clinical remissions have only been achieved in a small number of cancer patients. More importantly, most cancer-related deaths are due to the spread or distant metastasis of cancer cells, and the objective response rate of existing ICI monotherapy or combination chemotherapy is further reduced for cancer patients with metastases or disease progression (Ganeshand Massague, 2021; Gerstberger et al., 2023; Waldman et al., 2020).

[0003] Ovarian cancer is the third most common gynecological cancer, but it is one of the deadliest. High-grade serous ovarian cancer (HGSOC) is the most common and aggressive type of ovarian cancer, characterized by insidious onset, peritoneal metastasis, and the formation of large amounts of ascites. Therefore, most HGSOC patients are diagnosed at an advanced stage. The first-line treatment for HGSOC is initial cytoreductive surgery followed by platinum-based chemotherapy. However, recurrence and chemotherapy resistance result in a 5-year survival rate of less than 50% for HGSOC patients (Lheureux et al., 2019).

[0004] Similarly, the role of ICI in ovarian cancer treatment is very limited. A recently published phase II clinical trial (followed for 3 years) showed that in patients with platinum-sensitive (advanced) ovarian cancer, there was no statistically significant difference in progression-free survival (PFS) between the atezolizumab group (anti-PD-L1 monoclonal antibody, n=410) and the placebo group (n=204) or the PD-L1 positive group (n=156) (Kurtz et al., 2023). Another phase III clinical trial also confirmed that for patients with advanced recurrent ovarian cancer, atezolizumab combined with platinum-based chemotherapy failed to significantly improve PFS or objective response rate (Gonzalez-Martin et al., 2024).

[0005] Preclinical and clinical studies have shown that a reduction or / and loss of function of effector T cells within the tumor microenvironment (TME) is one of the main causes of ICI therapy failure. Emerging evidence highlights the importance of cancer-associated fibroblasts (CAFs) in T cell function and fate programming (Chen et al., 2021; Cox, 2021). As a major cellular subset of the TME, CAFs establish an immunosuppressive microenvironment by remodeling the extracellular matrix (ECM) and altering T cell phenotype and function, thereby driving cancer development, metastasis, and immune escape, and contributing to the failure of existing ICI therapies (Caligiuri and Tuveson, 2023; Chen et al., 2021; Prakash and Shaked, 2024). However, in ovarian cancer, the pathways by which CAFs suppress the body's anti-tumor immune capacity and affect the efficacy of ICI therapy remain unclear.

[0006] GREM1 is a highly conserved secretory glycoprotein in vertebrates. Human and mouse GREM1 consists of 182 amino acids and belongs to the Dan family. GREM1 can bind to and inhibit the signal transduction abilities of bone morphogenetic proteins (BMPs) BMP2, BMP4, and BMP7, playing an important regulatory role in embryonic development.

[0007] Previous studies have shown that aberrant GREM1 expression is associated with the development of various cancers, including pancreatic ductal carcinoma (PADC), colorectal cancer (CRC), and lung adenocarcinoma (LUDC), and its mechanism is thought to be related to antagonizing the BMP signaling pathway to promote tumor proliferation (Sneddon et al., 2006). However, recent evidence suggests that, in addition to the BMP signaling pathway, GREM1 may promote tumor progression and drug resistance through non-BMP-dependent pathways. For example, in prostate cancer cells, GREM1 directly binds to fibroblast growth factor receptor 1 (FGFR1), activating the FGFR1 signaling pathway, promoting tumor development, and leading to resistance to androgen deprivation therapy (Cheng et al., 2022). These results suggest that aberrant GREM1 expression may promote tumorigenesis and development by affecting multiple signaling pathways. However, whether cancer cells (CAFs) affect T cell-mediated anti-tumor immune responses by secreting GREM1 has not yet been publicly reported.

[0008] Neutralizing antibodies against GREM1 have been developed; however, their antitumor effects are limited. For example, GREM1 neutralizing antibodies can promote Lgr5 by restoring the BMP signaling pathway. +The antibody inhibited the differentiation of intestinal stem cells and suppressed the growth of Smad4 wild-type colorectal cancer tumors. However, it did not significantly inhibit the growth of Smad4 mutant tumor cells. Smad4 mutant tumors account for approximately 16% of colorectal cancer patients, and these patients have a worse prognosis and greater resistance to chemotherapy and ICI compared to wild-type patients. Importantly, the GREM1 neutralizing antibody did not show significant therapeutic effects in a mouse model of colorectal cancer liver metastases (Kobayashi et al., 2021).

[0009] In summary, although immune checkpoint inhibitors (ICIs) have become a first-line treatment for many cancers, most patients, especially those with metastatic or recurrent cancer, benefit very little from this therapy. Numerous preclinical and clinical studies have confirmed that the number, phenotype, and function of T cells infiltrating the tumor microenvironment (TEM) directly affect the efficacy of ICI treatment. However, the impact of cancer cells (CAFs), the dominant cell type in the tumor microenvironment, on T cells and the mechanisms by which they are regulated remain poorly understood.

[0010] Therefore, it is urgent in this field to elucidate the roles of GREM1 and CAFs in TME, especially whether CAFs affect the phenotype and function of T cells by secreting GREM1, and promote tumorigenesis, development and metastasis and ICI resistance. At the same time, it is also urgent to develop new drugs and combinations targeting GREM1 to provide new approaches for cancer treatment. Summary of the Invention

[0011] Therefore, the purpose of this invention is to explore new applications of GREM1 inhibitors in medicine.

[0012] In a first aspect, the present invention provides a GREM1 inhibitor, which is a substance that inhibits the expression of GREM1, reduces the stability of GREM1, reduces the effective duration of GREM1, or inhibits the transcription and processing of GREM1, preferably a nucleic acid molecule.

[0013] A second aspect of the present invention provides a formulation of a GREM1 inhibitor comprising the above-described GREM1 inhibitor and a pharmaceutically acceptable carrier or excipient.

[0014] In a third aspect, the present invention provides a pharmaceutical composition for treating cancer, the active ingredients of which include the GREM1 inhibitor or a formulation of the GREM1 inhibitor and an immune checkpoint inhibitor (ICI), wherein the GREM1 inhibitor or a formulation of the GREM1 inhibitor and the immune checkpoint inhibitor (ICI) are each independent administration units, or the GREM1 inhibitor or a formulation of the GREM1 inhibitor and the immune checkpoint inhibitor (ICI) together form a combined administration unit.

[0015] A fourth aspect of the invention provides the use of the GREM1 inhibitor or a recombinant vector of the GREM1 inhibitor with other anticancer agents (such as immune checkpoint inhibitors) in the preparation of a medicament for treating cancer.

[0016] A fifth aspect of the invention provides a method of treating cancer, comprising administering to a subject a therapeutic dose of the GREM1 inhibitor or an formulation of the GREM1 inhibitor or the pharmaceutical composition for treating cancer.

[0017] A sixth aspect of the invention provides a method for detecting cancer in a patient, the method comprising measuring the expression level of GREM1 in the patient's bodily fluids.

[0018] The beneficial effects of this invention are:

[0019] This invention provides the use of GREM1 inhibitors in the preparation of antitumor drugs. Through the preparation of inhibitors that specifically inhibit GREM1 activity and their therapeutic experiments in various human cancer in vitro or mouse models, it was found that the GREM1 inhibitors provided by this invention can inhibit cancer cell proliferation, reduce tumor extracellular matrix (ECM) deposition and tissue stiffness, and reduce intratumoral invasive Tregs and depleted CD8. + T cell count, enhanced effector CD8 + The anti-tumor ability of T cells, especially the combined use of GREM1 inhibitors and ICIs, can synergistically enhance the tumor-killing effect and significantly improve the treatment effect on primary and advanced cancers. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other implementation schemes can be obtained based on these drawings without creative effort.

[0021] Figure 1GREM1 is selectively overexpressed in metastatic CAFs and is associated with poor prognosis in HGSOC patients. Among them: (A) Volcano plot of differentially expressed genes (DEGs) between HGSOC primary lesions and omental metastatic CAFs, where padj represents the adjusted p value, normal indicates no difference in gene expression between the two, up indicates upregulation, and down indicates downregulation; (B) Violin plot of GREM1 expression in different cell types in the public dataset GSE165897 of HGSOC patients; (C) Comparison of GREM1 expression levels in CAFs from different anatomical sites in the GSE165897 data, and the data were analyzed using the Wilcoxon rank-sum test; (D) Detection of GREM1 expression in primary lesions and omental metastatic lesions of HGSOC patients by fluorescence in situ hybridization (FISH). The scale bar is 100 micrometers; (E) GREM1 expression level of CAFs in primary lesions and omental metastases of HGSOC patients was detected by Western blotting; (F) GREM1 secretion level of CAFs in primary lesions and omental metastases of HGSOC patients was detected by ELISA (n = 5, data are expressed as mean ± standard error; and Student's t-test was used for analysis); (G) Box plots of GREM1 expression levels in patients with different clinical stages in TCGA-OV and GSE9891 data, and data were analyzed by Wilcoxon rank-sum test; (H) GREM1 expression levels in patients with different subtypes of ovarian cancer in TCGA-OV, and data were analyzed by Wilcoxon rank-sum test; (I) In HGSOC, the association between GREM1 expression level and overall survival (OS) was assessed using a univariate Cox proportional hazards regression model. The figure shows the hazard ratio (HR) and its 95% confidence interval and the corresponding p-value. Values; (J) Kaplan-Meier survival curves of ovarian cancer patients in different datasets, divided into high and low groups (GREM1-high and GREM1-low) according to the expression level of GREM1 in the tumor tissue. NS indicates no statistical difference, *p<0.05, **p<0.01, ***p<0.001. Abbreviations: P, primary lesion; M, omental metastasis.

[0022] Figure 2 In ovarian cancer patients, GREM1 expression levels are associated with ECM deposition and Treg invasion, including: (A) Gene Ontology (GO) enrichment analysis of upregulated DEGs in omental metastases of HGSOC patients, where -log 10(A) Adjusted p-value > 12 was the cutoff value; (B) Wilcoxon test was used to analyze the expression of immunosuppressive molecules (including PDCD1, HAVCR2, CTLA4, FOXP3, and TIGIT) in primary and metastatic lesions of HGSOC patients; (C) Spearman correlation test was used to analyze the correlation between GREM1 expression level and fibroblast markers (including COL1A1, COL3A1, COL5A2, and FAP) and immunosuppressive molecules (including FOXP3, PDCD1, and HAVCR2); (D) In ​​the TCGA-OV (n=420) dataset, Spearman correlation test was used to analyze the correlation between GREM1 expression level and immunosuppressive molecules (including FOXP3, HAVCR2, CTLA4, TIGH, and IL10) and fibroblast markers (FAP, COL1A1, and COL5A2); (E) In the GSE213699 data, GREM1 Spatial co-expression patterns of immunosuppressive molecules (including FOXP3, HAVCR2, PDCD1, TIGIT, and CTLA4). * p < 0.05, ** p < 0.01, *** p < 0.001.

[0023] Figure 3 GREM1 promotes Treg differentiation and drives the progression and metastasis of HGSOC, in which: (A) L929-Grem1 cells with CD4 + After co-culturing T cells, the expression levels of immunosuppressive genes were detected by qRT-PCR (n = 3); (B) L929-Grem1 cells and CD4 + After direct co-culture of T cells, the change in the proportion of Tregs was analyzed by flow cytometry (n = 3); (C) L929-Grem1 cells and CD4 + After indirect transwell coculture of T cells, the change in the proportion of Tregs was analyzed by flow cytometry (n = 3); (D, E)CD4 + T cells were directly co-cultured with L929-Grem1 cells, and then induced to develop CD8+ cells derived from mouse spleen. + T cells were co-cultured, and PD1 was analyzed by flow cytometry. + TIM3 + CD8 + T cells (D) and IFN-γ + CD8 +(E) Changes in the proportion of T cells (n = 3); (F) Changes in ascites fluid in mice after co-injection of L929-Grem1 cells and ID8 cells (n = 6); (G) Changes in the number of tumor metastases in the entire peritoneal cavity of mice after co-injection of L929-Grem1 cells and ID8 cells (n = 6). (HJ) Flow cytometry analysis of CD25 in tumor tissue after co-injection of L929-Grem1 cells and ID8 cells. + FoxP3 + Tregs (H), PD1 + TIM3 + CD8 + T cells (I) and IFNγ + CD8 + Changes in the proportion of T cells (J). The number of mice in each group was: ID8 group, n = 3; ID8 combined with L929-Ctrl group, n = 4; ID8 combined with L929-Grem1 group, n = 5. All data in the above figures and tables are expressed as mean ± standard error, and data analysis was performed using Student's t-test (AF) or two-way ANOVA (GK). *p<0.05, **p<0.01, ***p<0.001.

[0024] Figure 4The study investigated the inhibition of HGSOC progression and metastasis by AAV9-shGREM1 treatment, including: (A) a schematic diagram of the construction of the AAV9-shGREM1 recombinant viral vector; (B) the knockdown efficiency of AAV9-shGREM1-1, AAV9-shGREM1-2, and AAV9-shGREM1-3 in L929 cells using qRT-PCR (n = 3); (C) changes in tumor weight and volume in nude mice inoculated with human ovarian cancer OVCAR3 cells after AAV9-shGREM1 treatment (n = 5); (D) the establishment of orthotopic or peritoneal HGSOC models in C57BL / 6J mice after orthotopic or intraperitoneal injection of ID8 cells, followed by AAV9-shGREM1 treatment; (EF) changes in ascites volume (E) and the number of metastatic lesions in the entire peritoneal cavity in orthotopic HGSOC model mice after AAV9-shGREM1 treatment (n = 6); and (GH) peritoneal HGSOC. (I) Changes in ascites volume (G) and number of metastatic tumors in the entire peritoneal cavity in model mice after AAV9-shGREM1 treatment (n = 6); (II) Kaplan-Meier curves of overall survival in two HGSOC model mice after AAV9-shGREM1 treatment (n = 12); (III) Representative images of in situ HGSOC model mice examined by ultrasound two weeks after AAV9-shGREM1 treatment and analysis of the maximum length of the tumor (n = 6), scale bar 2 mm; (IV) Changes in ovarian tumor weight in in situ HGSOC model mice after AAV9-shGREM1 treatment (n = 6); (V) Changes in αSMA expression in tumor tissue in in situ HGSOC model mice after AAV-shGREM1 treatment, scale bar 100 μm; (VI) Masson staining and quantitative analysis of tumor tissue in in situ HGSOC model mice after AAV-shGREM1 treatment (n = 6). The scale bar is 100 micrometers. All data in the above figures are expressed as mean ± standard error and analyzed using a Student's t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.

[0025] Figure 5 AAV9-shGREM1 treatment restored the anti-tumor ability of HGSOC mice. Specifically, in two HGSOC model mice (AF), after AAV9-shGREM1 treatment, the CD25 infiltrating tumor tissue was significantly reduced. + FoxP3 + Tregs(A,B), PD1 + TIM3 + CD8 +T cells (C, D) and IFNγ + CD8 + Changes in the proportion of T cells (E, F) (n = 5); (G) In orthotopic HGSOC model mice treated with AAV9-shGREM1, the number of PD1 cells infiltrating tumor tissue was reduced. + FoxP3 + Changes in the proportion of Tregs (n = 5); Foxp3 levels in tumor tissue of (H, I) orthotopic HGSOC model mice after AAV-shGREM1 treatment. + CD4 + T cells (H) and PD1 + CD8 + Spatial distribution and proportion of T cells (I) (n = 6). Scale bar: 50 micrometers. All data in the above figures and tables are expressed as mean ± standard error and analyzed using Student's t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.

[0026] Figure 6 AAV9-shGREM1 treatment enhances the efficacy of PD-1 monoclonal antibodies. (A) Orthotopic HGSOC model mice treated with AAV9-shGREM1 combined with PD-1 monoclonal antibody; (BF) Representative images of primary ovarian tumors in different treatment groups (B), tumor weight (C), ascites volume (D), representative images of metastatic tumors throughout the peritoneal cavity of mice (E), and changes in their number (F); (GI) Infiltrating CD25 in tumor tissues of different treatment groups. + FoxP3 + Tregs (G), PD1 + TIM3 + CD8 + T cells (H) and IFNγ + CD8 + Changes in the proportion of T cells (I). In the above figures, the number of mice in each group = 5. All data are expressed as mean ± standard error and analyzed using two-way ANOVA. * p < 0.05, ** p < 0.01, *** p < 0.001.

[0027] Figure 7High GREM1 expression is associated with poor prognosis in patients with various human cancers. (A) Univariate Cox proportional hazards regression model was used to assess the association between GREM1 expression levels and overall survival (OS) in various human cancer types. The figure shows the hazard ratio (HR), its 95% confidence interval, and the corresponding p-value; (BK) Kaplan-Meier survival curves for overall survival in patients with various human cancers, divided into high / low groups (GREM1-high and GREM1-low) according to GREM1 expression levels. Data for various human cancers included colorectal cancer (CRC), gastric adenocarcinoma (STAD), pancreatic ductal adenocarcinoma (PDAC), lung adenocarcinoma (LUAD), breast cancer (BRCA), and renal clear cell carcinoma (KIRC); (L) Violin plots of Tregs infiltration density in tumor tissues of patients with various human cancers, divided into high / low groups (GREM1-high and GREM1-low) according to GREM1 expression levels. Data were analyzed using the Wilcoxon rank-sum test; (MP) In the single-cell transcriptome datasets GSE144735 and GSE225857 from CRC patients, GREM1 was mainly expressed in fibroblasts (M, N), and its expression level in tumor tissue was significantly higher than that in normal tissue and tumor periphery tissue (O). Importantly, compared with the primary lesion, the expression level of GREM1 in liver metastases (CAFs) was significantly increased (P). Data were analyzed using the Wilcoxon rank-sum test. * p < 0.05, ** p < 0.01, *** p < 0.001.

[0028] Figure 8 AAV9-shGREM1 treatment inhibits the metastasis of various cancers. (A) A mouse model of colorectal cancer liver metastasis was established by intrasplenic injection of MC38 cell line, and AAV9-shGREM1 was administered as shown in the schematic diagram. (BE) Images of the liver and tumor lesions in the mouse model of colorectal cancer liver metastasis after AAV-shGREM1 treatment (B), liver weight and the ratio of liver weight to body weight (C), a representative HE-stained image of the liver (D, scale bar 2 mm), and Foxp3 in the tumor tissue. + CD4 +Representative immunofluorescence images of T cells (left, scale bar 50 μm) and quantitative analysis (right); (F) Mouse model of breast cancer lung metastasis established by tail vein injection of 4T1 cells, and treated with AAV9-shGREM1 as shown in the schematic diagram; (G) Representative images of the lungs and lung metastatic nodules in the mouse model of breast cancer lung metastasis after AAV9-shGREM1 treatment (left, scale bar 1 cm) and quantitative analysis (right); (H) Representative HE staining image of breast cancer lung metastasis, scale bar: 1 mm; (I) Foxp3 in tumor tissue + CD4 + Representative immunofluorescence images of T cells (left, scale bar 50 μm) and quantitative analysis (right). In the above figures, n = 5, all data are expressed as mean ± standard error and analyzed using Student's t-test, * p < 0.05, ** p < 0.01, *** p < 0.001.

[0029] Figure 9 The level of GREM1 in the plasma of patients was associated with the occurrence of ovarian cancer, colorectal cancer, and gastric adenocarcinoma. (A) Standard curve of ELISA detection method; (BD) GREM1 protein content in the plasma of patients with ovarian cancer (n=34), colorectal cancer (n=31), and gastric adenocarcinoma (n=10). All data in the above figures are expressed as mean ± standard error and analyzed using Student's t-test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.001. All tumor patients were pathologically diagnosed. Detailed Implementation

[0030] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0031] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples are commercially available products.

[0032] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0033] To facilitate understanding of this technology, some terms and phrases are defined below.

[0034] As used in this article, the term "prevention" refers to stopping or delaying the onset of disease.

[0035] As used herein, the term "treatment" means curing or at least partially halting the progression of cancer, or alleviating symptoms in a cancer patient. Treatment of cancer also includes suppressing local invasion or distant metastasis of the cancer.

[0036] In this invention, a "therapeutic effective amount" includes an amount of GREM1 inhibitor or a drug used in combination with it, such as an immune checkpoint inhibitor (ICI) like an anti-PD-1 antibody, sufficient to treat the disease (e.g., by weakening, reducing, or maintaining the existing disease, or one or more symptoms of the disease) when administered to a patient for the treatment of cancer. This "therapeutic effective amount" may vary depending on the GREM1 inhibitor, how the formulation is administered, the disease and its severity, and the patient's medical history, age, weight, family history, genetic makeup, stromal or peripheral blood GREM1 expression level, clinical or pathological stage and phase, type of prior treatment or combination therapy (if any), and other independent characteristics.

[0037] "Therapeutic effective dose" or "preventive effective dose" also includes the amount of the GREM1 inhibitor, with any treatment-acceptable reasonable benefit-risk ratio.

[0038] In this document, "subject" or "patient" refers to a human or a non-human animal such as a mammal. "Subject" can include any other mammal, including horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds. Human subjects may be referred to as patients.

[0039] Small interfering RNA (siRNA), also known as short interfering RNA or silent RNA, is a type of double-stranded RNA molecule with a length of 20-25 base pairs. It can inhibit the expression of the corresponding gene by recognizing and binding to its complementary target mRNA sequence and inducing the degradation of the mRNA after transcription.

[0040] Short hairpin RNA (shRNA) is an artificially designed single-stranded RNA molecule with a hairpin-like secondary structure, consisting of two inverted repeat sequences linked by a stem-loop structure. It is typically transcribed under the drive of RNA polymerase III (such as the U6 or H1 promoter). In mammalian cells, shRNA can be processed and cleaved into small interfering RNA (siRNA) by the Dicer enzyme. The siRNA then guides the RNA-induced silencing complex (RISC) to recognize and degrade its complementary target mRNA (e.g., the mRNA of the GREM1 gene), thereby mediating specific gene silencing.

[0041] Antisense oligodeoxynucleotides (AS-ODNs) are synthetic single-stranded DNA molecules typically between 15 and 30 nucleotides in length. Through the principle of complementary base pairing, they can specifically bind to the mRNA or DNA sequence of a target gene (such as the GREM1 gene in this case), thereby precisely inhibiting or regulating the expression of that gene at the transcriptional or translational level.

[0042] Expression vectors are vectors that add expression regulatory elements (such as promoters, terminators, enhancers, polyadenylated tails, etc.) to cloning vectors to achieve the expression of a target gene. Their core structure includes the target gene, promoter, terminator, and marker gene, where the marker gene is used to identify plasmids and detect gene integration. Based on host type, they can be divided into prokaryotic expression vectors (such as the *E. coli* system) and eukaryotic expression vectors (such as mammalian cell systems). More specifically, in this paper, an expression vector is an artificially designed and modified DNA molecule (usually a plasmid, virus, etc.) that can deliver a foreign target gene (such as the GREM1 gene in this paper) into a host cell (such as bacterial, yeast, animal, or plant cells) and utilize the host cell's transcription and translation systems to regulate the expression level of the protein encoded by that gene. For example, the GREM1 protein described in this invention.

[0043] The inventors unexpectedly discovered that in HGSOC patients, the expression and secretion levels of GREM1 were significantly increased in metastatic cancer cell artery fibroids (CAFs) compared to the primary tumor. Importantly, GREM1 expression levels are closely related to disease progression and poor prognosis. Furthermore, the inventors found that GREM1 secreted by CAFs promotes cancer cell proliferation, increases ECM deposition, and reduces effector CD8+. + T cell infiltration, on the other hand, promotes the differentiation of regulatory T cells (Tregs) and inhibits effector CD8. +The tumor-killing function of T cells drives the development, metastasis, and ICI resistance of HGSOC through the two mechanisms mentioned above. Furthermore, the inventors discovered that GREM1 is widely and highly expressed in various cancers, including colorectal cancer (CRC), breast cancer (BRCA), and gastric adenocarcinoma (STAD), with further increases in expression levels in metastatic lesions. Importantly, high GREM1 expression is significantly associated with poor prognosis in patients with these cancers.

[0044] Based on the above findings, we considered restoring or enhancing the effector CD8 by inhibiting GREM1 to alter the physicochemical properties and immune status of the TME. + T cell function enhances the body's anti-tumor ability and the efficacy of ICI treatment. Multiple experiments have confirmed that downregulating GREM1 expression using small RNA interference technology can significantly inhibit cancer cell proliferation, reduce ECM deposition, and decrease tumor tissue stiffness, thereby increasing effector CD8+. + T cell infiltration was also observed. Intratumoral Tregs (especially the more potent PD-1 inhibitors) were also found. + Tregs and depleting CD8 + The proportion of T cells decreased, while the effector CD8 ratio decreased. + The number of T cells increased significantly, ultimately achieving effective inhibition of the progression and metastasis of various cancers. Even more surprisingly, GREM1 inhibition also significantly enhanced the therapeutic effect of PD-1 antibodies. Therefore, it is evident that specifically inhibiting GREM1 activity can significantly reduce tumor progression, metastasis, and immune escape, thereby improving the body's anti-tumor ability. This can be used to prepare cancer therapeutic drugs, thus completing this invention.

[0045] In some embodiments of the present invention, a GREM1 inhibitor is involved, wherein the GREM1 inhibitor is any substance capable of reducing the activity of GREM1, reducing the stability of GREM1, inhibiting the expression of GREM1, reducing the effective duration of GREM1, or inhibiting the transcription and processing of GREM1. This substance can be a nucleic acid molecule, including but not limited to: small interfering molecules that specifically interfere with the expression and processing of the GREM1 gene, such as shRNA molecules, siRNA molecules, antisense nucleotides, etc. Furthermore, the GREM1 inhibitor can also be a peptide, protein, antibody, or small molecule compound targeting GREM1.

[0046] The GREM1 inhibitor can also be a GREM1 antagonist, downregulator, blocker, or inhibitor.

[0047] In some embodiments, the GREM1 inhibitor is a small interfering RNA molecule, short hairpin RNA, or antisense nucleotide that specifically interferes with the expression of the GREM1 gene, more preferably a short hairpin RNA (shRNA) with a simple structure.

[0048] In some implementations, the sequence of the short hairpin RNA is shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0049] The DNA sequences encoded by the short hairpin RNA are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0050] The GREM1 inhibitor of this invention maintains and / or promotes CD8. + The role of T cells in tumor killing or survival.

[0051] The GREM1 inhibitor described in this invention increases CD8 + The role of T cells in producing interferon-γ (IFN-γ).

[0052] The GREM1 inhibitor described in this invention has the use in inhibiting the differentiation and function of regulatory T cells (Tregs).

[0053] The GREM1 inhibitor described in this invention has the effect of inhibiting cancer ECM deposition and reducing tumor tissue stiffness.

[0054] The GREM1 inhibitor described in this invention has applications in inhibiting cancer cell proliferation and metastasis.

[0055] Some embodiments of the present invention relate to formulations of GREM1 inhibitors, which include a GREM1 inhibitor and a pharmaceutically acceptable carrier or excipient.

[0056] In some embodiments, the GREM1 inhibitor is formulated as a recombinant vector of the GREM1 inhibitor. The recombinant vector includes an expression vector and a GREM1 inhibitor inserted into the expression vector. The GREM1 inhibitor refers to a siRNA, shRNA, or antisense nucleotide that targets and inhibits the expression of the GREM1 gene or is stable.

[0057] In some embodiments, the expression vector is a plasmid vector, a granular vector, a bacteriophage vector, or a viral vector.

[0058] In some embodiments, the expression vector is a "viral vector," including adeno-associated virus (AAV), lentivirus, vaccinia virus, adenovirus, Coxsackievirus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, and vesicular stomatitis virus, etc. Suitable viral vectors are well known to those skilled in the art.

[0059] In some embodiments, adeno-associated virus, vaccinia virus, and lentiviral vectors are preferred.

[0060] In some embodiments, the expression vector is an adeno-associated virus (AAV) vector and its viral particles, the AAV particles comprising an AAV recombinant vector, a packaging plasmid encoding a capsid protein, and optionally an auxiliary plasmid.

[0061] In some embodiments, the expression vector is a lentiviral vector and its viral particles, the lentiviral particles comprising a lentiviral vector, a packaging plasmid encoding a capsid protein, and optionally an auxiliary plasmid.

[0062] The term "pharmaceutically acceptable carrier" also includes a variety of non-viral delivery systems, such as liposomes or lipid nanocomposites, cationic polymers, chitosan polymers, and various functionalized nanoparticle carriers.

[0063] In some embodiments, pharmaceutically acceptable carriers may be lipid-based systems, such as lipid nanoparticles (LNPs), cationic liposomes, or polymeric nanoparticles.

[0064] Generally, suitable pharmaceutically acceptable carriers or excipients are well known to those skilled in the art.

[0065] In some embodiments of the present invention, there is a pharmaceutical composition for treating cancer, the active ingredients of which include the GREM1 inhibitor or a formulation of the GREM1 inhibitor and an immune checkpoint inhibitor (ICI), wherein the GREM1 inhibitor or a formulation of the GREM1 inhibitor and the immune checkpoint inhibitor (ICI) are each a separate administration unit, or the GREM1 inhibitor or a formulation of the GREM1 inhibitor and the immune checkpoint inhibitor (ICI) together form a combined administration unit.

[0066] In some embodiments, the immune checkpoint inhibitor (ICI) is selected from at least one of anti-PD-1, CTLA-4, and TIM-3 antibodies, and may be any one, two, or three of them.

[0067] Some embodiments of the present invention relate to the use of the GREM1 inhibitor or a formulation of the GREM1 inhibitor, or the use of the pharmaceutical composition for treating cancer in the preparation of a medicament for treating cancer.

[0068] Some embodiments of the present invention relate to the use of the GREM1 inhibitor or a formulation of the GREM1 inhibitor, or the pharmaceutical composition for treating cancer, in the preparation of a medicament for inhibiting cancer metastasis.

[0069] In some embodiments, the cancer typically refers to primary solid carcinoma and metastatic carcinoma with a matrix, often exhibiting GREM1 overexpression in stromal fibroblasts and secretion within the tumor microenvironment (TEM). The cancer may have GREM1 overexpression in stromal cells (such as fibroblasts) or epithelial cells.

[0070] In some embodiments, the cancer is at least one of the following: ovarian cancer, colorectal cancer, breast cancer, gastric adenocarcinoma, pancreatic ductal adenocarcinoma, lung adenocarcinoma, oral squamous cell carcinoma, and kidney cancer.

[0071] In some embodiments, the cancer is ovarian cancer, preferably high-grade serous ovarian cancer (HGSOC) or stromal ovarian cancer.

[0072] In some implementations, the cancer is colorectal cancer and breast cancer.

[0073] Use of GREM1 inhibitors in the preparation of drugs for the treatment of early-stage and / or advanced-stage cancers. "Early-stage" refers to cancer cells confined to the primary site, and "advanced-stage" refers to cancers that have undergone local invasion or distant metastasis.

[0074] In some implementations, the cancer is particularly a highly invasive and metastatic cancer.

[0075] In some embodiments of the present invention, a method of treating cancer is provided, comprising administering to a subject a therapeutic dose of the GREM1 inhibitor or an formulation of the GREM1 inhibitor or the pharmaceutical composition for treating cancer.

[0076] Some embodiments of the present invention relate to a method for detecting cancer in a patient, the method comprising detecting the expression level of GREM1 in the patient's body fluids, wherein overexpression of GREM1 indicates that the patient has cancer.

[0077] In some embodiments, the patient's bodily fluids, such as blood, saliva, ascites, urine, and tissue exudate, are preferably blood. Peripheral blood is particularly preferred.

[0078] The expression level of GREM1 in the patient's body fluids is detected using various detection methods known to those skilled in the art, and information on whether the patient has cancer is obtained based on whether GREM1 is overexpressed.

[0079] In some embodiments, the detection method includes various gene-based detection methods, such as hybridization techniques like in situ hybridization (ISH) and Northern blotting; PCR-based techniques like reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qPCR); and sequencing-based techniques like RNA-Seq (RNA sequencing). PCR technology is preferred.

[0080] In some embodiments, the detection method includes various detection methods for proteins or peptides, such as Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC), immunocytochemistry (ICC), flow cytometry, mass spectrometry (MS), or colorimetric / fluorescent methods, such as the BCA method, Bradford method, etc.

[0081] The materials and standard experimental methods used in the following experiments are as follows:

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Patient sample collection and preparation

[0088] Cancerous and adjacent tissues from patients with high-grade serous ovarian cancer (HGSOC) were obtained from Nanfang Hospital, Southern Medical University. All samples were obtained from patients who provided informed consent, and all related procedures were approved by the Ethics Committee of Nanfang Hospital.

[0089] Isolation and identification of cancer-associated fibroblasts (CAFs)

[0090] Primary tumor lesions (P) and omental metastases (M) from HGSOC patients were minced and added to DMEM / F12 medium containing 10% FBS, along with type IV collagenase (Sigma-Aldrich, #9001-12-1) and hyaluronidase (Sigma-Aldrich, #H3506). Digestion was carried out at 37°C with stirring for 2 hours. Stromal cells were collected by centrifugation (1000 rpm, 5 min) and cultured in DMEM / F12 medium containing 10% FBS. Cellular fibroblasts (CAFs) from passage 4 to 9 were used for subsequent experiments. The expression of fibroblast markers α-SMA and FAP was detected by qRT-PCR, Western blotting, and immunofluorescence to identify CAFs.

[0091] Cells and their culture

[0092] The human ovarian cancer cell line OVCAR3 was originally obtained from the American Type Culture Collection (ATCC). Normal ovarian fibroblasts (NOFs) were purchased from Wuhan Pronosei Biotechnology Co., Ltd. All cell lines and NOFs tested negative for mycoplasma.

[0093] Primary CAFs, NOFs, and OVCAR3 were cultured in DMEM / F12 medium supplemented with 10-15% FBS and 1% penicillin / streptomycin at 37°C. The medium was changed daily, and cells were passaged when they reached approximately 80-90% confluence.

[0094] Immunofluorescence (IF) analysis

[0095] Cells were seeded on glass coverslips in 6-well plates and fixed with 4% paraformaldehyde at room temperature for 20 minutes. Tumor tissue samples from HGSOC patients were fixed with 4% paraformaldehyde, embedded in paraffin, and then sectioned into 4-micrometer sections. Cell and tissue sections were blocked with 5% bovine serum albumin at room temperature for 1 hour. According to the experimental design, samples were incubated sequentially with primary antibodies against α-SMA (1:300), anti-FAP (1:200), or anti-EPCAM (1:300), and secondary antibodies against goat anti-rabbit (Dyelight 488 or 549). Finally, the samples were counterstained with DAPI, and images were acquired using a Nikon Ti2-U microscope. Double immunofluorescence assays were performed according to the manufacturer's instructions (AiFang Biotechnology, AFIHC024).

[0096] qRT-PCR

[0097] Total RNA was extracted using TRIzol reagent and reverse transcribed into cDNA using the PrimeScript RT kit. qRT-PCR was performed using SYBR Green PCR premix and corresponding primers. Relative expression levels were calculated using the 2-ΔCT or 2-ΔΔCT method.

[0098] Western blot for protein immunoblotting

[0099] Cells were lysed in RIPA lysis buffer containing protease inhibitors at 4°C for 30 min, followed by centrifugation at 18,000g for 10 min. The supernatant was quantified by BCA protein assay, separated by SDS-PAGE, and transferred to a PVDF membrane (Millipore, #IPVH00010). The membrane was blocked with 5% BSA at room temperature for 2 h, followed by overnight incubation with the corresponding primary antibody at 4°C. Horseradish peroxidase (HRP)-labeled secondary antibody was incubated at room temperature for 1 h. The signal was amplified using an ECL chemiluminescence ultrasensor kit and detected using an ImageQuant™ LAS 500 system.

[0100] ELISA testing

[0101] The secretion level of GREM1 in culture supernatant was detected by ELISA. Preparation of the standard curve: Eight wells were prepared for the standard on an ELISA-coated plate, and the standards were serially diluted. Sample addition: Blank wells and sample wells were prepared. 50 μL of sample diluent was added to each sample well, followed by 50 μL of the sample to be tested (final dilution of the sample to 2-fold), and the mixture was gently shaken to mix. Incubation: The plate was sealed with sealing film and incubated at 37°C for 60 minutes. Addition of primary antibody: 100 μL of primary antibody working solution was added directly, the plate was sealed with sealing film, and the plate was incubated at 37°C for 60 minutes. Washing: The sealing film was carefully removed, the liquid was discarded, and the plate was shaken dry. 300 μL of washing buffer was added to each well, and the plate was allowed to stand for 60 seconds before discarding. The plate was then patted dry. This process was repeated 3 times. Addition of enzyme conjugate: 100 μL of 1× enzyme conjugate was added, the plate was sealed with sealing film, and the plate was incubated at 37°C for 30 minutes. This process was repeated 5 times. Add chromogenic substrate: Add 90 μl of chromogenic substrate to each well and incubate at 37°C in the dark for 15 minutes. Stop reaction: Add 50 μl of stop solution to each well to stop the reaction (the blue color will immediately turn yellow). Measurement: Zero the instrument using a blank control and measure at a wavelength of 450 nm.

[0102] Fluorescence in situ hybridization (FISH)

[0103] After dewaxing, rehydration, and antigen retrieval, paraffin sections were treated with proteinase K, followed by the addition of human and mouse GREM1 probes (the human and mouse sequences are 5'CY3CGGAUGUGCCUGGGGAUGUAGAA3', SEQ ID NO:13), and washing with 2×, 1×, and 0.5× SSC solutions sequentially. Finally, the cell nuclei were counterstained with DAPI.

[0104] Transcriptome sequencing (RNA-seq) and data analysis

[0105] RNA extraction and transcriptome sequencing were performed on surgically resected primary tumors and omental metastases from HGSOC patients. Libraries were constructed using the NEBN-ext Ultra™ RNA library preparation kit, and their quality was assessed using the Bioanalyzer 2100 system before sequencing on the Illumina Hiseq platform. Differentially expressed genes (DEG) analysis was performed using DESeq2 (v1.42.0), with selection criteria of |log2FoldChange| > 1 and pad just < 0.05. Immune cell infiltration density was analyzed using the R package GSVA (v1.50.0). KEGG and GO enrichment analyses were performed using ClusterProfiler (v4.10.0), and GSEA analysis and visualization were performed using GseaVis (v0.0.5).

[0106] Analysis of public cancer datasets

[0107] The mRNA expression data and related clinical features for all cancer types involved in this invention were obtained from the Gene Expression Database (GEO; https: / / www.ncbi.nlm.nih.gov / geo / ) and the Cancer Genome Atlas (TCGA; https: / / portal.gdc.cancer.gov / ). Survival analysis was performed using the survival package (versions 3.5-7) in R language, and other analytical methods were performed in accordance with the "Transcriptome Sequencing and Data Analysis" section.

[0108] Analysis of public databases for single-cell RNA sequencing (scRNA-seq)

[0109] The scRNA-seq datasets used in this invention are all from publicly available databases. Specifically, they include the HGSOC dataset GSE165897, the CRC datasets GSE144735 and GSE225857. In addition, a recently published HGSOC dataset was obtained from the Mendeley Data platform. https: / / data.mendeley.com / datasets / rc47y6m9mp / 1The data integration, dimensionality reduction, and unsupervised clustering analysis were performed using the Seurat software package (version 4.0.5), and cell types were annotated based on known cell-specific marker genes. Differentially expressed genes (DEGs) in each cluster were identified using the FindAllMarkers function in Seurat (with Wilcox test). GO enrichment analysis was performed using the R software package clusterProfiler (version 4.10.0).

[0110] Analysis of public spatial transcriptome data

[0111] The HGSOC spatial transcriptome data used in this invention are from the publicly available database GSE213699. Expression analysis of relevant genes was performed using the Seurat software package (version 4.0.5).

[0112] HE staining and Masson staining

[0113] Tumor tissue was embedded in paraffin and cut into 4-micrometer-thick sections. After drying, the sections were dewaxed and hydrated. They were then stained with hematoxylin (wood extract) and eosin. The sections were subsequently mounted and observed under a microscope. The tumor tissue was also stained with Masson's trichrome staining kit according to the manufacturer's instructions.

[0114] Preparation and quantification of recombinant adeno-associated virus (AAV9)

[0115] AAV-shGREM1 or AAV-vector, AAV-RC9, and Helper plasmid were triple-transfected into 293T cells to package AAV virus. Viral supernatant was collected, purified by chloroform extraction, and recombinant virus was quantified by qRT-PCR in vg / mL (vector genomes per milliliter). The specific procedures for AAV virus packaging and purification are as follows:

[0116] 1. HEK293T cells were cultured in DMEM complete medium containing 10% fetal bovine serum and 1% penicillin-dextrose antibody until the cell density reached 80%. pHelper, pAAV-RC9, and hGREM1-shRNA-AAV-U6-MCS-CMV-EGFP (hereinafter referred to as AAV-shGREM1) plasmids were transfected at a mass ratio of 1:1:1. The plasmid volume was calculated based on transfecting one 10cm HEK293T cell dish, as follows: pHelper:pAAV-RC9:AAV-shGREM1 = 8.26 μg: 5.2 μg: 4.08 μg. The volume of 1 mg / mL PEI40000 was calculated based on transfecting one 10cm HEK293T cell dish, resulting in 52 μL.

[0117] 2. Add the plasmid to 1 mL of DMEM basal medium according to the dosage, and incubate at room temperature for 5 min. Simultaneously, add the PEI4000 to another 1 mL of prepared DMEM basal medium according to the dosage, and incubate at room temperature for 5 min. Slowly add the DMEM medium containing PEI4000 dropwise to the DMEM medium containing the plasmid to form a transfection mixture, mix thoroughly, and incubate at room temperature for 20 min. Add 2 mL of the transfection mixture to 4 mL of DMEM basal medium, and then replace the 6 mL of the transfection mixture with ? mL of DMEM complete medium containing 10% fetal bovine serum and 1% penicillin antibiotics. The cell culture conditions for all the above methods are 37℃ and 5% CO2.

[0118] 3. 24 h after transfection, discard 2.5 ml of the DMEM medium containing the transfection mixture, add 5 ml of DMEM complete medium containing 10% fetal bovine serum and 1% antibiotics, and continue culturing for 48 h. The culture conditions for all cells were 37℃ and 5% CO2.

[0119] 4. 72 h after transfection, purify AAV-shGREM1 using the following method. Taking the preparation of virus for four 10.0 cm cell culture dishes as an example, perform the following steps: Slowly pipette the cells in the culture dish, then transfer the cell suspension to a 50 ml centrifuge tube to achieve a total volume of 30 ml. Add 3 mL of chloroform to the centrifuge tube and vortex for 5 min to fully disrupt the cell membrane and release viral particles. Add 7.6 mL of 5 M NaCl (final concentration approximately 0.2 M) to the vortexed AAV-shGREM1 virus solution, vortex for 10 s, and then centrifuge at 3000 × g, 4°C for 5 min. Collect the supernatant aqueous phase into a new 50 mL centrifuge tube. Add 7.5 mL of PEG8000 solution to the collected aqueous phase, vortex for 10 s to mix, and store at 4°C overnight (15 h). The following day, centrifuge at 12000 rpm and 4°C for 30 minutes, discard the supernatant, and then add 1.4 mL of PBS buffer to completely resuspend the virus pellet in the centrifuge tube. Add 3.5 μl of 1M MgCl2, 14 μl of 10 μg / μl DNase I, and 1.4 μl of 10 μg / μl RNase A, and then incubate in a water bath at 37°C for 20 minutes. Add chloroform to the crude AAV-shGREM1 solution at a volume ratio of 1:1, vortex for 10 seconds, and centrifuge at 3000 × g and 4°C for 5 minutes. Collect the aqueous phase, and repeat this step twice until the aqueous phase is clear. Add 6 mL of the obtained AAV-shGREM1 virus solution to a 30 kDa ultrafiltration tube, centrifuge at 5400 rpm for 30 minutes to concentrate to a volume of 1 mL. Collect the concentrated AAV-shGREM1 for subsequent titer determination and store at -80°C for later use.

[0120] Titer determination of shGREM1-rAAV:

[0121] 1. Add the AAV-shGREM1 plasmid (initial copy number approximately 10) 10 (vg / μL) Diluted sequentially by 10 1 Up to 10 5 To perform qPCR, 1 μL of AAV-shGREM1 at different dilutions was added sequentially to a reaction system containing 5 μL of 2×SYBR Green qPCR Mix, 0.2 μL of CMV primers (forward and reverse), and 3.6 μL of nuclease-free water. qPCR reaction conditions: A standard curve was plotted comparing viral titer (vg / μL) with CT values ​​at each dilution gradient, and the titer of the AAV-shGREM1 viral concentrate was calculated based on this curve.

[0122] 2. Preparation of shGREM1-rAAV test sample: 85 μL PBS buffer, 5 μL 10 mg / ml DNase I, 5 μL 100 μg / ml proteinase K, and 5 μL AAV-shGREM1 virus concentrate. Incubate at 37℃ for 20 min, then inactivate DNase I at 100℃ for 5 min before loading the sample for qPCR. Each well contains: 5 μL 2×SYBR Green qPCR Mix, 0.2 μL each of the CMV promoter's forward and reverse primers, 3.6 μL enzyme-free water, and 1 μL shGREM1-rAAV test sample. qPCR reaction conditions: Calculate the titer of the AAV-shGREM1 virus concentrate based on the standard curve.

[0123] Unit explanation: vg / mL (vector genomes per milliliter), vg / m refers to the number of viral particles carrying the complete vector genome per milliliter.

[0124] Lentiviral transduction and establishment of stable cell lines: Mouse Grem1 overexpression vector or control vector was co-transfected with pMD2.G and psPAX2 helper plasmids into HEK293T cells using PEI40000. Forty-eight hours after transfection, the supernatant was collected, concentrated with PEG8000, and stored at -80°C. For cell transduction, cells were seeded in six-well plates to 50% confluence and cultured overnight. The medium was then replaced with DMEM / F12 containing lentiviral particles and 10 μg / mL polybrene. After 12 hours, the medium was replaced with DMEM / F12 containing 10% FBS, and selection was performed for 7 days with 1.0–2.0 μg / mL puromycin. The expression of the target gene was detected by fluorescence observation, qRT-PCR, and Western blotting.

[0125] Preparation of conditioned medium (CM)

[0126] The specified cells were cultured in DMEM / F12 medium containing 10% FBS to 80% confluence, then the medium was replaced with 2% FBS and cultured for another 48 hours. The supernatant was collected, centrifuged at 1000g to remove the precipitate, and used for co-culture experiments of the specified cells.

[0127] Mouse fibroblasts and CD4 + T cell co-culture

[0128] L929 cells, with or without Grem1 overexpression, were seeded in 6-well plates (1 × 10⁶ cells per well). 6 (1 cell), cultured for 24 hours to allow complete adhesion. Mouse CD4...+ / CD8 + T-cell isolation magnetic bead kit for isolating CD4 from spleen cells of C57BL / 6J mice. + T and CD8 + T cells. CD4 + T cells were cultured in RPMI 1640 medium containing 10% FBS at 37°C for 24 hours before being added to wells of a plate. Anti-CD3 (1 μg / mL), anti-CD28 (1 μg / mL) antibody, and IL-2 (25 ng / mL) were added to the co-culture system. CD4+ was then... + T cells were transferred to L929 cells and co-cultured in the same culture medium for 48 hours. Cells were then collected for qRT-PCR and flow cytometry (FACS) analysis.

[0129] Tregs inhibition experiment

[0130] CD4+ cells co-cultured with Grem1-L929 cells + T cells and CD8 + T cells were co-cultured at a 1:1 ratio for 48 hours, and then the cells were collected for FACS analysis.

[0131] Flow cytometry analysis (FACS)

[0132] After cell suspension collection, cells were washed with PBS and centrifuged. Cells were stained with viable fixative dyes to remove dead cells. Subsequently, staining was performed using specified antibodies at 4°C for 30 minutes, depending on experimental requirements. These antibodies included CD45, CD3e, CD4, CD8, PD1, TIM3, and CD25. For intracellular or nuclear protein detection, cells were treated with fixation / permeabilization buffer (BD Biosciences) followed by staining with Foxp3 and IFNγ antibodies. Data were acquired using a BD FACS LSR Fortessa X-20 flow cytometer and analyzed using FlowJo 10.8 software (TreeStar, USA).

[0133] animal models

[0134] Animal experiments strictly adhere to the "Principles of Vertebrate Utilization and Care" and the "Guidelines for Laboratory Animal Care and Use," and have been approved by the Animal Ethics Committee of Southern Medical University.

[0135] Orthotopic HGSOC xenograft mouse model

[0136] Eight-week-old female C57BL / 6J mice were anesthetized by inhalation of 5% isoflurane, with 2.5–3.0% isoflurane maintained nasally during the procedure. The fallopian tubes were located using a microscope, and 2 × 10⁻⁶ tubes were inserted. 6 One ID8 cell was injected below the left ovarian sac. Two weeks post-surgery, mice were randomly divided into four groups, receiving 2 × 10⁸ ID8 cells each. 11 Vg / mL AAV9-shGREM 1 and control virus or 200 μg anti-PD1 monoclonal antibody or control mouse IgG were administered intraperitoneally.

[0137] Peritoneal HGSOC xenograft mouse model

[0138] 5×10 6 ID8 cells and an equal number of fibroblasts were co-injected intraperitoneally into 8-week-old female C57BL / 6J mice. Two weeks later, 2×10⁸ ID8 cells and an equal number of fibroblasts were injected intraperitoneally once weekly. 13 vg / mL AAV9-shGREM 1 and control virus.

[0139] Mouse model of colorectal cancer liver metastasis

[0140] 1×10 6 One MC38 cell was suspended in PBS and injected intrasplenically into 8-week-old female C57BL / 6J mice. Three days later, the mice were randomly assigned to groups and administered 2 × 10⁶ cells every 3 days. 11 Vg / mL AAV9-shGREM 1 and control virus. Mice were weighed twice a week and sacrificed on day 21.

[0141] Mouse model of breast cancer lung metastasis

[0142] 5×10 5 Four T1 cells were suspended in PBS and injected into 8-week-old male BALB / cJ mice via the tail vein. Seven days later, the mice were randomly assigned to different groups and received 2 × 10⁴ cells intravenously every 3 days. 11 Vg / mL AAV9-shGREM 1 and control virus were administered. Mice were sacrificed one month after injection, and lung tissue was collected, fixed in 4% buffered formalin, and subjected to pathological analysis.

[0143] HGSOC subcutaneous tumor mouse model

[0144] 2×10 6OVCAR3 cells were subcutaneously injected into the right groin of 5-week-old mice. Body weight and tumor growth were monitored every 3 days, and tumor volume was measured using calipers using the formula "1 / 2a×b²", where a is the major axis and b is the minor axis (unit: mm). Treatment was initiated when the tumor volume reached 100 mm³, with 2 × 10⁻⁶ cells injected every 3 days. 11 vg / mL AAV9-shGREM1-1 and control virus.

[0145] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0146] Example 1

[0147] 1. GREM1 is highly expressed in metastatic CAFs and is associated with poor prognosis in HGSOC patients.

[0148] To understand the clinical significance of GREM1 in the progression of HGSOC, the inventors performed RNA sequencing (RNA-seq) on tumor tissues from the primary lesion and omental metastases of HGSOC patients. All tumor tissue samples were collected during cytoreductive surgery, and none of the patients had received platinum-based chemotherapy (patient information is shown in Table 3).

[0149] Table 3: Clinical Sample Information of HGSOC Patients

[0150]

[0151] RNA-seq analysis showed that GREM1 and fibroblast markers (such as FAP, COL1A1, COL5A2, and COL3A1) were significantly highly expressed in HGSOC metastatic lesions. Figure 1 A). Analysis of the public dataset (GSE165897) of single-cell RNA sequencing (scRNA-seq) from HGSOC patients revealed that GREM1 was highly expressed only in CAFs, but was essentially not expressed in immune cells, endothelial cells, or epithelial cells. Figure 1 B). Compared with the primary lesion, the expression level of GREM1 in metastatic lesions (such as the greater omentum, peritoneum, and mesentery) CAFs was significantly increased. Figure 1 C). Immunofluorescence assays confirmed that GREM1 was positively expressed in the stroma of HGSOC tumor tissue, and the expression level in metastatic lesions was higher than that in the primary lesion (Figure 1D). Western blot and ELISA results showed that compared with the primary lesion CAFs (P), the GREM1 protein level and its secretion were significantly increased in the CAFs (M) of the omental metastases of HGSOC patients (Figure 1E, F).

[0152] Analysis of the TCGA-OV and GSE9891 public datasets also revealed significantly elevated GREM1 expression levels in patients with advanced ovarian cancer compared to those with early-stage disease (Figure 1G, H). Furthermore, GREM1 expression was highest in patients with stromal ovarian cancer (Desbois et al., 2020), which has the worst prognosis (Figure 1H). Importantly, high GREM1 expression was significantly associated with shortened overall survival in HGSOC patients (Figure 1I-J). In conclusion, GREM1 is highly expressed in metastatic CAFs and is associated with HGSOC progression, metastasis, and poor prognosis.

[0153] 2. GREM1 promotes ECM deposition and the establishment of a suppressive immune microenvironment.

[0154] To elucidate the biological significance of GREM1 overexpression, the inventors analyzed RNA-seq data and found that differentially expressed genes upregulated in HGSOC metastases were mainly enriched in immune regulation and extracellular matrix (ECM) remodeling. Figure 2 A); Importantly, in metastatic lesions, the expression levels of some key immunosuppressive genes, such as PDCD1 (encoding PD-1), HAVCR2 (encoding TIM-3), CTLA4, TIGIT, and FOXP3, were significantly higher than in primary lesions (Figure 2B); and the expression level of GREM1 was significantly positively correlated with the expression of the above-mentioned immunosuppressive genes and fibroblast markers (such as FAP, COL1A1, COL3A1, and COL5A2). Figure 2 C). Analysis of the ovarian cancer public dataset (TCGA-OV) also showed that the expression level of GREM1 was significantly positively correlated with the expression of immunosuppressive genes (CTLA4, FOXP3, TIGHT, HAVCR2, and IL10) and fibroblast markers (FAP, COL1A1, and COL5A2) (Figure 2D). Furthermore, the inventors also found, using the spatial transcriptome public dataset (GSE213699), that GREM1 and the aforementioned immunosuppressive genes were spatially co-localized in HGSOC metastases (Figure 2E). In summary, high GREM1 expression may be associated with ECM deposition in metastatic lesions and the formation of an immunosuppressive microenvironment.

[0155] 3. GREM1 promotes Treg cell differentiation and drives the progression and metastasis of HGSOC.

[0156] To confirm the role of GREM1 in promoting the formation of an immunosuppressive microenvironment, the inventors isolated CD4 from mouse spleens. +T cells were directly co-cultured with the mouse fibroblast cell line L929 (L929-Grem1) overexpressing Grem1 at a cell ratio of 1:1, or indirectly co-cultured in Transwell chambers. CD4 counts were then detected by qRT-PCR. + The expression of immunosuppressive genes (such as Foxp3, Ctla4, Lag3, IL10, and Pdcd1) in T cells was increased. Results showed that both co-culture methods significantly increased the expression levels of these immunosuppressive genes (Figure 3A). Flow cytometry analysis indicated that both co-culture methods significantly promoted the expression of regulatory T cells (CD25). + FoxP3 + Differentiation of Tregs (Figures 3B and 3C). When CD4+ cells were sensitized by the above direct co-culture method... + T cells and CD8 cells derived from the same mouse spleen + T cells were co-cultured directly at a 1:1 ratio, followed by depleted PD1 cells. + TIM3 + CD8 + The proportion of T cells increased ( Figure 3 D), Effect type IFNγ + CD8 + The proportion of T cells decreased (Figure 3E). Furthermore, the inventors discovered that injecting mouse ovarian cancer ID8 cells and L929-Grem1 cells in a 1:1 ratio into the peritoneal cavity of mice significantly increased the amount of ascites. Figure 3 F), and these mice also showed more metastatic lesions in their peritoneum and mesentery (F). Figure 3 G); more importantly, tumor-infiltrating Tregs and depleted PD1 + TIM3 + CD8 + The proportion of T cells increased significantly, while effector IFNγ... + CD8 + The proportion of T cells decreased significantly (Figure 3H-J). These findings suggest that GREM1 promotes Treg cell differentiation and inhibits effector CD8. + T cell function drives the progression and metastasis of HGSOC.

[0157] Example 2

[0158] AAV9-shGREM1 therapy inhibits the progression and metastasis of HGSOC.

[0159] Because overexpression of GREM1 promotes the progression and metastasis of HGSOC, the inventors hypothesized that GREM1 inhibitors might be useful for cancer treatment. Therefore, they constructed short hairpin structures shGREM1-1, shGREM1-2, and shGREM1-3 to target and inhibit GREM1 expression. Their RNA sequences and encoded DNA sequences are shown in Tables 1 and 2. Using an adeno-associated virus (AAV) vector, recombinant viral plasmids AAV9-shGREM1-1, AAV9-shGREM1-2, and AAV9-shGREM1-3 were constructed, respectively. Figure 4 A). After infecting L929 cells with the three recombinant AAV9-shGREM1 viruses prepared above, the expression level of GREM1 was detected by qRT-PCR (RNA was extracted from cells infected with each recombinant AAV9-shGREM1 virus, and the relative expression level of GREM1 was measured, repeated 3 times, and the average value was taken). We found that all three recombinant AAV9-shGREM1 viruses could inhibit the expression level of GREM1, and their knockdown effects were not significantly different (Figure 4B). In subsequent examples, AAV9-shGREM1-1 was used and named the GREM1 inhibitor. Further, it was found that compared with the placebo (i.e., the control virus, AAV9-shCtrl, abbreviated as AAV-shCtrl), injections were given every 3 days for a total of 7 times, with a dose of 2×10⁻⁶. 11 vg / mL GREM1 inhibitors significantly inhibited the volume and weight of subcutaneous tumors formed by OVCAR3 cells in nude mice. Figure 4 C). To verify the antitumor effect of GREM1 inhibitors in mouse models with intact immune systems, the inventors constructed orthotopic or intraperitoneal HGSOC model mice and administered 2×10⁻⁶ HGSOC inhibitors to these mice for 6 consecutive weeks. 11 vg / mL GREM1 inhibitor ( Figure 4 D). The results showed that in both HGSOC mouse models, GREM1 inhibitors significantly reduced ascites volume and the number of metastatic lesions. Figure 4 EH), and significantly prolonged the survival time of mice ( Figure 4 I). Furthermore, in orthotopic HGSOC model mice, after 2×10 11 After two weeks of treatment with a vg / mL GREM1 inhibitor, ultrasound examination revealed a significant reduction in the volume of the orthotopic tumor in mice. Figure 4 J), after the mice were euthanized at the end of treatment, it was found that the weight of their primary ovarian tumors was also significantly reduced. Figure 4 K).

[0160] Given that GREM1 promotes extracellular matrix (ECM) deposition and increases tumor tissue stiffness, the inventors hypothesized that GREM1 inhibitors might reduce ECM collagen deposition. Immunofluorescence staining and Masson's trichrome staining results showed that 2×10 11 After 6 weeks of continuous treatment with a vg / mL GREM1 inhibitor, the expression level of αSMA and the degree of collagen deposition in tumor tissues of orthotopic HGSOC model mice were reduced. Figure 4 L, M). In summary, GREM1 inhibitors can significantly inhibit the progression and metastasis of HGSOC and the deposition of ECM.

[0161] Table 1: GREM1-specific short hairpin RNA sequences

[0162]

[0163] The encoding DNA sequence of this short hairpin RNA is shown in Table 2:

[0164] Table 2: DNA sequence encoded by GREM1-specific short hairpin RNA

[0165]

[0166] Example 3: GREM1 inhibitor treatment restores antitumor ability in HGSOC mice

[0167] The inventors further discovered that administering 2×10 for six consecutive weeks... 11 vg / mL GREM1 inhibitor treatment ( Figure 4 D), in the tumor tissues of the two HGSOC model mice mentioned above, CD25 + FoxP3 + The degree of infiltration and depletion of Tregs PD1 + TIM3 + CD8 + The frequency of T cells was significantly reduced ( Figure 5 A to Figure 5 D), while IFN-γ + CD8 + The proportion of T cells increased significantly ( Figure 5 E, F). Importantly, after treatment with GREM1 inhibitors, intratumoral PD1 in orthotopic HGSOC mice... + FoxP3 + CD4 + The number of T cell subsets (with strong immunosuppressive functions) was also significantly reduced. Figure 5 G). Immunofluorescence staining results further confirmed that after treatment with the above-mentioned GREM1 inhibitor, CD25 infiltrating within the tumor of orthotopic HGSOC mice was reduced. + FoxP3+ Tregs and exhausted T cells (PD1) + CD8 + The proportion of ) decreased significantly ( Figure 5 H, I).

[0168] Example 4: Treatment with GREM1 inhibitors enhances the efficacy of PD-1 monoclonal antibodies.

[0169] The synergistic effect between GREM1 inhibitor therapy and anti-PD-1 immunotherapy was further evaluated, and the inventors, based on the experimental design ( Figure 6 A), orthotopic HGSOC mice were randomly divided into 4 groups, including a placebo group (each mouse was injected intraperitoneally with 2×10⁻⁶ g / L HGSOC mice). 11 vg / mLAAV-shCtrl+200μg IgG), PD-1 monotherapy group (2×10g IgG per animal via intraperitoneal injection) 11 vg / mL AAV-shCtrl + 200μg anti-PD-1 monoclonal antibody, GREM1 inhibitor monotherapy group (2×10 vg / mL intraperitoneal injection per animal) 11 (vg / mL AAV-shGREM1 and 200μg IgG) and combination group (2×10 vg / mL AAV-shGREM1 and 200μg IgG per mouse) and the combination group (2×10 vg / mL AAV-shGREM1 and 200μg IgG per mouse) 11 vg / mL AAV-shGREM1 and 200μg anti-PD-1 monoclonal antibody). Results showed that, compared to the monotherapy group, the combination therapy of GREM1 inhibitor and PD-1 antibody significantly inhibited the growth of the primary tumor. Figure 6 B, C), ascites formation ( Figure 6 D) and tumor metastasis ( Figure 6 E, F). Importantly, combination therapy significantly reduced intratumoral infiltrating Tregs and depleted PD1. + TIM3 + CD8 + The number of T cells ( Figure 6 G, Figure 6 H), significantly improves IFN-γ + CD8 + The proportion of T cells ( Figure 6 I).

[0170] The results in summary indicate that GREM1 inhibitors significantly enhance the efficacy of PD-1 antibodies, providing a novel approach with significant application value for the immunotherapy of HGSOC.

[0171] Example 5: High expression of GREM1 is associated with poor prognosis in patients with various cancers.

[0172] 1. GREM1 expression is closely associated with poor prognosis in various human cancers.

[0173] The inventors analyzed the correlation between GREM1 expression levels and poor prognosis in various human cancers using public databases. The results showed that in multiple human cancers, including colorectal cancer (CRC), gastric adenocarcinoma (STAD), pancreatic ductal adenocarcinoma (PDAC), lung adenocarcinoma (LUAD), breast cancer (BRAC), and clear cell renal cell carcinoma (KIPC), patients with high GREM1 expression had significantly worse prognoses than those with low expression. Figure 7 A to Figure 7 K). Importantly, compared to patients with low expression, the enrichment of Tregs in tumor tissues of patients with high GREM1 expression was significantly enhanced (K). Figure 7 L). Public data analysis of scRNA-seq from CRC patients revealed that GREM1 is mainly expressed in fibroblasts ( Figure 7 M,N); and compared with normal tissue, the expression level of GREM1 in fibroblasts of cancerous tissue and its marginal zone in CRC patients was significantly higher (M,N); and compared with normal tissue, the expression level of GREM1 in cancerous tissue and its marginal zone of CRC patients was significantly higher (M,N); Figure 7 O); Importantly, in patients with liver metastases, the expression level of GREM1 in CAFs was significantly higher than that in the primary lesion ( Figure 7 P).

[0174] 2. GREM1 inhibitors can inhibit the progression and metastasis of various cancers.

[0175] Based on the above findings, the inventors hypothesized that GREM1 inhibitor treatment might also inhibit the progression and liver metastasis of CRC. To verify this hypothesis, the inventors established a mouse model of CRC liver metastasis using spleen injection and administered 2 × 10⁻⁶ mmol / L to each mouse every three days. 11 vg / mL GREM1 inhibitor or placebo treatment ( Figure 8 A). The results showed that GREM1 inhibitor treatment significantly reduced the number of liver tumor metastases in mice (A). Figure 8 B to Figure 8 D), reducing the infiltration density of Tregs within the tumor ( Figure 8 E). The inventors further discovered that GREM1 inhibitor treatment can also significantly inhibit the formation of lung tumor metastases in breast cancer mice and reduce the infiltration density of intratumoral Tregs (E). Figure 8 F to Figure 8 I).

[0176] In summary, GREM1 inhibitor therapy can effectively inhibit the metastasis of colorectal cancer and breast cancer. Therefore, this therapy has important application value in the treatment of various cancers.

[0177] Example 6

[0178] 1. Detection of GREM1 expression level in peripheral blood of ovarian cancer patients

[0179] This study included 102 participants, including 34 ovarian cancer patients (29 with HGSOC and 5 with non-HGSOC ovarian cancer) and 69 healthy female controls. Enzyme-linked immunosorbent assay (ELISA) was used to directly detect the GREME1 level in the peripheral blood of the patients. The ELISA kit used was manufactured by Jianglai Biotechnology Co., Ltd., China (catalog number JL14340). The ELISA standard curve and measurement results in this study are shown below. Figure 9 A and 9B. (As...) Figure 9 B shows that, compared with the normal control group (mean = 543 pg / mL), the level of GREM1 protein in peripheral blood was significantly increased in ovarian cancer patients (mean = 4348 pg / mL), with an increase of about 8 times, which was statistically significant between the two groups (p < 0.0001).

[0180] 2. Detection of GREM1 expression levels in peripheral blood of patients with colorectal cancer and gastric adenocarcinoma

[0181] This study included 112 participants, including 31 patients with colorectal cancer, 10 patients with gastric adenocarcinoma, and 71 healthy controls. The level of GREM1 in the peripheral blood of the patients was directly detected using enzyme-linked immunosorbent assay (ELISA). The ELISA kit used was manufactured by Jianglai Biotechnology Co., Ltd., China (catalog number JL14340). Figure 9 As shown in Figures C and D, compared with the normal control group (mean = 543 pg / mL), the level of GREM1 protein in peripheral blood was significantly increased in patients with colorectal cancer (mean = 2098 pg / mL) and patients with gastric adenocarcinoma (mean = 2179 pg / mL), with increases of approximately 3.86 and 4 times, respectively. The difference between the two groups was statistically significant (p < 0.0001).

[0182] As the results above show, direct detection of GREM1 levels in peripheral blood can distinguish between normal controls and ovarian cancer, colorectal cancer, or gastric adenocarcinoma.

[0183] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A GREM1 inhibitor, characterized in that, The GREM1 inhibitor is any substance capable of blocking the activity of GREM1 binding to its receptor, or the GREM1 inhibitor is any substance capable of reducing the activity of GREM1, reducing the stability of GREM1, inhibiting the expression of GREM1, reducing the effective duration of GREM1, or inhibiting the transcription and processing of GREM1. The substance is at least one of nucleic acids, peptides, proteins, antibodies, or small molecule compounds that inhibit or stabilize GREM1 expression.

2. The GREM1 inhibitor according to claim 1, characterized in that, The GREM1 inhibitor is a small interfering RNA molecule (siRNA), short hairpin RNA (shRNA), or antisense nucleotide that specifically interferes with the expression of the GREM1 gene.

3. The GREM1 inhibitor according to claim 2, characterized in that, The GREM1 inhibitor is a short hairpin RNA, the sequence of which is shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or the DNA sequence encoded by the short hairpin RNA is shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:

6.

4. A formulation of a GREM1 inhibitor, characterized in that, The formulation of the GREM1 inhibitor comprises the GREM1 inhibitor of any one of claims 1-3 and a pharmaceutically acceptable carrier or excipient.

5. The formulation of the GREM1 inhibitor according to claim 4, characterized in that, The formulation of the GREM1 inhibitor is a recombinant vector of the GREM1 inhibitor, wherein the recombinant vector includes an expression vector and a GREM1 inhibitor inserted into the expression vector. The GREM1 inhibitor is a siRNA, shRNA or antisense nucleotide that targets and inhibits the expression or activity of the GREM1 gene.

6. The formulation of the GREM1 inhibitor according to claim 5, characterized in that, The expression vector is a plasmid vector, a granular vector, a bacteriophage vector, or a viral vector.

7. The formulation of the GREM1 inhibitor according to claim 6, characterized in that, The viral vector is selected from any of the following: adeno-associated virus (AAV), lentivirus, vaccinia virus, adenovirus, Coxsackie virus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, and vesicular stomatitis virus.

8. The formulation of the GREM1 inhibitor according to claim 5, characterized in that, The pharmaceutically acceptable carrier is a liposome or lipid complex, a cationic polymer, a chitosan polymer, or a nanoparticle carrier.

9. A pharmaceutical composition for treating cancer, characterized in that, The active ingredient of the pharmaceutical composition includes a formulation of the GREM1 inhibitor according to any one of claims 1-3 or the GREM1 inhibitor according to any one of claims 4-8, and an immune checkpoint inhibitor; the GREM1 inhibitor or the formulation of the GREM1 inhibitor and the immune checkpoint inhibitor are each independent drug delivery units, or the GREM1 inhibitor or the formulation of the GREM1 inhibitor and the immune checkpoint inhibitor together form a combined drug delivery unit.

10. The pharmaceutical composition for treating cancer according to claim 9, characterized in that, The immune checkpoint inhibitor is at least one of anti-PD-1, CTLA-4, and TIM-3 antibodies.

11. The use of the GREM1 inhibitor of any one of claims 1-3, or an formulation of the GREM1 inhibitor of any one of claims 4-8, or the pharmaceutical composition for treating cancer of any one of claims 9-10, in the preparation of a medicament for treating cancer.

12. The use of the GREM1 inhibitor of any one of claims 1-3, or an formulation of the GREM1 inhibitor of any one of claims 4-8, or the pharmaceutical composition for treating cancer of any one of claims 9-10, in the preparation of a medicament for inhibiting cancer metastasis.

13. The application according to claim 11 or 12, characterized in that, The cancer typically refers to primary solid carcinoma and metastatic carcinoma with a matrix, or cancer with GREM1 overexpression in stromal fibroblasts and secretion in the tumor microenvironment (TEM), or cancer with GREM1 overexpression in stromal cells or epithelial cells.

14. The application according to claim 13, characterized in that, The cancer is at least one of the following: ovarian cancer, colorectal cancer, breast cancer, gastric adenocarcinoma, pancreatic ductal adenocarcinoma, lung adenocarcinoma, oral squamous cell carcinoma, and kidney cancer.

15. The application according to claim 13, characterized in that, The cancer in question is either high-grade serous ovarian cancer (HGSOC) or stromal ovarian cancer.

16. The application according to claim 13, characterized in that, The cancer in question is an early-stage or / and advanced-stage cancer.

17. The application according to claim 13, characterized in that, The advanced stage cancer refers to cancer that has undergone local invasion or distant metastasis.

18. A treatment for cancer, characterized in that, The formulation of the GREM1 inhibitor of any one of claims 1-3 or the GREM1 inhibitor of any one of claims 4-8, or the pharmaceutical composition for treating cancer of any one of claims 9-10, administered to a subject at a therapeutic dose.

19. A method for detecting cancer, characterized in that, The method includes detecting the expression level of GREM1 in the patient's body fluids.

20. The detection method according to claim 19, wherein the body fluid is blood, saliva, ascites, urine, or tissue exudate.

Images