Application of miR-181c-5p and extracellular vesicle containing miR-181c-5p in preparation of medicine for treating diabetic nephropathy

Abstract

The invention provides application of miR-181c-5p and an extracellular vesicle containing the miR-181c-5p in preparation of a medicine for treating diabetic nephropathy, and belongs to the technical field of biological medicine. Researches find that miR-181c-5p and extracellular vesicles containing miR-181c-5p can inhibit intracellular Fe < 2 + > generation, ROS generation, MDA accumulation and increase GSH synthesis by regulating and controlling expression of TFRC genes, ACSL4 genes and PTGS2 genes, and then podocyte ferroptosis is inhibited, so that the effect of improving glomerular injury in the diabetic nephropathy process is achieved; the miR-181c-5p and the extracellular vesicles containing the miR-181c-5p may be key targets for treating the diabetic nephropathy, can be used for developing medicines for treating the diabetic nephropathy, and have good practicability.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of miR-181c-5p and extracellular vesicles containing miR-181c-5p in the preparation of drugs for treating diabetic nephropathy. Background Technology

[0002] Diabetic kidney disease (DKD) is one of the most common and serious microvascular complications of diabetes mellitus, and it has become the leading cause of end-stage renal disease worldwide. The pathological features of DKD mainly include damage to the glomerular filtration barrier, thickening of the basement membrane, expansion of the mesangial matrix, loss of podocytes, and tubulointerstitial fibrosis. Podocytes are highly differentiated terminal cells and a key component of the glomerular filtration barrier. Damage and loss of podocytes are a core and irreversible process in the development of DKD. In DKD, podocytes undergo a series of significant pathological changes, such as foot process disappearance, cell hypertrophy, cell cycle arrest, metabolic remodeling, mitochondrial dysfunction, increased oxidative stress and endoplasmic reticulum stress, and increased secretion of inflammatory factors. These changes lead to podocyte detachment from the basement membrane and loss in the urine, thereby disrupting the integrity of the glomerular filtration barrier and causing continuous disease progression. Currently, clinical treatments for kidney disease (DKD) mainly include glycemic control, blood pressure management, and the use of renin-angiotensin system blockers. However, these methods can only slow disease progression in some patients and cannot reverse existing kidney damage, especially for patients with advanced DKD. Therefore, developing novel treatment strategies that target the mechanisms of podocyte injury is urgently needed.

[0003] In recent years, extracellular vesicles derived from mesenchymal stem cells (MSCs-EVs) have become ideal natural carriers for delivering bioactive molecules (such as proteins, mRNA, and miRNA) due to their low immunogenicity, high biocompatibility, excellent tissue targeting, and barrier penetration capabilities. HucMSCs-EVs, in particular, not only possess these advantages but also offer benefits such as wide availability, ease of expansion, minimal ethical controversy, and abundance of paracrine factors. HucMSCs-EVs are rich in various bioactive microRNAs (miRNAs), which participate in multiple protective effects, including anti-inflammatory, anti-fibrotic, anti-oxidative, and anti-cell death effects, by regulating gene expression and signaling pathways in recipient cells. This provides new insights for the treatment of disseminated intracellular drug delivery (DKD).

[0004] Ferroptosis is a novel iron-dependent cell death mechanism driven by lipid peroxidation, playing a crucial role in damage repair. This repair process involves multiple key genes and pathways: transferrin receptor (TFRC) is responsible for cellular iron uptake and regulates intracellular iron concentration; acyl-CoA synthase long chain member 4 (ACSL4) catalyzes the esterification of polyunsaturated fatty acids, providing substrates for lipid peroxidation; and prostaglandin intraperoxide synthase 2 (PTGS2 / COX-2) serves as a biomarker of ferroptosis, reflecting oxidative stress and inflammation levels. These molecules constitute the core regulatory network of ferroptosis and also provide novel potential targets for the treatment of diabetic kidney disease (DKD). Summary of the Invention

[0005] To address some shortcomings in existing technologies, this invention provides the application of miR-181c-5p and extracellular vesicles containing miR-181c-5p in the preparation of drugs for treating diabetic nephropathy. Through research, this invention has discovered that miR-181c-5p and extracellular vesicles containing miR-181c-5p can inhibit intracellular Fe by regulating the expression of TFRC, ACSL4, and PTGS2 genes. 2+ The miR-181c-5p and extracellular vesicles containing miR-181c-5p may be key targets for the treatment of diabetic nephropathy, and can be used to develop drugs for the treatment of diabetic nephropathy, which has great practicality.

[0006] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0007] The present invention first provides the use of miR-181c-5p, or extracellular vesicles containing miR-181c-5p, in the preparation of drugs for treating diabetic nephropathy.

[0008] Preferably, the nucleotide sequence of miR-181c-5p is shown in SEQ ID NO:1.

[0009] Preferably, the extracellular vesicles are derived from human umbilical cord mesenchymal stem cells (HucMSCs).

[0010] Preferably, the diabetic nephropathy includes diabetic nephropathy caused by high blood sugar and high fat intake.

[0011] Preferably, the application includes one or more of the following:

[0012] (a) Targeted regulation of TFRC, ACSL4 and PTGS2 gene expression;

[0013] (b) Improves podocyte ferroptosis;

[0014] (c) Improves diabetic glomerular damage;

[0015] (d) Inhibit intracellular Fe 2+ Generation, ROS generation, and MDA accumulation;

[0016] (e) Increases intracellular GSH synthesis.

[0017] The present invention also provides an extracellular vesicle containing miR-181c-5p, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0018] The present invention also provides the use of the above-mentioned extracellular vesicles in the preparation of a drug for treating diabetic nephropathy. The present invention also provides a drug for treating diabetic nephropathy, the drug comprising miR-181c-5p, or extracellular vesicles comprising miR-181c-5p.

[0019] Preferably, the nucleotide sequence of miR-181c-5p is shown in SEQ ID NO:1.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention, through intervention with hucMSC-EVs in a diabetic nephropathy model, found that hucMSC-EVs effectively improved glomerular damage in diabetic nephropathy rats and mice, and inhibited ferroptosis in the kidney tissue of diabetic nephropathy rats and mice. Furthermore, this invention verified the inhibitory effect of hucMSC-EVs on podocyte ferroptosis by establishing a high-glucose, high-lipid cell model.

[0022] This invention identified the key molecule miR-181c-5p in hucMSC-EVs through combined RNA sequencing and database prediction analysis, and experimentally verified its high expression in hucMSC-EVs. The invention also confirmed through dual-luciferase reporter gene assays that miR-181c-5p can target and regulate the TFRC, ACSL4, and PTGS2 genes. Furthermore, this invention demonstrated that miR-181c-5p mimic / inhibitor was transfected into podocytes under high glucose and high lipid conditions, and the results showed that miR-181c-5p can inhibit intracellular Fe... 2+The production of miR-181c-5p, ROS generation, MDA accumulation, and increased GSH synthesis inhibit ferroptosis; conversely, transfection with miR-181c-5p inhibitor accelerates podocyte ferroptosis. This invention also inhibits miR-181c-5p expression in hucMSC-EVs using electroporation, and compared with uninhibited native hucMSC-EVs, further clarifies that miR-181c-5p plays a dominant role in inhibiting podocyte ferroptosis in hucMSC-EVs.

[0023] This invention reveals that hucMSC-EVs target and regulate the expression of TFRC / ACSL4 / PTGS2 via miR-181c-5p, thereby inhibiting podocyte ferroptosis and improving glomerular damage in diabetic nephropathy. miR-181c-5p may be a key target for treating diabetic nephropathy and has significant application value and potential for drug development. Attached Figure Description

[0024] Figure 1 Morphological image of newly formed hucMSCs observed under a bright field microscope (A), image of Alizarin Red S staining results after osteogenic induction of hucMSCs (B), image of Oil Red O staining results after adipogenic induction of hucMSCs (C).

[0025] Figure 2 The figure shows the results of flow cytometry detection of hucMSCs biomarkers; in the figure, A is the isotype control, BD is the positive expression of hucMSCs CD105, CD73 and CD166, and EG is the negative expression of hucMSCs CD11b, CD34 and CD45.

[0026] Figure 3 This image shows the morphological results of hucMSC-EVs observed under a transmission electron microscope.

[0027] Figure 4 The average particle size and particle concentration of hucMSC-EVs were determined by NTA. In the figure, A is the average particle size kurtosis plot, and B is the average particle size and particle concentration of hucMSC-EVs.

[0028] Figure 5 The image shows the results of Western blot detection of protein biomarkers in hucMSC-EVs.

[0029] Figure 6 This image shows the uptake of Dil-labeled hucMSC-EVs by podocytes. In the image, A represents the podocyte nucleus (blue), B represents Dil-labeled hucMSC-EVs (red), and C is a composite image.

[0030] Figure 7 Figure A shows the results of evaluating the repair effect of HucMSC-EVs on glomerular injury in the DKD model. Figure B shows the results of HE, PAS and Masson staining of kidney tissue sections. Figure B shows the results of tissue immunofluorescence detection of Podocin expression level.

[0031] Figure 8 Fe in renal tissue after hucMSC-EVs intervention 2+ Figure A shows the Fe content results in the kidney tissue of the db / db mouse model after intervention with hucMSC-EVs. 2+ Figure B shows the Fe content in the kidney tissue of the DKD rat model after intervention with hucMSC-EVs. 2 + The content of.

[0032] Figure 9 Figure A shows the MDA content in the kidney tissue after hucMSC-EVs intervention in the db / db mouse model, and Figure B shows the MDA content in the kidney tissue after hucMSC-EVs intervention in the DKD rat model.

[0033] Figure 10 Figure A shows the GSH content in the kidney tissue after hucMSC-EVs intervention in the db / db mouse model, and Figure B shows the GSH content in the kidney tissue after hucMSC-EVs intervention in the DKD rat model.

[0034] Figure 11 Immunohistochemical staining was used to detect the expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in kidney tissue sections of DKD rats. Figure A shows the expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in kidney tissue after intervention with hucMSC-EVs in the db / db mouse model, and Figure B shows the expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in kidney tissue after intervention with hucMSC-EVs in the DKD rat model.

[0035] Figure 12 The expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in renal tissue after hucMSC-EVs intervention was detected by qRT-PCR. Figure A shows the expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in renal tissue of db / db mouse model after hucMSC-EVs intervention, and Figure B shows the expression of TFRC, ACSL4, PTGS2, GPX4 and xCT in renal tissue of DKD rat model after hucMSC-EVs intervention.

[0036] Figure 13 The image shows the results of CCK8 assay for Fer-1 rescuing cell viability.

[0037] Figure 14 Figure A shows the changes in GSH (Figure A) and MDA (Figure B) levels in podocytes after intervention with hucMSC-EVs.

[0038] Figure 15 Figure 1 shows the results of immunofluorescence assay for the expression of TFRC (Figure A), ACSL4 (Figure B), PTGS2 (Figure C), GPX4 (Figure D), and xCT (Figure E) in podocytes.

[0039] Figure 16 The figure shows the results of detecting changes in ROS levels in podocytes using the DCFH-DA probe.

[0040] Figure 17 FerroOrange probe for Fe in podocytes 2+ The result of fluorescence imaging.

[0041] Figure 18 Venn diagram for miRNA prediction (Figure A) and miRNA sequencing diagram (Figure B).

[0042] Figure 19 Figure showing the relative expression results of miR-181c-5p in hucMSCs and hucMSC-EVs detected by qRT-PCR.

[0043] Figure 20 The predicted binding sites of miR-181c-5p targeting TFRC / ACSL4 / PTGS2 are shown in Figure A, Figure B, and Figure C.

[0044] Figure 21 Figure 1 shows the results of dual-luciferase reporter gene assays to verify the binding of TFRC / ACSL4 / PTGS2 mRNA to miR-181c-5p. Figure 2 shows the results of the assays to verify the binding of TFRC mRNA to miR-181c-5p, Figure 3 shows the results of the assays to verify the binding of ACSL4 mRNA to miR-181c-5p, and Figure 4 shows the results of the assays to verify the binding of PTGS2 mRNA to miR-181c-5p.

[0045] Figure 22 Figure showing changes in ROS levels in podocytes detected by the DCFH-DA probe.

[0046] Figure 23For the FerroOrange probe to target Fe in podocytes 2+ The result of fluorescence imaging.

[0047] Figure 24 The image shows the results of JC-1 detection of mitochondrial membrane potential in podocytes.

[0048] Figure 25 Figure showing the results of CCK8 assay to detect changes in cell viability due to miR-181c-5p mimic rescue / inhibitor inhibition.

[0049] Figure 26 Figure A shows the results of GSH (Figure A) and MDA (Figure B) content after intervention.

[0050] Figure 27 Figure 1 shows the results of qRT-PCR detection of changes in miR-181c-5p (Figure A), TFRC (Figure B), ACSL4 (Figure C), and PTGS2 (Figure D) mRNA levels.

[0051] Figure 28 This is a graph showing changes in cell viability as detected by CCK8.

[0052] Figure 29 Figure A shows the results of GSH (Figure A) and MDA (Figure B) content after intervention.

[0053] Figure 30 Figure showing changes in ROS levels in podocytes detected by the DCFH-DA probe.

[0054] Figure 31 FerroOrange probe for Fe in podocytes 2+ The result of fluorescence imaging.

[0055] Figure 32 The image shows the results of JC-1 detection of mitochondrial membrane potential in podocytes.

[0056] Figure 33 To observe the morphology of mitochondria in cells using transmission electron microscopy. Detailed Implementation

[0057] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the biochemical reagents, consumables, etc. used in the embodiments are commercially available products.

[0058] The sequence of miR-181c-5p mentioned in the following examples is: AACAUUCAACCUGUCGGUGAGU (SEQ ID No: 1);

[0059] The sequence of miR-181c-5p mimics is: AACAUUCAACCUGUCGGUGAGU (SEQ ID No: 2);

[0060] The sequence of miR-181c-5p inhibitors is: ACUCACCGACAGGUUGAAUGUU (SEQ ID No: 3).

[0061] Example 1:

[0062] In this embodiment, HucMSCs were isolated, cultured, and identified. Then, hucMSC-EVs were extracted from the HucMSCs and identified. The specific steps are as follows:

[0063] Isolation, culture and identification of S1.HucMSCs:

[0064] Fresh umbilical cord specimens were obtained from the Fourth Affiliated Hospital of Jiangsu University (Zhenjiang Maternal and Child Health Hospital), and approved by the Ethics Committee of Zhenjiang Maternal and Child Health Hospital (Ethics Review No. 201701). The obtained umbilical cord tissue was cleaned with PBS to remove surface blood, and arteries and veins were removed. The tissue was then transferred to a 100 mm dish in α-MEM medium (supplied by Invitrogen) containing 15% fetal bovine serum and 1% penicillin-dextrose antibody. The umbilical cord tissue was then quickly cut into pieces approximately 2 mm in size. 2 Small pieces were attached to the bottom of a new 35mm dish and placed upside down in a larger dish for incubation. When the culture medium was nearly dry, additional medium was added, and incubation continued, changing the medium every 3 days. When cells around the tissue block grew into a whorl-like structure, the tissue block was removed, digested, and passaged to expand the cells, yielding P1 generation hucMSCs. Microscopic examination of the P1 generation hucMSCs showed that primary hucMSCs were successfully isolated using the umbilical cord tissue block adhesion method; the cells exhibited a typical elongated spindle-shaped morphology under the microscope. Figure 1 A). After passage to the 3rd generation (P3), cells in good condition were selected for osteogenic and adipogenic induction differentiation. The specific steps are as follows:

[0065] Osteogenic induction differentiation:

[0066] Coat 6-well plates with 0.1% gelatin, incubate at 37°C for 30 minutes, then remove. Take healthy P3 generation hucMSCs, digest them, and then incubate at 2 × 10⁶ cells per well. 5Cells were seeded in pre-coated plates and cultured in α-MEM containing 10% FBS until complete confluence. The medium was then replaced with 2 mL of osteogenic induction medium (supplied by OriCell) every 3 days. After extensive calcification, Alizarin Red S staining was performed: the cells were washed with PBS, fixed with 4% paraformaldehyde for 30 minutes, washed three times with PBS, stained with Alizarin Red S for 10 minutes, washed three more times with PBS, and then examined under a microscope. Microscopic examination revealed obvious calcification. Figure 1 B).

[0067] Adipogenic differentiation:

[0068] Coat 6-well plates with 0.1% gelatin, incubate at 37°C for 30 minutes, then remove. Take P3 generation hucMSCs, digest them, and then fill each well with 2 × 10⁶ cells. 5 Cells were seeded and cultured in α-MEM containing 10% FBS until complete confluence. Then, 2 mL of lipidogenesis induction solution A (supplied by OriCell) was used for 3 days, followed by induction with solution B (supplied by OriCell) for 1 day. This alternating induction was repeated 3–5 times. Finally, cells were cultured in solution B for 4–7 days. When lipid droplets were clearly visible, Oil Red O staining was performed: after washing with PBS, the cells were fixed with 4% paraformaldehyde for 30 minutes, washed three times with PBS, stained with Oil Red O for 20 minutes, washed three more times with PBS, and examined under a microscope. Microscopic examination revealed a large aggregation of lipid droplets. Figure 1 C).

[0069] It is evident that hucMSCs possess excellent osteogenic and adipogenic differentiation capabilities.

[0070] This step also uses flow cytometry to detect surface markers in hucMSCs, as detailed below:

[0071] Take healthy P3 generation cells, digest them with trypsin, collect the pellet, wash with PBS and resuspend to 3×10⁻⁶. 6 / mL. Add 100μL of cell suspension and 2μL of different primary antibodies (CD105, CD73, CD166, CD11b, CD34, CD45) or isotype control to each EP tube. Mix well and incubate at 4°C for 30 minutes. Wash with buffer, centrifuge at 300g for 5 minutes and discard the supernatant. Add another 100μL of buffer and 2μL of the corresponding fluorescent secondary antibody (CD105, CD73, CD166, CD11b, CD34, CD45). Mix well and incubate at 4°C in the dark for 30 minutes. Wash, centrifuge, resuspend in 400μL buffer, and analyze. The results are as follows. Figure 2 As shown in the figure, hucMSCs highly express positive mesenchymal stem cell surface markers such as CD105, CD73, and CD166, while failing to express negative markers such as CD11b, CD34, and CD45, which conforms to the internationally recognized MSC phenotypic characteristics.

[0072] Separation and extraction of S2.hucMSC-EVs:

[0073] The P3 generation hucMSCs obtained in step S1 were cultured in α-MEM medium containing 10% FBS. When the cell density reached 60–70%, the original medium was discarded, the cells were washed twice with PBS, and cultured in 10% FBS-free α-MEM medium for another 48 hours. The supernatant was then collected, and this process was continued until the P7 generation. The collected P3–P7 generation cell culture supernatants were centrifuged sequentially at 300g, 500g, 2000g, and 10000g to remove cells and debris. The supernatants were transferred to ultrafiltration tubes and concentrated by centrifugation at 2000g for 30 min at 4°C. The concentrate was then ultracentrifuged at 100000g for 3 h, the supernatant was discarded, the cells were resuspended in PBS, and ultrafiltration was repeated. The resulting precipitate was thoroughly dissolved in PBS and sterilized through a 0.22 μm filter membrane to obtain freshly acquired EVs.

[0074] Approximately 20 μL of freshly acquired EVs was dropped onto a copper mesh and allowed to stand for 5 minutes before removing excess liquid. The copper mesh was then inverted onto a drop of 3% (w / v) phosphotungstic acid solution (pH 6.8), allowed to stand for 5 minutes, dried under an incandescent lamp, and observed and photographed under a transmission electron microscope. The transmission electron microscope images showed that hucMSC-EVs exhibited a typical cup-shaped structure with an intact membrane structure. Figure 3 ).

[0075] The EVs were appropriately diluted with pure water. A 1 mL sample was drawn up with a syringe and injected into the detector. The instrument analyzed Brownian motion data to determine the particle size distribution and particle concentration. NTA showed that the average particle size was 144.7 nm and the particle concentration was 1.2 × 10⁻⁶. 11 particles / mL Figure 4 ).

[0076] This step also uses Western blot to detect hucMSC-EVs protein biomarkers, as detailed below:

[0077] Mix EVs with an equal volume of RIPA lysis buffer, place on ice, vortex for 1 minute, then place on ice for 10 minutes, repeating 3–5 times. Then add 1 / 3 volume of protein loading buffer, mix well, boil at 100°C for 10 minutes, incubate on ice for 2 minutes, and store at -20°C for later use. Prepare a 12% SDS-PAGE gel, load hucMSC-EVs proteins for electrophoresis, transfer to a PVDF membrane at 300mA for 90 minutes, block with 5% skim milk TBST at room temperature for 2 hours, incubate overnight at 4°C with CD63, CD8, CD9, TSG10, ALIX, and Calnexin primary antibodies (1:500), wash the membrane 3 times with TBST, react with HRP-labeled secondary antibody at 37°C for 1 hour, wash 3 times again, add HRP luminescent substrate, and perform chemiluminescence imaging. Western blot analysis showed that hucMSC-EVs positively expressed the marker proteins CD9, CD63, CD81, TSG101, and Alix, but did not express the negative marker Calnexin. Figure 5 ).

[0078] To verify that hucMSC-EVs can be effectively taken up by podocytes, a cellular uptake assay of hucMSC-EVs was also performed in this step. In this assay, hucMSC-EVs were labeled with Vybrant CM-Dil fluorescent dye and co-incubated with podocytes. The specific steps are as follows:

[0079] Mix 100 μL LEVs with 5 μL LCM-Dil dye, incubate at 37°C in the dark for 45 min, transfer to an ultrafiltration tube, add 1 mL PBS, mix well, centrifuge at 2000g for 30 min at 4°C, repeat 3 times, and collect the concentrate. After podocytes (purchased from Beina Biotechnology Cell Bank) adhere to the culture medium, discard the culture medium, wash once with PBS, add culture medium and 20 μL concentrate, incubate for 12 h, discard the culture medium after incubation, wash twice with PBS, fix with 4% paraformaldehyde for 10–30 min, wash with PBS 3 × 5 min, stain the nuclei with Hoechst 33342 (1:400) for 10 min, wash with PBS 3 × 5 min, invert the slides onto an anti-quenching agent, and handle in the dark throughout. Mount the slides, and then observe and photograph under a fluorescence microscope. Under the fluorescence microscope, a widespread distribution of red fluorescence signal can be seen in the cytoplasm of podocytes. Figure 6 This study confirmed that podocytes can efficiently take up hucMSC-EVs.

[0080] In summary, this embodiment successfully isolated and cultured primary hucMSCs for amplification, and extracted high-purity hucMSC-EVs for subsequent experiments. The successful uptake of hucMSC-EVs by podocytes also laid the foundation for subsequent functional experiments.

[0081] Example 2:

[0082] This embodiment examines the repair effect of hucMSC-EVs isolated and extracted in Example 1 on glomerular damage in a DKD model. The specific steps are as follows:

[0083] (1) Construction of db / db mouse model and STZ / high-fat diet (HFD) induced DKD rat model:

[0084] Seven-week-old male db / m and db / db mice used in the experiment were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., with an initial weight of 40–60g. db / m mice served as the normal control group, and db / db mice served as the experimental group. After a week of acclimatization at the Experimental Animal Center of Jiangsu University, the experimental group mice were fed a 45% high-fat diet for four weeks. During this period, fasting blood glucose was monitored weekly, and 24-hour urine samples were collected to determine the urinary microalbumin to creatinine ratio. The model was considered successfully established when the fasting blood glucose of the experimental group mice was ≥16.7 mmol / L and the urinary microalbumin to creatinine ratio was ≥300 mg / 24h.

[0085] Subsequently, the successfully modeled db / db mice were randomly divided into two groups: the DKD group and the DKD+hucMSC-EVs group. Starting from week 12, mice in the DKD+hucMSC-EVs group were injected with hucMSC-EVs via the tail vein at a dose of 5 × 10⁻⁶. 9 Particle count / kg, administered once every 5 days; the DKD group received an equal volume of PBS as a control at the same time points.

[0086] The entire modeling process lasted 24 weeks. After the process, the mice were sacrificed and kidney tissue was collected for further analysis.

[0087] STZ / high-fat diet (HFD) induced DKD rat model:

[0088] Eight-week-old SD rats, weighing 190±10g, were purchased from the Experimental Animal Center of Jiangsu University and randomly divided into a normal control group and an experimental group. The experimental group rats were fed a 45% high-fat diet for 5 weeks, while the control group continued to be fed a normal diet. After 5 weeks, the experimental group rats were injected with streptozotocin (STZ) via the tail vein at a dose of 35mg / kg. Random blood glucose levels were then measured. Rats with a blood glucose level ≥16.7mmol / L were included in subsequent experiments.

[0089] Rats meeting blood glucose standards were randomly divided into a DKD group and a DKD+hucMSC-EVs group. Intervention began 8 weeks after STZ injection: the DKD+hucMSC-EVs group received tail vein injection of hucMSC-EVs at a dose of 1×10⁻⁶. 11Particles / kg were injected every 3 days during the first month, then weekly thereafter; the DKD group received the same amount of PBS via injection in the same manner and frequency. The entire experiment lasted 24 weeks. At the end of the experiment, the animals were sacrificed and kidney tissue was collected for subsequent experiments.

[0090] (2) Investigation on the repair effect of hucMSC-EVs on glomerular injury in the DKD model:

[0091] HE staining: Kidney tissue from db / db mouse and DKD rat models was used as the injury group, kidney tissue from the Normal group was used as the control group, and kidney tissue from the hucMSC-EVs group was used as the intervention group. Wax sections were dried at 60℃ for 4–6 hours, dewaxed with xylene for 2 × 15 min, and then treated with gradient alcohols (100%, 95%, 95%, 90%, 85%, 75%) for 3 min each, followed by washing with ddH2O. Hematoxylin staining was performed for 5–10 min, followed by washing with water, differentiation with 1% hydrochloric acid ethanol for 1–5 s, washing with water, blueing with 0.5% ammonia for 20–30 s, washing with water, eosin staining for 1–3 min, washing with water, dehydration with alcohol, clearing with xylene for 30 min, mounting with neutral resin, and air-drying before scanning with a pathological scanner.

[0092] PAS staining: HE staining and dewaxing to water. Then periodic acid oxidation at room temperature in the dark for 5–10 min, washed with water, Schiff staining in the dark for 15–30 min, washed with water, hematoxylin counterstaining for 1–2 min, washed with water, differentiation with 1% hydrochloric acid and ethanol for 1–5 s, washed with water, dehydrated with alcohol gradient, cleared with xylene for 30 min, mounted with neutral resin, air-dried, and then scanned for observation using a pathological scanner.

[0093] Masson staining: HE staining and dewaxing to water. Weigert iron hematoxylin staining solution (A:B = 1:1) for 2–5 min, differentiation with acidic ethanol for 5–15 s, and washing with water for 1 min. Masson blueing solution for 3–5 min, washing with water and then double-distilled water for 1 min. Ponceau S staining for 5–10 min, washing with weak acid working solution (double-distilled water: weak acid solution = 2:1) for 1 min. Phosphomolybdic acid washing for 1–2 min, followed by washing with weak acid working solution for 1 min. Aniline blue staining for 1–2 min, washing with weak acid working solution for 1 min. 95% ethanol quick wash for 2–3 s, dehydration with anhydrous ethanol for 3 × 2 s, clearing with xylene for 3 × 2 min, mounting with neutral resin, air drying, and then scanning the pathological sections for observation.

[0094] Immunofluorescence staining: HE staining and dewaxing to water. Freshly prepared 0.01M citrate buffer was used to immerse the sections, followed by heating at 100℃ for 30 min and then allowing to cool naturally. 5% BSA was added for blocking at room temperature for 1 h, then discarded. Primary antibody Podocin (1:200) was added and incubated overnight at 4℃. The sections were washed with PBS 3×5 min, then incubated with 1:300 fluorescent secondary antibody at room temperature in the dark for 90 min, followed by washing with PBS 3×10 min. Hoechst (1:400) staining was performed in the dark for 10 min, followed by washing with PBS 3×10 min. Anti-fluorescence quencher was added, and the sections were mounted and observed and photographed under a fluorescence microscope.

[0095] Staining results showed that the glomeruli and tubules in the normal control group were structurally intact, with no obvious pathological changes. The DKD model group, however, exhibited typical diabetic nephropathy lesions, including significant proliferation of the glomerular mesangial matrix, diffuse thickening of the basement membrane, atrophy of tubular epithelial cells, and abundant blue collagen fiber deposition and significant inflammatory cell infiltration in the interstitial region. In the hucMSC-EVs treatment group, these pathological changes were significantly reduced, glomerular structure improved, and mesangial proliferation and collagen deposition were significantly decreased. Figure 7 A).

[0096] This embodiment further employs immunofluorescence staining to perform localization and semi-quantitative analysis of the glomerular podocyte marker protein podocin. The analysis results are as follows: Figure 7 As shown in Figure B, compared with the normal group, the fluorescence intensity of Podocin in the kidney tissue of the DKD group was significantly reduced, indicating severe podocyte damage and possible damage to the slit septum structure. However, after intervention with hucMSC-EVs, the fluorescence intensity of Podocin significantly increased, approaching the level of the normal group, indicating that hucMSC-EVs has a certain repair effect on podocyte damage in DKD.

[0097] In summary, the db / db mouse model and the STZ / high-fat diet (HFD) induced DKD rat model were successfully established, and experimental verification showed that hucMSC-EVs have a certain repair effect on glomerular damage in DKD.

[0098] Example 3:

[0099] This embodiment used the Normal group as the control group, the DKD group as the injury group, and the hucMSC-EVs group as the intervention group to investigate the effect of hucMSC-EVs on inhibiting ferroptosis in the DKD model. The specific investigation steps are as follows:

[0100] S1. Tissue iron content detection:

[0101] This step uses a tissue iron content assay kit (supplied by Solarbio) to measure ferrous ions (Fe2+) in the renal cortex-medullary junction tissue.2+ The content determination process is as follows:

[0102] Take approximately 0.1g of kidney tissue (corticomedullary junction) from the control group, injury group, and intervention group, add 1mL of the extraction buffer from the kit, homogenize on ice, centrifuge at 4000g for 10min at 4℃, and collect the supernatant. Add the reagents from the kit according to Table 1, vortex to mix, centrifuge at 10000rpm for 10min at room temperature, aspirate 200μL of the upper inorganic phase, measure the absorbance at 520nm, and calculate the iron content according to the method described in the kit.

[0103] Table 1. Tissue Iron Content Determination - Sample Loading Table

[0104]

[0105] from Figure 8 It can be seen that Fe in the DKD model group 2+ The levels increased significantly, but decreased significantly after intervention with hucMSC-EVs.

[0106] S2. Detection of malondialdehyde (MDA) content in tissues:

[0107] Excessive accumulation of Fe 2+ Lipid peroxidation can be promoted through the Fenton reaction, with malondialdehyde (MDA) being one of the key end products. In this step, the MDA content was detected in the kidney tissue of the db / db mouse model constructed in Example 2 and the STZ / high-fat diet (HFD) induced DKD rat model using a malondialdehyde (MDA) content detection kit (supplied by Solarbio). The specific steps are as follows:

[0108] Take approximately 0.1g of kidney tissue (corticomedullary junction), add 1mL of extraction buffer, homogenize on ice, centrifuge at 8000g for 10min at 4℃, and collect the supernatant. Add samples according to Table 2, incubate at 100℃ for 60min, cool on ice, centrifuge at 10000g for 10min at room temperature, and measure the absorbance at 532nm and 600nm using 200μL of the supernatant. Calculate the MDA content according to the method described in the kit. The calculation results are as follows: Figure 9 As shown.

[0109] Table 2. Malondialdehyde Content Detection - Sample Addition Table

[0110] Reagent Name (μL) Measurement tube Blank tube MDA detection working solution 300 300 distilled water - 100 sample 100 - Reagent 3 100 100

[0111] from Figure 9 It can be seen that MDA accumulates in large quantities in the kidney tissue of the DKD group, while hucMSC-EVs treatment significantly reduces MDA levels.

[0112] S3. Tissue glutathione content detection:

[0113] This step uses a reduced glutathione (GSH) content assay kit (supplied by Solarbio) to detect the tissue and cellular glutathione content in the kidney tissues of the db / db mouse model constructed in Example 2 and the STZ / high-fat diet (HFD) induced DKD rat model. The specific steps are as follows:

[0114] Take approximately 0.1g of kidney tissue (corticomedullary junction), add 1mL of reagent, homogenize in an ice bath, centrifuge at 12000g for 10min at 4℃, and collect the supernatant. Add the sample according to the table below, mix well, let stand at room temperature for 2min, measure the absorbance at 412nm, and calculate the GSH content according to the method described in the kit.

[0115] Table 3. Tissue Glutathione Content Detection - Sample Addition Table

[0116] Reagent Name (μL) Measurement tube Standard pipe Blank tube sample 20 - - Standard products - 20 - distilled water - - 20 Reagent 2 140 140 140 Reagent 3 40 40 40

[0117] from Figure 10 It can be seen that the expression of reduced glutathione (GSH) was significantly decreased in the DKD group, but its content recovered after intervention with hucMSC-EVs.

[0118] S4. Immunohistochemical staining:

[0119] This step involves immunohistochemical staining of kidney tissue from the db / db mouse model constructed in Example 2 and the STZ / high-fat diet (HFD) induced DKD rat model to investigate whether ferroptosis occurs in the diabetic nephropathy model. The specific steps are as follows:

[0120] Kidney tissue paraffin sections were dried at 60℃ for 4–6 h, dewaxed with xylene 2 × 15 min, and washed with a gradient of alcohols (100%, 95%, 95%, 90%, 85%, 75%) for 3 min each, followed by washing with ddH2O. 3% H2O2 was added and incubated at room temperature for 10–15 min, followed by washing with 1× histochemical PBS for 3 × 5 min. The sections were boiled in fresh 0.01M citrate buffer at 100℃ for 30 min, cooled, and blocked with 5% BSA for 1 h. Primary antibodies TFRC, ACSL4, PTGS2, GPX4, and xCT (1:100) were added and incubated overnight at 4℃, followed by washing with PBS for 3 × 5 min. Biotin-labeled secondary antibody was added and incubated at 37℃ for 30 min, followed by washing with PBS, then SABC was added and reacted at 37℃ for 30 min, followed by washing with PBS for 3 × 5 min. DAB staining time control, ddH2O termination, hematoxylin counterstaining for 30s, rinsing with running water for 10min, alcohol dehydration, xylene clearing for 30min, mounting with neutral resin, air drying, and then scanning the pathological sections for observation.

[0121] from Figure 11As can be seen, in the DKD model, the expression of ferroptosis proteins TFRC, ACSL4 and PTGS2 was significantly upregulated, while the expression of antiferroptosis proteins xCT and GPX4 was significantly downregulated; after intervention with hucMSC-EVs, the above abnormal expression trends were effectively reversed.

[0122] S5. Total RNA extraction, reverse transcription, and qRT-PCR:

[0123] This step involves extracting total RNA from kidney tissue and podocyte samples from the control group (Normal group), the injury group (DKD group), and the intervention group (HucMSC-EVs group), reverse transcribing the RNA, and performing qPCR to examine the inhibitory effect of hucMSC-EVs on ferroptosis in the DKD model.

[0124] Kidney tissue sample: Take a kidney tissue the size of a mung bean, add 1 mL of Trizol, homogenize, centrifuge at 12000g for 15 min at 4℃, and collect the supernatant.

[0125] Podocyte samples: Wash twice with PBS, add 1 mL Trizol and lyse by pipetting. Add 200 μL chloroform and vortex for 30 s, incubate on ice for 15 min, centrifuge at 12000g for 15 min at 4℃, collect 400 μL of the upper aqueous phase, add an equal volume of isopropanol and mix well, incubate at -20℃ for 20 min. Centrifuge at 12000g for 10 min at 4℃ and discard the supernatant. Wash the precipitate with 75% ethanol, centrifuge, air dry, and dissolve in DEPC water to obtain the desired RNA. The concentration of the obtained RNA was determined using a NanoDrop 1000 micro-volume spectrophotometer, and subsequent experiments were performed according to the reverse transcription and qRT-PCR (supplied by Vazyme) instructions.

[0126] from Figure 12 As can be seen, in the DKD model, the expression of ferroptosis proteins TFRC, ACSL4 and PTGS2 was significantly upregulated, while the expression of antiferroptosis proteins xCT and GPX4 was significantly downregulated; after intervention with hucMSC-EVs, the above abnormal expression trends were effectively reversed.

[0127] Example 4:

[0128] This embodiment investigated the effect of hucMSC-Evs on inhibiting HG / HF-induced podocyte ferroptosis. The specific steps are as follows:

[0129] 80 μL of 5 mM palmitic acid was added to 1 mL of 30 mM high-glucose medium to obtain a high-glucose / high-fat (HG / HF) medium. Podocytes (purchased from BeiNa Biotechnology Cell Bank) were then stimulated with this HG / HF medium for 6 h. During stimulation, different concentrations (5 μM, 10 μM, 15 μM, 20 μM) of the ferroptosis inhibitor Ferrostatin-1 (Fer-1) or 1 × 10⁻⁶ mmol / L was added to the medium. 11 hucMSC-Evs particles / mL. The assays were performed using CCK8 assay, immunofluorescence, ROS detection, and intracellular Fe content analysis. 2+ The inhibitory effect of hucMSC-EVs on HG / HF-induced podocyte ferroptosis was investigated, and the specific steps are as follows:

[0130] S1.CCK8 Experiment:

[0131] Untreated podocytes were seeded into 96-well plates and stimulated with high-glucose / high-fat (HG / HF) medium for 6 h as described above. The medium was then discarded, and the cells were washed once with PBS. 100 μL of serum-free medium containing 10% CCK8 was added to each well, and the cells were incubated in the dark for 1 h. The absorbance was measured at 450 nm.

[0132] from Figure 13 As can be seen, podocyte viability decreased significantly after HG / HF treatment, while intervention with 10 μM Fer-1 significantly improved cell viability and effectively reversed the damage. This indicates that an in vitro model of HG / HF-induced podocyte ferroptosis was successfully established.

[0133] S2. Detection of malondialdehyde (MDA) content in cells:

[0134] Collect approximately 5×10 6 Podocytes treated with HG / HF and hucMSC-EVs were added to 1 mL of extraction buffer and subjected to repeated freeze-thaw cycles 2–3 times. Subsequent steps were the same as step S2 in Example 3. The results were examined as follows: Figure 14 As shown in B.

[0135] S3. Detection of glutathione content in cells:

[0136] The procedure for detecting glutathione content in podocytes is as follows: collect approximately 5 × 10⁵ cells. 6 After treating HG / HF and hucMSC-EVs with podocytes, add 1 mL of reagent I, and repeat freeze-thaw cycles 2–3 times. Subsequent steps are the same as step S3 in Example 3. The results are as follows: Figure 14 As shown in Figure A.

[0137] S4. Cellular immunofluorescence:

[0138] Untreated podocytes were seeded onto slides and stimulated with high-glucose / high-fat (HG / HF) medium for 6 h as described above. The medium was then discarded, and the cells were washed twice with PBS. Fixation was performed with 4% paraformaldehyde for 30 min, followed by PBS washing (3 x 5 min). Cell permeabilization was achieved with 0.1% Triton X-100 for 2 min, followed by PBS washing (3 x 5 min). Blocking with 5% BSA for 1 h was followed by incubation overnight at 4°C in the dark with primary antibodies TFRC, ACSL4, PTGS2, GPX4, and xCT (1:50). The cells were washed with PBS (3 x 5 min), incubated with 1:400 fluorescent secondary antibody in the dark for 90 min, and then washed with PBS (3 x 10 min). Hoechst (1:400) staining was performed in the dark for 5 min, followed by PBS washing (3 x 10 min). The slides were then inverted onto an anti-quenching agent, mounted, and observed and photographed under a fluorescence microscope. Results were analyzed as follows: Figure 15 As shown.

[0139] from Figure 14 and 15 The results show that HG / HF treatment significantly reduced GSH levels and increased MDA accumulation in podocytes, and significantly downregulated the expression of key ferroptosis proteins xCT and GPX4, while significantly upregulated the expression of TFRC, ACSL4, and PTGS2. However, after intervention with hucMSC-EVs, GSH levels rebounded, MDA production decreased, the protein expression of xCT and GPX4 was upregulated, and the protein expression of TFRC, ACSL4, and PTGS2 was downregulated.

[0140] S5. Cell ROS detection:

[0141] Untreated podocytes were seeded into 24-well plates and stimulated with high glucose / high fat (HG / HF) medium for 6 h as described above. The medium was then discarded, and 1:2000 DCFH-DA (diluted with serum-free medium) was added. The plates were incubated in the dark for 30 min, washed three times with serum-free medium, and observed and photographed under a fluorescence microscope.

[0142] from Figure 16 As can be seen, the ROS level in podocytes was significantly lower in the hucMSC-EVs intervention group compared to the HG / HF group.

[0143] S6. Intracellular Fe 2+ Detection:

[0144] Untreated podocytes were seeded into 24-well plates and stimulated with high glucose / high fat (HG / HF) medium for 6 h as described above. The medium was then discarded, and the cells were washed three times with serum-free medium. 1 μM working solution was added, and the cells were incubated in the dark for 30 min before being observed and photographed under a fluorescence microscope.

[0145] from Figure 17As can be seen, the fluorescence intensity of Fe2+ in podocytes of the HG / HF group was significantly enhanced, while the fluorescence signal was significantly weakened after intervention with hucMSC-EVs.

[0146] In conclusion, hucMSC-EVs can effectively inhibit HG / HF-induced podocyte ferroptosis.

[0147] Example 5:

[0148] This embodiment compared the miRNA expression profiles of hucMSC-EVs and HFL1-EVs derived from human embryonic lung fibroblasts using miRNA sequencing. Figure 18 B), and combined with bioinformatics target prediction analysis ( Figure 18 A) Through joint screening, a key candidate molecule—miR-181c-5p (SEQ ID NO.1, 5'-AACAUUCAACCUGUCGGUGAGU-3')—was identified. This molecule was significantly enriched in hucMSC-EVs and was predicted to target and bind to the TFRC, ACSL4, and PTGS2 genes. Subsequently, qRT-PCR experiments confirmed that miR-181c-5p was indeed highly expressed in hucMSC-EVs. Figure 19 To further verify whether miR-181c-5p directly targets and regulates the TFRC, ACSL4, and PTGS2 genes, the binding sequences of miR-181c-5p to the 3'-UTR regions of these two genes were analyzed using an online target prediction tool. Figure 20 Based on this, a luciferase reporter gene plasmid containing wild-type (WT) and mutant (MUT) binding sites was constructed (provided by Gemma Biotechnology). The binding of miR-181c-5p to the TFRC, ACSL4, and PTGS2 genes was experimentally verified using a dual-luciferase reporter gene assay. Figure 21 The specific verification steps include:

[0149] (1) Total RNA extraction from HucMSC-EVs:

[0150] Total RNA was extracted from hucMSC-EVs using the miRNeasy Serum / Plasma Kit (supplied by QIAGEN). 200 μL of LEVs were mixed with 1 mL of Qiazol by vortexing and allowed to stand at room temperature for 5 min. 200 μL of chloroform was added, vortexed for 15 s, allowed to stand for 2–3 min, and centrifuged at 12000 g for 15 min at 4 °C. The supernatant was collected and mixed with 1.5 times the volume of anhydrous ethanol. 700 μL of the supernatant was transferred to the adsorption column, centrifuged at 8000 g for 15 s, and the liquid was discarded. 700 μL of LWT and 500 μL of LPE were added sequentially and centrifuged through the column. 500 μL of 80% ethanol was added, centrifuged at 8000 g for 2 min, and the liquid was discarded. After changing the tube, the column was centrifuged at 12000 g for 5 min. The column was transferred to a new 1.5 mL tube, 14 μL of RNase-free water was added, allowed to stand for 5 min, and centrifuged at 12000 g for 1 min to collect RNA for subsequent miRNA content detection in hucMSC-EVs.

[0151] (2) Dual-luciferase reporter gene assay:

[0152] In this step, the detection kit was supplied by Vazyme (catalog number MR101-02); the dual-luciferase reporter gene assay plasmid vector was supplied by Gemma Biosciences (catalog number C09005); the dual-luciferase reporter gene assay was performed according to the method described in the detection kit:

[0153] ① Inoculate healthy HEK293T cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) into 24-well plates. When the growth density reaches 60%, transfect plasmids (LIPOFECTAMINE 2000 transfection reagent, Invitrogen, 11668019; Opti-MEM serum-free medium, Gibco, 31985-070). The plasmids to be transfected are: MUT-TFRC+miR-181c-5p mimicsNC, MUT-TFRC+miR-181c-5p mimics, WT-TFRC+miR-181c-5p mimics NC, WT-TFRC+miR-181c-5p mimics, MUT-ACSL4+miR-181c-5p mimics NC, MUT-ACSL4+miR-181c-5p mimics, WT-ACSL4+miR-181c-5p mimics NC, WT-ACSL4+miR-181c-5p mimics, MUT-PTGS2+miR-181c-5pmimics; the plasmids described above contain wild-type and mutant dual-luciferase reporter genes TFRC, ACSL4, PTGS2 (provided by Gemma Biosciences), and miR-181c-5p mimics, respectively. Among them, the one containing NC is the control group.

[0154] ② Based on the transfected plasmids, the cells were divided into twelve groups: MUT-TFRC+miR-181c-5p mimics NC, MUT-TFRC+miR-181c-5p mimics, WT-TFRC+miR-181c-5p mimics NC, WT-TFRC+miR-181c-5p mimics, MUT-ACSL4+miR-181c-5p mimics NC, MUT-ACSL4+miR-181c-5p mimics, WT-ACSL4+miR-181c-5p mimics NC, WT-ACSL4+miR-181c-5p mimics, MUT-PTGS2+miR-181c-5p mimics NC, MUT-PTGS2+miR-181c-5p mimics, WT-PTGS2+miR-181c-5p mimics NC, WT-PTGS2+miR-181c-5p mimics.

[0155] ③ Solution A consists of 0.8 μl of plasmid (WT or MUT) added to 50 μL of Opti-MEM, which is then mixed by pipetting and allowed to stand at room temperature for 5 min. Solution B consists of 1.25 μL of miR-181c-5p mimics or mimics NC added to 50 μL of Opti-MEM, which is then mixed by pipetting and allowed to stand at room temperature for 5 min. Solution C consists of 1 μL of Lipo2000 added to 50 μL of Opti-MEM, which is then mixed by pipetting and allowed to stand at room temperature for 5 min.

[0156] ④ Mix solutions A, B and C thoroughly and incubate at room temperature in the dark for 20 min. Add 150 μl of the mixture evenly to the corresponding well, with a total volume of 500 μl per well.

[0157] ⑤ After 6 hours, discard the culture medium and replace it with a complete culture medium containing 10% FBS, and continue culturing for 24 hours.

[0158] ⑥ After culture, discard the culture medium and wash twice with PBS. Add 100 μl of freshly prepared 1×Cell LysisBuffer, let stand at room temperature for 10 min, then harvest the cells into EP tubes, centrifuge at 11200 rpm for 2 min at room temperature, and collect the supernatant for later use.

[0159] ⑦ Take 20 μL of supernatant and 100 μL of freshly prepared Luciferase Substrate (provided with the kit) into a new EP tube, mix well, and immediately place it in a biochemiluminescence detector to detect and read the Fireflyluciferase activity.

[0160] ⑧ Add 100 μl of freshly prepared Renilla substrate (included in the kit), mix well, and detect Renilla luciferase activity.

[0161] ⑨ Record the relative activity values ​​and perform statistical analysis. The results are as follows: Figure 21 As shown.

[0162] As can be seen from the figure, transfection with miR-181c-5p mimics can significantly inhibit the luciferase activity of wild-type TFRC reporter genes, wild-type ACSL4 reporter genes, and wild-type PTGS2 reporter genes. However, when the binding site is mutated, the inhibitory effect disappears.

[0163] In summary, miR-181c-5p can directly bind to the 3'-UTR regions of the TFRC, ACSL4, and PTGS2 genes, thereby regulating their expression at the posttranscriptional level.

[0164] Example 6:

[0165] To further investigate the function of miR-181c-5p in podocyte ferroptosis, this study transfected podocytes (visceral epithelial cells of Bowman's capsule, purchased from BeiNa Biobank) with miR-181c-5p mimics and miR-181c-5p inhibitors (provided by Gemma Biotechnology). Cell viability, oxidative stress indicators (GSH, MDA, ROS), and ferrous ion concentrations (Fe3+) were systematically measured. 2+ The changes in mitochondrial levels and mitochondrial membrane potential are detailed in the following steps:

[0166] S1. miR-181c-5p mimics and miR-181c-5p inhibitors transfection

[0167] This step involves transfecting miR-181c-5p inhibitors and miR-181c-5p inhibitors according to the instructions of the transfection kit (purchased from Polyplus, catalog number 101000046), and includes the following steps:

[0168] Healthy podocytes were seeded into 6-well plates and transfected when the density reached 50%. 200 μL of jetprime buffer was added, along with 5 μL each of miR-181c-5p mimics (NC, provided by Gemma), miR-181c-5p inhibitors (NC, provided by Gemma), and miR-181c-5p pinhibitors (provided by Gemma), and centrifuged by vortexing for 10 s. Then, 4 μL of jetprime reagent was added, centrifuged by vortexing for 1 s, and incubated at room temperature for 10 min. After incubation, the mixture was added to cells in serum-containing medium, with a total volume of 2 mL per well, and cultured for another 6 h. The medium was then replaced with 10% FBS complete medium, and samples were collected for subsequent experiments.

[0169] S2. Cell viability, oxidative stress indicators (GSH, MDA, ROS), ferrous ions (Fe2+) 2+ Detection of mitochondrial membrane potential and mitochondrial membrane level:

[0170] Podocytes were seeded in 24-well plates. After treatment, the culture medium was discarded, and the cells were washed 1–2 times with 1×JC-1 buffer. An equal volume of complete culture medium and JC-1 working solution was added, and the cells were incubated in the dark for 15–30 min. The supernatant was discarded, and the cells were washed 2–3 times with buffer. The cells were then observed and photographed under a fluorescence microscope.

[0171] Compared with the high-glucose / high-fat (HG / HF) treatment group, intervention with miR-181c-5p mimics reduced ROS and Fe. 2+ level( Figure 22 and Figure 23 Meanwhile, JC-1 staining results showed that mimics treatment also improved mitochondrial membrane potential, manifested as a decrease in the intensity of green monomer fluorescence. Figure 24 Furthermore, mimics treatment significantly improved cell viability. Figure 25 ), restored intracellular GSH levels ( Figure 26 A) reduced MDA accumulation ( Figure 26 B). Conversely, transfection with miR-181c-5p inhibitors exacerbated HG / HF-induced podocyte injury, showing a phenotype that promoted ferroptosis in all assays. Figure 22-26 ).

[0172] In conclusion, miR-181c-5p can inhibit ferroptosis in podocytes, and the function of miR-181c-5p is significant.

[0173] Example 7:

[0174] To further confirm whether miR-181c-5p is the core effector molecule that exerts a protective effect on hucMSC-EVs, this embodiment uses electroporation to introduce miR-181c-5p inhibitors into hucMSC-EVs, constructing functionally inhibitory vesicles (miR-181c-5p). in -EVs), and verified their intracellular miR-181c-5p expression level, the specific steps of which are as follows:

[0175] S1. Add 45 μL of hucMSC-EVs (1×10⁻⁶) 6 (particle number / μL) and 5 μl miRNA inhibitors (1×10) 6 Mix the samples (μg / μl) in a reaction vessel. Perform electroporation using a CUY21EDIT II electroporator at 110V and 940μF. After electroporation, transfer the mixture to an ultrafiltration centrifuge tube, add 2mL of PBS, and centrifuge at 2000g for 30min at 4℃. Repeat three times to remove unbound nucleic acids, yielding functionally repressive vesicles (miR-181c-5p). in -EVs).

[0176] S2. Discard the original culture medium from each group of podocytes transfected in Example 6, add 2.5% glutaraldehyde for 5 min, scrape off the cells, centrifuge at 2000 rpm for 5 min, replace with fresh fixative, and after 1–2 h, gently lift the cell clumps and suspend them in the fixative. Subsequent steps are the same as step S2 in Example 1.

[0177] qRT-PCR validation of miR-181c-5p in -EVs group miR-181c-5p expression level was significantly lower than NC in -EVs group ( Figure 27 This demonstrates the successful construction of functionally inhibitory vesicles. Subsequent functional experiments showed that, compared to NC... in Compared to the -EVs group, miR-181c-5p in - The viability of podocytes in the EVs-treated group was significantly reduced. Figure 28 ), GSH content decreased ( Figure 29 A) Increased MDA accumulation ( Figure 29 B) Intracellular ROS and Fe 2+ The level rose significantly ( Figure 30 and Figure 31 The enhanced green fluorescence of JC-1 suggests an accelerated collapse of mitochondrial membrane potential. Figure 32 Transmission electron microscopy (TEM) revealed that the mitochondria in the control group had normal morphology, a homogeneous matrix, and clear and intact cristae; the mitochondria in the HG / HF group showed significant shrunkenness, outer membrane rupture, and disappearance of cristae; NC... in -EVs treatment significantly improved mitochondrial morphology, with only some mitochondria showing mild shrunkenness and some recovery of cristae number; while miR-181c-5p in - EVs-treated groups still showed significant mitochondrial shrinkage, reduced volume, and decreased cristae structure. Figure 33 ).

[0178] Combination Figures 27-33 It is known that miR-181c-5p carried by hucMSC-EVs is a key molecule mediating its inhibition of podocyte ferroptosis.

[0179] In summary, this invention reveals that hucMSC-EVs target and regulate the expression of TFRC, ACSL4, and PTGS2 genes via miR-181c-5p, thereby inhibiting podocyte ferroptosis and improving glomerular damage in diabetic nephropathy. miR-181c-5p may be a key target for treating diabetic nephropathy and could be used to develop drugs for the treatment and / or prevention of diabetic nephropathy, demonstrating significant application value and potential.

[0180] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. The use of miR-181c-5p, or extracellular vesicles containing miR-181c-5p, in the preparation of drugs for treating diabetic nephropathy.

2. The application according to claim 1, characterized in that, The nucleotide sequence of miR-181c-5p is shown in SEQ ID NO:

1.

3. The application according to claim 1, characterized in that, The extracellular vesicles are derived from human umbilical cord mesenchymal stem cells.

4. The application according to claim 1, characterized in that, The diabetic nephropathy includes diabetic nephropathy caused by high blood sugar and high fat intake.

5. The application according to claim 1, characterized in that, The application includes any one or more of the following: (a) Targeted regulation of TFRC, ACSL4 and PTGS2 gene expression; (b) Improves podocyte ferroptosis; (c) Improves diabetic glomerular damage; (d) Inhibit intracellular Fe 2+ Generation, ROS generation, and MDA accumulation; (e) Increases intracellular GSH synthesis.

6. An extracellular vesicle, characterized in that, The extracellular vesicles contain miR-181c-5p, the nucleotide sequence of which is shown in SEQ ID NO:

1.

7. The use of the extracellular vesicles according to claim 6 in the preparation of a drug for treating diabetic nephropathy.

8. A drug for treating diabetic nephropathy, characterized in that, The drug contains miR-181c-5p, or contains extracellular vesicles containing miR-181c-5p.

9. The medicament for treating diabetic nephropathy according to claim 8, characterized in that, The nucleotide sequence of miR-181c-5p is shown in SEQ ID NO:1.

Images