Application of exosome carrying miR-125a-5p in acute lung injury

Abstract

The invention discloses an application of an exosome carrying miR-125a-5p in acute lung injury, and belongs to the technical field of biological medicines. The invention proposes that the miR-125a-5p and the human umbilical cord mesenchymal stem cell source carrying the miR-125a-5p exosome can be used for treating the acute lung injury for the first time; the miR-125a-5p and the human umbilical cord mesenchymal stem cell source carrying the miR-125a-5p exosome can improve the development process of the mouse acute lung injury by means of reducing lung microvascular endothelial cell ferroptosis, reducing expression of intercellular adhesion molecules and improving lung inflammation, and a new thought is provided for the pathogenesis of the acute lung injury. The research on related mechanisms of occurrence and development of the acute lung injury is further perfected. According to the invention, a theoretical basis and related experimental data support can be provided for clinical early diagnosis, early treatment and future development of targeted miRNA drugs and treatment of acute lung injury.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of a miR-125a-5p exosome in acute lung injury. Background Technology

[0002] Acute lung injury (ALI) is characterized by damage to the alveolar epithelium and pulmonary capillary endothelium, leading to diffuse interstitial lung disease and exudative alveolar edema, resulting in acute hypoxic respiratory failure or exhaustion. Current treatments primarily involve respiratory support and fluid management; however, despite existing treatments, patients often develop irreversible lung function impairment.

[0003] Exosomes offer a novel treatment strategy for improving patient prognosis and quality of life due to their low immunogenicity, inherent targeting ability, and barrier penetration properties.

[0004] In view of this, we designed an application of miR-125a-5p exosomes in acute lung injury to address the above-mentioned problems. Summary of the Invention

[0005] The purpose of this invention is to provide an application of exosomes carrying miR-125a-5p in acute lung injury, in order to solve the problems existing in the prior art. The exosomes carrying miR-125a-5p provided by this invention can improve the progression of acute lung injury in mice with lipopolysaccharide-induced acute lung injury by reducing ferroptosis in pulmonary microvascular endothelial cells, reducing the expression of intercellular adhesion molecules, and improving lung inflammation. This can provide new insights into the pathogenesis of acute lung injury and further improve the research on the related mechanisms of acute lung injury occurrence and development.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] In a first aspect, the present invention provides the use of miR-125a-5p in the preparation of products for treating acute lung injury.

[0008] Preferably, the nucleotide sequence of the gene encoding miR-125a-5p is shown in SEQ ID NO.1.

[0009] Preferably, the product is a drug.

[0010] Preferably, the drug contains a pharmaceutically acceptable carrier or excipient.

[0011] Preferably, the dosage form of the product is one or more of the following: emulsion, capsule, pill, tablet, suspension, syrup, ointment, oral liquid, injection, and granule.

[0012] Secondly, the present invention also provides the use of exosomes carrying the miR-125a-5p in the preparation of products for treating acute lung injury.

[0013] Preferably, the method for preparing exosomes carrying the miR-125a-5p includes the steps of cell culture and exosome isolation to obtain exosomes carrying the miR-125a-5p.

[0014] Preferably, the exosomes are derived from human umbilical cord mesenchymal stem cells.

[0015] Thirdly, the present invention also provides a product for treating acute lung injury, the product comprising the miR-125a-5p or the exosomes carrying miR-125a-5p.

[0016] Preferably, the dosage form of the product is one or more of the following: emulsion, capsule, pill, tablet, suspension, syrup, ointment, oral liquid, injection, and granule.

[0017] The present invention discloses the following technical effects:

[0018] This invention proposes for the first time the use of miR-125a-5p and miR-125a-5p-carrying exosomes derived from human umbilical cord mesenchymal stem cells for the treatment of acute lung injury. The mechanism of action is that miR-125a-5p and miR-125a-5p-carrying exosomes derived from human umbilical cord mesenchymal stem cells slow down the disease progression of acute lung injury by inhibiting neutrophil adhesion mediated by ferroptosis in pulmonary microvascular endothelial cells, thus providing a new approach for the treatment of this disease.

[0019] The miR-125a-5p and human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p described in this invention can improve the progression of acute lung injury in mice with lipopolysaccharide-induced acute lung injury by reducing ferroptosis in pulmonary microvascular endothelial cells, decreasing the expression of intercellular adhesion molecules, and improving lung inflammation. This provides new insights into the pathogenesis of acute lung injury and further improves the research on the mechanisms related to the occurrence and development of acute lung injury.

[0020] This invention provides a theoretical basis and relevant experimental data support for early diagnosis and treatment in clinical practice, as well as for the future development of targeted miRNA drugs for the treatment of acute lung injury, and has innovative value and practical significance. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The images show the results of exosome isolation and identification; where A is a flowchart of exosome preparation, B is an electron micrograph of exosomes (scale bar of the upper image = 0.5 μm, scale bar of the lower image = 200 nm), and C is a WB identification result of exosomes.

[0023] Figure 2 Here are the exosomal microRNA sequencing results; where A represents the exosomal microRNA sequencing results and B is the enrichment association diagram of miRNA-functional regulatory relationships.

[0024] Figure 3 Western blot analysis was performed to detect the effect of miR-125a-5p mimicry on LPS-treated pulmonary vascular endothelial cells; where A is the Western blot identification result and B is the corresponding expression level.

[0025] Figure 4 The effects of different treatment groups on a mouse model of acute lung injury are shown in Figure 1. A is a flowchart of the experimental model construction; B is a diagram of HE staining results; C is the neutrophil content in bronchoalveolar lavage fluid of mice in different groups detected by flow cytometry; D is a fluorescence colocalization analysis diagram of vascular endothelial cells (CD31), neutrophils (Ly6g), and ferroptosis marker (4-HNE); E is the linear relationship between the double positivity rate of CD31 and 4-HNE and the neutrophil infiltration rate in Figure D; F is a fluorescence colocalization analysis diagram of vascular endothelial cells (CD31), ferroptosis marker (4-HNE), and intercellular adhesion molecule (ICAM-1); and G is a fluorescence colocalization analysis diagram of vascular endothelial cells (CD31), neutrophils (Ly6g), and intercellular adhesion molecule (ICAM-1).

[0026] Figure 5The ameliorative effect of miR-125a-5p mimic on a mouse model of acute lung injury is shown in Figure 1. A is a flowchart of miR-125a-5p treatment of the acute lung injury model; B shows H&E staining of lung tissue from different groups of mice; C is a fluorescence colocalization analysis of vascular endothelial cells (CD31), neutrophils (Ly6g), and ferroptosis marker (4-HNE); D is a fluorescence colocalization analysis of vascular endothelial cells (CD31), neutrophils (Ly6g), and intercellular adhesion molecule (ICAM-1); E shows the linear relationship between the double positivity rate of CD31 and 4-HNE and the neutrophil infiltration rate in Figure 1; and F is a statistical graph of the neutrophil infiltration ratio and ICAM-1 fluorescence intensity in Figure 1.

[0027] Figure 6 The study aimed to improve the effect of exosomes carrying miR-125a-5p on a mouse model of acute lung injury. A is a flowchart of the exosome-mediated acute lung injury model; B shows H&E staining of lung tissue from different groups of mice; C is a fluorescence colocalization analysis of vascular endothelial cells (CD31), neutrophils (Ly6g), and ferroptosis marker (4-HNE); D is a fluorescence colocalization analysis of vascular endothelial cells (CD31), neutrophils (Ly6g), and intercellular adhesion molecule (ICAM-1); E shows the linear relationship between the double positivity rate of CD31 and 4-HNE and the neutrophil infiltration rate in Figure C; and F is a statistical graph of the neutrophil infiltration ratio and ICAM-1 fluorescence intensity in Figure D. Detailed Implementation

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0031] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0033] The nucleotide sequence encoding the miR-125a-5p gene in this embodiment of the invention is shown in SEQ ID NO.1.

[0034] SEQ ID NO.1: UCCUGAGACCCUUUAACCUGUGA;

[0035] Example 1: Isolation and Identification of Exosomes

[0036] See the flowchart for exosome preparation. Figure 1 Human umbilical cord mesenchymal stem cells (hUCMSCs) were cultured and continuously expanded in serum-free medium. After collecting the cell supernatant, residual cells were first removed by centrifugation at 300 ×g for 10 minutes. The resulting supernatant was filtered through a 0.22 μm filter and then centrifuged again at 2000 ×g for 10 minutes to remove cell debris. Subsequently, it was centrifuged at 10000 ×g for 30 minutes at 4°C to remove cell debris and large vesicles. The culture medium was transferred to an ultracentrifuge tube and centrifuged at 100000 ×g for 70 minutes at 4°C. After discarding the supernatant, the exosome pellet was resuspended in PBS. The resuspended exosomes were washed again by centrifugation at 100000 ×g at 4°C for 70 minutes. Finally, the purified exosome pellet was resuspended in 50 μL of PBS.

[0037] Electron microscopy and Western blot analysis revealed that the prepared exosomes exhibited a cup-shaped morphology with a diameter ranging from 0 to 500 nm. Figure 1(B) hMSC-exos was positive for the standard surface markers TSG101, CD9, and CD63, but negative for the endoplasmic reticulum contaminant marker calnexin. Figure 1 (C). This expression profile meets the established criteria for hMSC-exos identification, confirming that the isolated exosomes are indeed human umbilical cord mesenchymal stem cells.

[0038] Analysis of miRNA components and transcriptome sequencing of human umbilical cord mesenchymal stem cell exosomes, combined with bioinformatics methods, identified miRNA molecules that may play a role in the exosomes of human umbilical cord mesenchymal stem cells: hsa-miR-125b-5p, hsa-let-7a-5p, hsa-let-7f-5p, hsa-miR-199b-3p, hsa-let-7c-5p, hsa-miR-125a-5p, hsa-miR-34a-5p, etc. Figure 2 (A)

[0039] The miRNAs obtained from the above screening were subjected to biological process enrichment analysis using the Metascape database (http: / / metascape.org / gp / index.html# / main / step1). The enrichment analysis steps are general: the screened miRNAs are copied and pasted into the Metascape URL, human is selected as the background, CustomAnaysis is selected, Enrichment is selected, and MF, BP, and CC are selected for enrichment analysis. The downloaded table is then processed to obtain a visualization. Figure 2 (B)

[0040] Figure 2 The left side of Figure B shows the enrichment of functional items such as cell migration, regulation of ion transport, and cell-substrate adhesion. In the bubble plot, the horizontal axis represents the rich factor (a higher value indicates a higher degree of enrichment), the vertical axis represents -log(Qvalue) (negative logarithm Q value, a higher value indicates higher significance), and the count (bubble size, representing the number of miRNAs enriched during that process). The analysis results indicate that hsa-miR-125a-5p exhibits significant functional enrichment in biological processes such as cell migration and ion transport regulation, suggesting that it may play a crucial role in these processes.

[0041] miR-125a-5p was ultimately identified as a key component that plays a role in human umbilical cord mesenchymal stem cell exosomes.

[0042] Example 2: Application of miR-125a-5p and human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p in acute lung injury.

[0043] 1. Application of miR-125a-5p in pulmonary vascular endothelial cell injury

[0044] Fresh lung tissue was minced and centrifuged at 3000 rpm for 3 minutes, followed by digestion with collagenase IV at 37°C for 40 minutes in a shaker. After digestion, the reaction was stopped by adding ECM medium containing 10% fetal bovine serum, mixing thoroughly, filtering through a 70-μm filter, and then centrifuging at 800 rpm for 10 minutes. If red blood cells were present, they were lysed. The cells were resuspended in ECM medium containing 10% serum, 1% ECGS, and two antibiotics, and finally plated for culture.

[0045] PMIVCs were treated with 20 μg / mL LPS. After treatment, PMIVCs in logarithmic growth phase were collected and seeded in 6-well plates. When confluence reached 80-90%, miR-125a-5p mimics were transfected with Lipofectamine 3000 for 8-10 hours, followed by 48 hours of culture in serum-containing medium. Western blotting was used to assess the effect of miR-125a-5p mimics on LPS-treated PMIVCs.

[0046] Western blot analysis showed that, compared to the LPS group, the expression level of 4-HNE was significantly reduced after treatment with miR-125a-5p mimicry. Figure 3 (AB).

[0047] 2. Application of miR-125a-5p and human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p in improving acute lung injury in mice.

[0048] Flowcharts for the lipopolysaccharide-induced acute lung injury model in mice, the miR-125a-5p overexpression exosome treatment, and the miR-125a-5p mimic treatment are shown below. Figures 4-5 In the study, 6-8 week old specific pathogen-free (SPF) male C57 mice (purchased from Zhaoqing Ruisiyuan Biotechnology Co., Ltd., animal license number: SCXK (Guangdong) 2020-0053) were used to induce acute lung injury (ALI) in anesthetized mice by intratracheal instillation of lipopolysaccharide (LPS, 10 μg / g body weight). Control mice were given an equal volume of PBS solution.

[0049] The mice were divided into four groups: a model group (LPS group), a human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p treatment group (EXO group), a miR-125a-5p mimic treatment group (miR-125a-5p group), and a control group (CON group). The human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p treatment group received intranasal instillation of exosomes (100 μg / mouse, 10 μL per nostril, for more than 5 minutes) 4 hours after LPS stimulation. The miR-125a-5p mimic treatment group received intranasal instillation of miR-125a-5p mimics (1 nmol / mouse, 10 μL per nostril, for more than 5 minutes) 4 hours after LPS stimulation. The control group received an equal volume of PBS intranasally (10 μL per nostril, for more than 5 minutes) 4 hours after PBS stimulation.

[0050] Lung tissue and bronchoalveolar lavage fluid (BALF) were collected 24 hours after drug administration for H&E staining, flow cytometry, and fluorescence colocalization analysis.

[0051] 3. Flow cytometry analysis

[0052] After centrifugation of BALF, the cells were resuspended in 100 μL PBS and stained with neutrophil antibody Ly6G (FITC-labeled) (1:200) for 30 minutes under light-protected conditions. Neutrophil infiltration was analyzed by flow cytometry.

[0053] 4. Immunofluorescence staining analysis

[0054] Frozen sections of lung tissue (7 μm) were first soaked in PBS for 10 minutes to remove OCT compounds, followed by fixation with 4% paraformaldehyde for 10 minutes. After three 10-minute PBS washes on a shaker, the sections were permeabilized with 0.3% Triton X-100 for 10 minutes, and then washed three times with PBS (10 minutes each time). The sections were blocked with 10% bovine serum albumin (BSA) containing 0.1% Triton X-100 at room temperature for 1 hour. They were then incubated overnight at 4°C with primary antibodies containing CD31 (5 μg / mL), GPX4 (1:500), 4-HNE (1:25), ICAM1 (1:1000), LY6G (1:500), and HDAC5 (1:500). The sections were then washed three times with PBS buffer for 20 minutes each time, followed by incubation with secondary antibody at room temperature for 1 hour, and then washed three more times with PBS buffer for 20 minutes each time. For nuclear staining, sections were incubated with DAPI for 10 minutes at room temperature, followed by a final 10-minute PBS rinse. Sections were mounted with anti-fading mounting medium and imaged using an inverted confocal fluorescence microscope.

[0055] 5. Results Analysis

[0056] The results are visible. Figures 4-6 .

[0057] H&E staining results showed that, compared with the control group, the LPS group exhibited alveolar capillary swelling and congestion, alveolar hemorrhage, and inflammatory cell infiltration, with an increased number of neutrophils observed in the collected bronchoalveolar lavage fluid. Furthermore, CD31 was found in lung sections of LPS-induced ALI mice. + / 4-HNE + The number of PMVECs was greater than that in the control group, which was also accompanied by a higher number of Ly6G cells and neutrophils. These results suggest that ferroptotic PMVECs may be involved in neutrophil recruitment in the LPS-induced ALI model. Neutrophil recruitment refers to the rapid migration of neutrophils to damaged tissue, which involves the adhesion process between PMVECs and neutrophils. ICAM-1 expressed on the surface of PMVECs plays a crucial role in mediating PMVEC neutrophil adhesion. Here, most CD31 cells were observed... + / 4-HNE + PMVECs also significantly increased ICAM-1 levels in LPS-induced ALI. Simultaneously, ferroptosis CD31... + / ICAM-1 + The more PMVECs there are, the more Ly6G neutrophils there will be, demonstrating that ICAM-1 participates in neutrophil adhesion on ferroptotic PMVECs. Figure 4 (BG).

[0058] miR-125a-5p mimics improved alveolar capillary damage in mice, reduced alveolar space, decreased lung injury fraction, and reduced inflammatory response in LPS-induced ALI mice. Treatment with miR-125a-5p mimics reduced CD31 levels in LPS-induced ALI mice. + / 4-HNE + PMVEC levels were lower in untreated LPS-induced ALI mice than in mice with other diseases. Furthermore, Ly6G levels were lower in LPS-induced ALI mice treated with miR-125a-5p mimics. + The number of neutrophils was reduced. Simultaneously, compared to the untreated group, miR-125a-5p mimics reduced LPS-induced CD31 in ALI mice. + The number of PMVECs and the expression level of ICMA-1 were reduced, while Ly6G expression was also decreased. + Percentage of neutrophil infiltration ( Figure 5 (Middle BF). It can be seen that miR-125a-5p improves the course of acute lung injury by reducing ferroptotic PMVECs to reduce neutrophil infiltration.

[0059] Following treatment with human umbilical cord mesenchymal stem cell-derived exosomes carrying miR-125a-5p, compared to the LPS group, the EXO treatment group showed reduced alveolar capillary swelling and congestion, reduced alveolar hemorrhage, and downregulated inflammatory cell infiltration, indicating that EXO administration significantly improved the pathological features of ALI. Immunofluorescence analysis showed that, compared to the LPS group, the EXO group had significantly lower levels of 4-HNE. + / CD31 + The number of PMVECs decreased, while Ly6G + Neutrophil infiltration was significantly reduced, consistent with the results of miR-125a-5p mimicry treatment. In addition, EXO treatment reduced CD31 in LPS-induced ALI. + The number of PMVECs, ICAM-1 expression, and the proportion of Ly6G neutrophil infiltration ( Figure 6 These results show that ferroptosis of PMVECs promotes neutrophil adhesion by increasing ICAM-1 signaling, thereby promoting neutrophil recruitment to injured lung tissue in ALI, while exosomes can block this process by inhibiting ferroptosis.

[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of miR-125a-5p in the preparation of products for treating acute lung injury.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene encoding miR-125a-5p is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The product is a medicine.

4. The application according to claim 1, characterized in that, The drug contains a pharmaceutically acceptable carrier or excipient.

5. The application according to claim 4, characterized in that, The dosage form of the product is one or more of the following: emulsion, capsule, pill, tablet, suspension, syrup, ointment, oral liquid, injection, and granule.

6. The use of an exosome carrying the miR-125a-5p described in claim 1 in the preparation of a product for treating acute lung injury.

7. The application according to claim 6, characterized in that, The method for preparing exosomes carrying miR-125a-5p as described in claim 1 includes the steps of cell culture and exosome isolation to obtain exosomes carrying miR-125a-5p as described in claim 1.

8. The application according to claim 7, characterized in that, The exosomes are derived from human umbilical cord mesenchymal stem cells.

9. A product for treating acute lung injury, characterized in that, The product comprises miR-125a-5p as described in claim 1 or exosomes carrying miR-125a-5p as described in claim 6.

10. The product according to claim 9, characterized in that, The dosage form of the product is one or more of the following: emulsion, capsule, pill, tablet, suspension, syrup, ointment, oral liquid, injection, and granule.

Images