CEACAM1 gene defect type engineered immune cell as well as preparation method and application thereof

Abstract

The invention relates to the field of gene editing and tumor immunotherapy, and discloses a CEACAM1 gene defect type engineered immune cell as well as a preparation method and application thereof. The engineering immune cell is characterized in that: (i) a CEACAM1 gene is knocked out; (ii) specifically recognizing and killing tumor cells expressing CD19; (iii) expressing CAR (chimeric antigen receptor); and iv) the immune cells are T cells. The CEACAM1 gene knockout CAR-T cell prepared by the invention shows an anti-tumor curative effect superior to that of a control group in malignant tumors of a blood system, has stronger in-vivo amplification capacity and good safety, reverses functional inhibition caused by IFN-I to a certain extent, and shows relatively high clinical application potential.

Description

Technical Field

[0001] This application relates to the fields of gene editing and tumor immunotherapy; more specifically, it relates to a... CEACAM1 Gene-defective engineered immune cells, their preparation methods, and applications. Background Technology

[0002] Chimeric antigen receptor (CAR) T-cell therapy is a promising immunotherapy strategy. This method involves genetically engineering T cells to express chimeric antigen receptors that target specific antigens. After reinfusion, these receptors can target and eliminate tumor cells, enabling specific treatment of various tumors. CAR-T therapy has achieved significant clinical efficacy in hematologic malignancies and has led to the approval of several products for market launch. In the field of solid tumors, CAR-T therapies targeting different tumor types are also under active research and clinical validation. Currently, more than 1,200 CAR-T-related clinical trials are underway globally.

[0003] However, in hematologic malignancies, some patients experience CAR-T therapy failure or fail to achieve long-term remission. The efficacy of CAR-T therapy is also limited in recipient tumors. This may be due to factors such as intrinsic or tumor-related T cell dysfunction, loss of target antigens, and the immunosuppressive tumor microenvironment. Therefore, optimizing CAR-T cell persistence and effector function has become a key breakthrough in improving the clinical efficacy of CAR-T therapy.

[0004] Immune checkpoint intervention is considered an effective strategy for optimizing CAR-T cell function. Immune checkpoint blockade reactivates T cell function by removing inhibitory signals. Multiple studies have shown that combining CAR-T cells with immune checkpoint inhibitors such as PD-1, CTLA-4, and LAG-3, or by directly intervening in T cell-intrinsic immune checkpoint molecules, can enhance CAR-T cell function and improve therapeutic efficacy.

[0005] Carcinoembryonic antigen-associated cell adhesion molecule 1 (CEACAM1) is a co-inhibitory receptor expressed by T cells. It can be activated through homologous binding or interaction with other ligands, thereby recruiting SHP phosphatases to inhibit TCR signaling and reduce cytotoxic effects. Previous studies have shown that CEACAM1 plays an important role in immune escape from solid tumors, and its monoclonal antibodies have shown synergistic effects in the treatment of non-small cell lung cancer. However, there are currently no publicly reported methods or applications for targeting CEACAM1 in CAR-T cell therapy. Summary of the Invention

[0006] The purpose of this invention is to provide a method or application for targeting CEACAM1 in CAR-T cell therapy. The invention yields... CEACAM1 Gene knockout CAR-T cells have shown good in vivo expansion capacity and good safety in hematological malignancies, and to some extent reverse the functional inhibition caused by IFN-I, showing high potential for clinical application.

[0007] To achieve the above-mentioned objectives, this application adopts the following technical solution: In a first aspect, this application provides an engineered immune cell, comprising the following features: (i) CEACAM1 The gene was knocked out; (ii) Specifically recognizes and kills tumor cells expressing CD19; (iii) Express CAR; (iv) The immune cells are T cells.

[0008] Furthermore, the CAR is composed of a CD8α signal peptide, a single-chain variable fragment scFv that recognizes CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, and an immune receptor tyrosine activation motif CD3ζ tandemly.

[0009] Secondly, this application provides a method for preparing the engineered immune cells described in the first aspect, comprising the following steps: Isolate primary human T cells; Knockout using the CRISPR / Cas9 editing system CEACAM1 Gene amplification and culture; The T cells were transfected with a lentiviral vector containing the CAR coding sequence. The genome was extracted, sequenced, and identified. The cells were then cultured in a larger scale to obtain the engineered immune cells.

[0010] Furthermore, the lentiviral vector containing the CAR coding sequence is a PLVX CD19 CAR vector.

[0011] Thirdly, this application provides a pharmaceutical composition comprising engineered immune cells as described in any of the first aspects, or engineered immune cells prepared by any of the preparation methods described in any of the second aspects, and a pharmaceutically acceptable carrier or excipient.

[0012] Fourthly, this application provides the use of engineered immune cells comprising any of the first aspects, or engineered immune cells prepared by any of the preparation methods described in the second aspect, or pharmaceutical compositions described in the third aspect, in the preparation of a medicament for treating tumors.

[0013] Furthermore, the tumor is a CD19-positive tumor.

[0014] Furthermore, the tumor is a hematologic malignancy or a solid tumor.

[0015] In summary, this application has the following beneficial effects: (1) Compared to non-engineered CAR-T cells, by knocking out CEACAM1 The gene effectively improved the cytotoxic function of CAR-T cells.

[0016] (2) Compared with non-engineered CAR-T cells, it enhances the persistence of CAR-T cells under repeated antigen stimulation and improves their anti-tumor effect.

[0017] (3) Using a mouse animal model, the present invention prepared... CEACAM1 Gene knockout CAR-T cells have shown superior anti-tumor efficacy compared to the control group in hematologic malignancies, with stronger in vivo expansion capacity and good safety. They can also reverse the functional inhibition caused by IFN-I to a certain extent, showing high potential for clinical application. Attached Figure Description

[0018] Figure 1 Flow cytometry analysis of CRISPR-Cas9 knockout efficiency; Figure 2 : CEACAM1 The process of constructing CAR-T knockout cells; Figure 3 CAR transduction efficiency in T cells; Figure 4 The amplification curves of the CAR-T group were measured using a CounterStar counter to measure T cell viability and cell number. Figure 5 The results of in vitro experiments showed that when different CAR-T cells were co-cultured with luciferase + Nalm6 cells (B-cell leukemia cell line) at different effector-to-target ratios, the total killing effect was measured as a relative reduction in luminescence after 48 hours. Figure 6 The results of the in vitro experiment showed that different CAR-T cells were co-cultured with Nalm6 cells at an effector-target ratio of 2:1, and fresh tumor cells were added every 3-4 days to count the CAR-T cells. Figure 7 Nalm6 leukemia (B-ALL) mouse model CEACAM1 A diagram illustrating the synergistic effects of knockout; Figure 7 A. Bioluminescence imaging was used to monitor changes in tumor burden in each group, and the number of bioluminescent photons in mouse tumors on day 27 was quantitatively analyzed. Figure 7 B. Survival status of mice in each treatment group (n=5). Detailed Implementation

[0019] The technical solutions and effects of this application will be further described in detail below with reference to the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the invention and are not intended to limit the invention.

[0020] Example 1: Synthesis, Design and Validation of gRNA Candidate sgRNAs for target gene knockout were designed and screened using the online sgRNA design tool provided by Synthego Technologies (https: / / design.synthego.com): Human CEACAM1 Gene( CEACAM1 (NCBI Registry No. NM_001712.5). Candidate sgRNAs were chemically synthesized by GenScript (Nanjing). Commercially synthesized gRNAs were combined with Cas9 protein in vitro to form a complex, and the gRNA / Cas9 ribonucleoprotein (RNP) was delivered to human T cells via electroporation to assess the editing efficiency of different sgRNAs. Figure 1 The optimized version is shown. CEACAM1 The editing efficiency of sgRNA in T cells was validated at the protein level.

[0021] CEACAM1 Target sequence: AGGGGAGACGTTGTAACTTA (SEQ ID NO:1).

[0022] Example 2: CEACAM1 Construction of CAR-T cell knockout expansion system CEACAM1 The process of constructing knockout CAR-T cells is as follows: Figure 2 As shown, the specific steps include: Human CD3+ T cells were cultured in Gibco CTS medium supplemented with 10% fetal bovine serum (Gibco), IL-2 (100 U / mL), and L-glutamine (1 mM / mL) (STEMCELL Technology). The cell concentration in the medium was maintained at 1–2 × 10⁻⁶ cells / mL. 6 Cells / mL. To activate cells, T cell activation beads (Dynabeads human T-activator CD3 / CD28) were added at a ratio of magnetic beads to cells of 3:1, and incubated in an incubator at 37°C and 5% CO2. T cells were activated for 24 hours, and the cells were counted, then the required CAR lentivirus solution was added.

[0023] Forty-eight hours after cell activation, CD3 / CD28 beads were removed using a magnet, followed by electroporation. 4 μg Cas9 protein and 2 μg sgRNA were introduced into 1 × 10⁻⁶ cells via electroporation.6 Personal primary T cells. Genes were introduced using a Lonza 4D-Nucleofector electroporator with the EH 115 electroporation program. After electroporation, the cells were incubated in an incubator at 37°C and 5% CO2.

[0024] On day 7 post-infection, the CAR positivity rate of T cells was detected using CD19 protein (Acro). Fresh culture medium was added every 2 days during the culture process. The CAR positivity rate in different CAR-T cells was detected by flow cytometry. Figure 3 The results showed CEACAM1 Unedited CD19 CAR-T cells and CEACAM1 The proportion of CAR-positive cells in defective CAR-T cells was quite high. Further analysis of cell expansion and cell viability showed... CEACAM1 Defective CAR-T cells can rapidly expand in vitro, and their cell viability is comparable to that of the control group. Figure 4 The above results demonstrate that this study has successfully established an efficient [system / mechanism]. CEACAM1 The CAR-T cell knockout preparation system was developed, and gene knockout does not affect CAR expression, in vitro expansion capacity, or cell viability of CAR-T cells.

[0025] Example 3: Packaging of CAR Lentiviral Virus Amplification and viral packaging of PLVX CD19 CAR plasmid.

[0026] The CAR consists of a CD8α signal peptide, a single-chain variable fragment scFv that recognizes CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, and an immune receptor tyrosine activation motif CD3ζ tandemly. (Second-generation CAR sequence obtained from Nanjing Reindeer Biotechnology Co., Ltd.)

[0027] Cell treatment: 24 hours before transfection, 293T cells were digested with trypsin and seeded into 15cm culture dishes. The cells were then grown in DMEM medium with 10% FBS and incubated at 37°C with 5% CO2. After passage, the cell confluence was observed under a microscope 18-24 hours later. When the confluence reached approximately 90%, transfection could be performed.

[0028] Prepare transfection solution: 1) Take two 5mL EP tubes. Add 10μg of the target plasmid (PLVX CD19 CAR), 7.5μg of the packaging plasmid psPAX2, 2.5μg of the packaging plasmid PMD2.G and 1mL of Opti-mem solution to one tube and mix thoroughly (solution 1); add 100μL of PEI transfection reagent and 1mL of Opti-mem solution to the other tube and mix thoroughly (solution 2).

[0029] 2) Add solution 2 to solution 1, vortex to mix, and then incubate at room temperature for 30 minutes.

[0030] 3) Add the above plasmid-PEI mixture to a 15cm culture dish and mix carefully; 4) Place the petri dish in a 37℃, 5% CO2 incubator and continue culturing; 5) Collect the supernatant twice, at 48 h and 72 h after transfection, and centrifuge at 3000 rpm for 20 min at room temperature. 6) Filter the viral supernatant using a 0.45μm filter to obtain PLVX CD19 CAR virus stock solution.

[0031] Lentiviral concentration: The virus was concentrated using ultracentrifugation (30,000g, 4°C, 3 h), and the concentrated virus can then be used to infect T cells.

[0032] Example 4: CEACAM1 Killing function of knocked-out CD19 CAR-T cells This embodiment investigated inhibitory receptors in CAR-T cells. CEACAM1 The impact of gene knockout on tumor killing.

[0033] Nalm6 acute lymphoblastic leukemia cells expressing firefly luciferase were seeded into 96-well plates at 3 × 10⁶ cells per well. 4 CAR-T cells were used in triplicate wells. Untransfected T cells, WT group, KO group, and OE group CAR-T cells were added according to different effector-to-target ratios. After co-culturing at 37℃ and 5% CO2 for 48 hours, luciferase substrate was added to each well and incubated for 10 min. Bioluminescence intensity was quantified using a Synergy H4 microplate reader and the corresponding BioTek Gen5 software. Wells containing only target cells served as blank controls. Specific lysis rate was calculated using the following formula: Specific lysis rate (%) = [1 - (experimental group luminescence value) / (blank control group)] × 100%. After 48 hours, total killing was measured as a relative reduction in luminescence. The results showed that... CEACAM1 The knockout group showed a stronger killing advantage than the control CAR-T cells. Figure 5 ).

[0034] Example 6: CEACAM1 Proliferative capacity of knockout CD19 CAR-T cells under long-term antigen stimulation For evaluation CEACAM1To eliminate the persistent effect of knockout on the function of CD19 CAR-T cells under long-term tumor antigen stimulation, an in vitro repeated antigen stimulation model was established. Specifically, Nalm6 cells were added to the culture system every 3–5 days at a 2:1 ratio of effector cells to target cells to repeatedly stimulate CAR-T cells, simulating long-term antigen load conditions. After each round of stimulation, CAR-T cells were counted, and the relative fold increase compared to the previous round was recorded, while the dynamic changes in the fold increase were monitored. Results showed that, compared to the control group, CEACAM1 Knockout CD19 CAR-T cells exhibited stronger sustained proliferation capacity under multiple rounds of repeated antigen stimulation. Figure 6 ).

[0035] Example 7: Evaluation in an acute lymphoblastic leukemia xenograft model CEACAM1 Knockout of CAR-T cell in vivo function Evaluation using a mouse model of intravenously disseminated tumors CEACAM1 In vivo antitumor efficacy of defective CAR-T cells. Intravenous dissemination model of the human acute lymphoblastic leukemia cell line Nalm6.

[0036] The experiment used NCG mice, with 2×10 6 One dose of Nalm6-luc was injected into mice via the tail vein. Approximately 7 days later, the tumor burden was quantitatively analyzed using a bioluminescence imaging system under isoflurane anesthesia via intraperitoneal injection of the luciferase substrate. Mice were then randomly assigned to groups to ensure comparable initial tumor burdens (as shown in Table 1), and 1 × 10⁻⁶ mmol / L was administered via tail vein according to the grouping protocol. 6 The corresponding cells were treated.

[0037] Table 1 Treatment groups used in studies of intravenous disseminated diseases Tumor burden was monitored weekly using a bioluminescence imaging system after infusion, and mouse weight, condition, and survival were observed every 3–5 days. Results showed that tumors progressed rapidly in the untransfected T-cell group, and all mice died on day 21. Quantitative bioluminescence analysis on day 27 showed that tumor progression was significantly controlled in the CAR-T cell therapy group. CEACAM1 The knockout group showed the slowest tumor progression, while the IFN-β-treated group of unedited CD19 CAR-T cells showed the most rapid tumor progression, indicating that... CEACAM1 Knockout can enhance the tumor-clearing function of CAR-T cells in vivo. Figure 7 A).

[0038] In animal welfare monitoring, mice were euthanized when they met any of the following criteria: weight loss exceeding 20%; tumors severely inhibiting normal physiological functions (including eating, drinking, activity, and excretion); or exhibiting prolonged / excessive symptoms of distress (such as collapse, kyphosis, paralysis or mild paralysis, abdominal distension, ulcers, abscesses, seizures, or bleeding). Comparison of in vivo survival rates revealed that, by the experimental endpoint, CEACAM1 The gene knockout group mice were still alive, while all mice in the other groups had died. Figure 7 B). This result indicates that knockout CEACAM1 It can enhance the in vivo anti-tumor efficacy of CAR-T cells, reduce tumor burden, prolong the survival of mice, and to some extent reverse the functional inhibition caused by IFN-I.

[0039] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. An engineered immune cell, characterized in that, Includes the following features: (i) CEACAM1 The gene was knocked out; (ii) Specifically recognizes and kills tumor cells expressing CD19; (iii) Express CAR; (iv) The immune cells are T cells.

2. The engineered immune cells according to claim 1, characterized in that, The CAR is composed of a CD8α signal peptide, a single-chain variable fragment scFv that recognizes CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, and an immune receptor tyrosine activation motif CD3ζ tandemly.

3. The method for preparing engineered immune cells according to claim 1 or 2, characterized in that, Includes the following steps: Isolate primary human T cells; Knockout using the CRISPR / Cas9 editing system CEACAM1 Gene amplification and culture; The T cells were transfected with a lentiviral vector containing the CAR coding sequence. The genome was extracted, sequenced, and identified. The cells were then cultured in a larger scale to obtain the engineered immune cells.

4. The preparation method according to claim 3, characterized in that, The lentiviral vector containing the CAR coding sequence is the PLVX CD19 CAR vector.

5. A pharmaceutical composition, characterized in that, It comprises engineered immune cells as described in any one of claims 1-2, or engineered immune cells prepared by the preparation method described in any one of claims 3-4, and pharmaceutically acceptable carriers or excipients.

6. The engineered immune cells according to any one of claims 1-2, or the engineered immune cells prepared by the preparation method according to any one of claims 3-4, or the use of the pharmaceutical composition according to claim 5 in the preparation of a medicament for treating tumors.

7. The use according to claim 6, characterized in that, The tumor is a CD19-positive tumor.

8. The use according to claim 7, characterized in that, The tumor is a hematologic malignancy or a solid tumor.

Images