Application of glutamate decarboxylase mutant in production of gamma-aminobutyric acid
By mutating specific amino acid sites of glutamate decarboxylase, its pH and temperature range were broadened, solving the problem of low efficiency in existing technologies and enabling efficient production of γ-aminobutyric acid under a wider range of conditions.
Patent Information
- Application Number
- CN202511694420.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-18
- Publication Date
- 2026-02-10
AI Technical Summary
In existing technologies, glutamate decarboxylase has a narrow optimal pH and temperature range, resulting in low efficiency in the industrial production of γ-aminobutyric acid (GABA) and making it difficult to meet the needs of large-scale whole-cell catalysis.
By mutating glutamate decarboxylase, specifically by mutating tyrosine at position 10 to valine (Y10V), lysine at position 22 to aspartic acid (K22D), tyrosine at position 39 to threonine (Y39T), asparagine at position 41 to serine (N41S), and lysine at position 56 to glutamate (K56E), its optimal pH and temperature range are broadened, allowing it to be effectively expressed at near-neutral pH and near 50°C.
The pH and temperature range of glutamate decarboxylase were broadened, enabling it to maintain high catalytic activity under a wider range of conditions and increasing the production yield of γ-aminobutyric acid.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of a glutamate decarboxylase mutant in the production of γ-aminobutyric acid. Background Technology
[0002] γ-Aminobutyric acid (GABA), also known as 4-aminobutyric acid, is a naturally occurring non-protein amino acid widely distributed in microorganisms, animals, humans, and plants. Currently, GABA is mainly produced industrially using microbial fermentation, with glutamate decarboxylase used for whole-cell catalysis. In microbial fermentation for GABA production, the glutamate decarboxylase gene is introduced into *Corynebacterium glutamicum* to obtain recombinant bacteria for fermentation. Since the optimal pH range for glutamate decarboxylase is between 4 and 5.5, enzyme activity decreases significantly when the pH is below 4 or above 5.5. Furthermore, the optimal catalytic temperature range for glutamate decarboxylase is between 35 and 45°C; catalytic activity decreases significantly when the temperature is below 35°C or above 45°C. Therefore, in practical production, the current pH and temperature ranges are not conducive to large-scale whole-cell catalytic production of glutamate decarboxylase. Summary of the Invention
[0003] To address the shortcomings of existing technologies, this invention provides an application of a glutamate decarboxylase mutant in the production of γ-aminobutyric acid (GABA), which broadens the optimal pH and temperature range for glutamate decarboxylase, thereby increasing the yield of GABA produced by Corynebacterium glutamicum fermentation.
[0004] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the application of a glutamate decarboxylase mutant in the production of γ-aminobutyric acid, wherein the amino acid sequence of the glutamate decarboxylase mutant is shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7.
[0005] It should be noted that this application obtained the glutamate decarboxylase with the amino acid sequence shown in SEQ ID NO.2 by mutating it in the following ways: tyrosine at position 10 is mutated to valine (Y10V), amino acid sequence is SEQ ID NO.3; or, lysine at position 22 is mutated to aspartic acid (K22D), amino acid sequence is SEQ ID NO.4; or, tyrosine at position 39 is mutated to threonine (Y39T), amino acid sequence is SEQ ID NO.5; or, asparagine at position 41 is mutated to serine (N41S), amino acid sequence is SEQ ID NO.6; or, lysine at position 56 is mutated to glutamate (K56E), amino acid sequence is SEQ ID NO.7.
[0006] Secondly, the present invention provides a gene encoding the aforementioned glutamate decarboxylase mutant.
[0007] Preferably, when the amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.3, the nucleotide sequence encoding SEQ ID NO.3 is as shown in SEQ ID NO.8; when the amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.4, the nucleotide sequence encoding SEQ ID NO.4 is as shown in SEQ ID NO.9; when the amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.5, the nucleotide sequence encoding SEQ ID NO.5 is as shown in SEQ ID NO.10; when the amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.6, the nucleotide sequence encoding SEQ ID NO.6 is as shown in SEQ ID NO.11; and when the amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.7, the nucleotide sequence encoding SEQ ID NO.7 is as shown in SEQ ID NO.12.
[0008] Thirdly, the present invention provides a recombinant expression vector carrying the gene.
[0009] Preferably, pET-28a is used as the original expression vector.
[0010] Fourthly, the present invention provides a recombinant bacterium containing the recombinant expression vector.
[0011] Preferably, the recombinant bacteria use Corynebacterium glutamicum or Escherichia coli as the host bacteria.
[0012] Fifthly, the present invention provides the application of the gene, the recombinant expression vector, or the recombinant bacteria described herein in the synthesis of γ-aminobutyric acid.
[0013] Preferably, glutamic acid or monosodium glutamate is used as the substrate, and the recombinant bacteria are used as the fermentation strain to generate γ-aminobutyric acid.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention broadens the optimal pH and temperature range of glutamate decarboxylase by mutating it. Glutamate decarboxylase can be well expressed at near-neutral pH and near 50°C, making its pH range close to that of Corynebacterium glutamicum. This promotes better fermentation production of γ-aminobutyric acid (GABA) by Corynebacterium glutamicum, thereby increasing the production yield of GABA.
[0015] (2) The mutants of glutamate decarboxylase Y10V, K22D, Y39T, N41S and K56E were recombinantly expressed in Escherichia coli as a host, and the expression effect was better than that of wild type. Detailed Implementation
[0016] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.
[0017] Key experimental materials sourced from: PLP (pyridoxal phosphate) was purchased from Shanghai Maclean Biochemical Technology Co., Ltd., and monosodium glutamate was purchased from Shanghai Sangon Biotech Co., Ltd.
[0018] LB solid medium: yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, agar powder 20g / L.
[0019] Example 1: Construction of engineered Escherichia coli containing the G9 gene The decarboxylase G9 gene used in this invention is derived from *Enterococcus faecalis*. The gene sequence was synthesized by Wuhan Jinkairui Biotechnology Co., Ltd. and inserted into plasmid pEC-XK99E. The inserted restriction sites are BamHI (5' end) and SalI (3' end), resulting in plasmid pEC-XK99E-G9. The nucleotide sequence of the G9 gene is shown in SEQ ID NO:1, and the amino acid sequence of the enzyme expressed by the G9 gene is shown in SEQ ID NO:2. The target gene G9 was obtained by PCR using primer G9-F (TGGTGCCGCGCGGCA). GCCATATGACCAAGAAGAACGATCTGAACGAATACC), downstream primer G9-R (TCGAGTGCGGCCGCAAGCTTTTAGATGATGGACT) Using primers GGTTTGGGCGC, the PCR amplification reaction system for the target gene G9 was as follows: upstream primer G9-F 2µL, downstream primer G9-R 2µL, template pEC-XK99E-G9 (100ng / µL) 0.5µL, DNA polymerase 2×Prime STAR Max DNA 25µL, and sterile water to a final volume of 50µL. The PCR reaction program was as follows: PCR amplification program: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 5 sec, 72℃ extension for 20 s, 30 cycles, final extension at 72℃ for 5 min, and storage of PCR products at 12℃.
[0020] PCR yielded linear plasmid pET28a, and upstream primer pET28a-F (AAGCTTG) CGGCCGCACTCGAGCACC), downstream primer pET28a-R (ATGGCTGC) CGCGCGGCACCAGGCCGCTG). The PCR amplification reaction system for obtaining the target fragment is as follows: upstream primer pET28a-F 2µL, downstream primer pET28a-R 2µL, template pET28a (100ng / µL) 0.5µL, DNA polymerase 2×Prime STAR MaxDNA 25µL, and sterile water to a final volume of 50µL. The PCR reaction program is as follows: PCR amplification program: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 5 sec, 72℃ extension for 80 s, 30 cycles, final extension at 72℃ for 5 min, and storage of PCR products at 12℃.
[0021] The obtained PCR products, G9 gene fragment, and pET28a linear fragment were detected by 1% agarose gel electrophoresis and recovered by gel extraction using an OMEGA gel extraction kit. The two recovered PCR products were digested with T5 exonuclease for 5 min to obtain the recombinant expression vector pET28a-G9. This vector was then added to DH5α competent cells, heat-shocked at 42℃ for 60 s, and incubated for 45 min at 37℃ and 200 rpm with 1 mL of LB liquid medium. The cells were then evenly spread onto LB solid medium containing 50 µg / mL kanamycin and incubated overnight at 37℃ inverted. Single clones were selected, colony PCR was performed for verification, and the colonies were sent to the company for sequencing. Strains with correct sequencing results were cultured, plasmids were extracted, and the cells were re-transformed into E. coli BL21(DE3) competent cells. After adding culture medium, the cells were cultured at 37°C and 200 rpm for 45 min. The cells were then plated on LB solid medium containing 50 µg / mL kanamycin and incubated overnight at 37°C for about 10 h to obtain the recombinant transformant E. coli BL21(DE3) / pET28a-G9 single clone strain for expressing the G9 gene.
[0022] Example 2 Construction of recombinant expression vector for G9 mutant In this embodiment, recombinant expression strains of G9 mutants Y10V, K22D, Y39T, N41S, and K56E were constructed. The primers for the mutants are shown in Table 1. Table 1: Primers for G9 enzyme mutant genes
[0023] The recombinant expression vector pET28a-10 for constructing the mutant Y10V is described in detail. For site-directed mutagenesis PCR, the reaction system is as follows: 1) Primer Y10V-F 2µL, Y10V-F 2µL, template pET28a-G9 (100ng / µL) 0.5µL, DNA polymerase 2×Prime STAR Max DNA 10µL, and sterile water to a final volume of 20µL. The PCR reaction procedure is as follows: PCR amplification program: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 5 sec, 72℃ extension for 80 s, 30 cycles, final extension at 72℃ for 5 min, and storage of PCR products at 12℃; 2) Dpn I template elimination, the reaction system is as follows: Dpn I 1µL, 10×buffer 1µL, PCR product 8µL, react at 37℃ for 3 h; 4) Add the Dpn I-treated product to DH5α competent cells, heat shock at 42℃ for 60 s, add 1 mL LB liquid medium in a shaker at 37℃ and 200 rpm, incubate for 45 min, then evenly spread on LB solid medium containing 50 µg / mL kanamycin, and incubate overnight in an inverted incubator at 37℃. Single clones are picked, colony PCR is verified and sent to the company for sequencing to determine the correct mutant expression vector pET28a-10, the corresponding single clone strain is cultured, and the expression vector is extracted.
[0024] The expression vectors pET28a-22, pET28a-39, and pET28a-56 corresponding to the other mutants K22D, Y39T, N41S, and K56E were constructed using the primers in Table X, with the remaining steps being the same as those for constructing the pET28a-10 vector.
[0025] Example 3 Construction of a recombinant expression host for the G9 mutant The mutant recombinant expressions pET28a-10, pET28a-22, pET28a-39, pET28a-41, and pET28a-56 from Example 2 were transformed into the E. coli BL21(DE3) host to construct the expression host. Taking the construction of E. coli BL21(DE3) / pET28a-10 as an example, the specific process is as follows: 1) Take 10µL of expression vector pET28a-10 into competent E. coli BL21(DE3), heat shock at 42℃ for 60s, add 1mL LB, and culture at 37℃ and 200rpm for 45min. Then, spread it on LB solid medium containing 50µg / mL kanamycin and culture it overnight at 37℃ for about 10h to obtain the recombinant expression host E. coli BL21(DE3) / pET28a-10 for expressing the mutant Y10V.
[0026] The expression hosts for the remaining mutants are E. coli BL21(DE3) / pET28a-22, E. coli BL21(DE3) / pET28a-39, E. coli BL21(DE3) / pET28a-41, and E. coli BL21(DE3) / pET28a-56, and the construction process is the same as that for E. coli BL21(DE3) / pET28a-10.
[0027] Example 4 Purification of G9 mutant This embodiment purifies wild-type G9 and its mutants. Taking the Y10V recombinant expression strain *E. coli* BL21(DE3) / pET28a-10 as an example, the specific steps are as follows: 50 µL of *E. coli* BL21(DE3) / pET28a-10 was transferred to a 50 mL Erlenmeyer flask containing 10 mL of LB liquid medium and cultured on a shaker at 37°C and 200 rpm for 11 hours. Then, 5 mL of the seed culture was transferred to a 2 L Erlenmeyer flask containing 500 mL of LB liquid medium and cultured on a shaker at the same temperature and speed for another 2 hours. Subsequently, IPTG inducer at a final concentration of 0.1 mM was added, and the fermentation temperature was lowered to 25°C to promote the recombinant expression of glutamate decarboxylase. This process lasted for 24 hours.
[0028] Glutamate decarboxylase was purified using a Nickel-NTA (Ni-NTA) affinity chromatography column. First, the fermented bacterial culture was collected and centrifuged at 8000g for 20 min at 4°C. The supernatant was discarded, and the bacterial cells were collected. The cells were resuspended in 0.2M phosphate buffer (pH 7.0) and then lysed by high-pressure polymerization. The cells were then centrifuged again at 8000g for 20 min at 4°C to separate the cell-free fraction containing glutamate decarboxylase and its mutants. The cell-free extract was added to a pre-chilled Ni-NTA chromatography column. The purification process consisted of two elution steps: First, washing with buffer A containing 50 mM phosphate-buffered saline (PBS) and 100 mM imidazole (pH 7.4) removed non-specifically bound proteins; second, elution with buffer B containing 50 mM PBS and 300 mM imidazole (pH 7.4) effectively recovered glutamate decarboxylase and its mutants. Finally, the purified enzyme and mutant were dialyzed in 0.2M, pH 7.0 phosphate buffer, aliquoted, and stored at -80°C. All buffers used in the entire purification process were pre-cooled to 4°C before use. Thus, purified glutamate decarboxylase was successfully obtained.
[0029] The enzyme purification process for the other recombinant expression strains of mutants K22D, Y39T, N41S, and K56E was consistent with that of mutant Y10V.
[0030] Example 5: In vitro optimization of glutamate decarboxylase mutant for the conversion of γ-aminobutyric acid This study verified the ability of wild-type glutamate decarboxylase and its mutants Y10V, K22D, Y39T, N41S, and K56E to synthesize γ-aminobutyric acid (GABA) from monosodium glutamate in vitro. The reaction system was prepared in a 250 mL Erlenmeyer flask as follows: 10 mg of purified enzyme, 0.1 mM PLP (pyridoxal phosphate), 100 g / L monosodium glutamate, and phosphate buffer to a final volume of 50 mL. With the reaction temperature set at 40 °C, the optimal pH of the catalytic reaction system was optimized at 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, and 7.5. After selecting the optimal pH, the optimal temperature of the reaction system was then optimized at 20 °C, 30 °C, 40 °C, 50 °C, 60 °C, and 70 °C. The reaction was carried out for 5 hours at different pH and temperature conditions. The content of γ-aminobutyric acid (GABA) synthesized from glutamate by glutamate decarboxylase and mutants under different conditions was then measured. The maximum GABA synthesis capacity of wild-type glutamate decarboxylase under different conditions was set at 100 g / L. The experimental results are shown in Tables 2 and 3. The results indicate that compared with wild-type glutamate decarboxylase, the mutants Y10V, K22D, Y39T, N41S, and K56E showed significantly improved catalytic ability to synthesize GABA from glutamate within a pH range of 5-7.5 and a temperature range of 20-70℃.
[0031] Table 2: Effects of different pH values on the synthesis of γ-aminobutyric acid (g / L) by glutamate decarboxylase
[0032] Table 3: Effect of different temperatures on the synthesis of γ-aminobutyric acid (g / L) by glutamate decarboxylase
[0033] Gene sequence and amino acid sequence SEQ ID NO.1 (G9: gene sequence) SEQ ID NO.2 (G9: Amino Acid Sequence) MTKKNDLNEYQEYLEDSFLGSKGSQRLLPNTKMPETPMYANLARDLIEHFRLNEAKANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.3 (Y10V: Amino Acid Sequence) MTKKNDLNEVQEYLEDSFLGSKGSQRLLPNTKMPETPMYANLARDLIEHFRLNEAKANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.4 (K22D: Amino Acid Sequence) MTKKNDLNEYQEYLEDSFLGSDGSQRLLPNTKMPETPMYANLARDLIEHFRLNEAKANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.5 (Y39T: Amino Acid Sequence) MTKKNDLNEYQEYLEDSFLGSKGSQRLLPNTKMPETPMTANLARDLIEHFRLNEAKANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.6 (N41S: Amino Acid Sequence) MTKKNDLNEYQEYLEDSFLGSKGSQRLLPNTKMPETPMYASLARDLIEHFRLNEAKANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.7 (K56E: Amino Acid Sequence) MTKKNDLNEYQEYLEDSFLGSKGSQRLLPNTKMPETPMYANLARDLIEHFRLNEAEANQNLATFCTTQMEKQADELILNSLNTNAIDKSEYPKTSAMENSCISMIAHLWNVGDDKEIFKDFIGTSTVGSSEGCMLGGLALLKSWRKRAADVGIDVDNMKDHKPNLVIMSGYQVVWEKFCVYWDVELRSIPVSKDHMSLDTDSVMSYVDENTIGIVGVHGITYTGAVDDIQKLDELVSEYNKNSKLDLRIHVDAAFGGLFSPFMDGFKPWDFRLKNVVSINVSGHKYGMVYPGIGWVIWRENNLDLLPESMRFEVAYLGDKVDSIAINFSHSGAHIVAQYYNFIRFGFYGYKKIMEGVRKVSIALADEISSTGFFEIINDGSQLPIVCWKLNDEIKTDWSLYDLESVLAKHGWQVPAYPLPKNRENTTISRIVVRPSMTMTVCGDFIDDLKLSIKELETSRLVRPNQSII SEQ ID NO.8 (Y10V: gene sequence)
[0034] SEQ ID NO.9 (K22D: gene sequence) SEQ ID NO.10 (Y39T: gene sequence) SEQ ID NO.11 (N41S: gene sequence) SEQ ID NO.12 (K56E: gene sequence) All other raw materials or structures not specifically described in this invention already exist in the prior art and can be purchased directly from the market.
[0035] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of a glutamate decarboxylase mutant in the production of γ-aminobutyric acid, characterized in that, The amino acid sequence of the glutamate decarboxylase mutant is shown in SEQ ID NO.
5.
2. The gene encoding the glutamate decarboxylase mutant of claim 1.
3. The gene as described in claim 2, characterized in that, The amino acid sequence of the glutamate decarboxylase mutant is SEQ ID NO.5, and the nucleotide sequence encoding SEQ ID NO.5 is shown in SEQ ID NO.
10.
4. A recombinant expression vector carrying the gene described in claim 2 or 3.
5. The recombinant expression vector as described in claim 4, characterized in that, pET-28a was used as the original expression vector.
6. Recombinant bacteria containing the recombinant expression vector of claim 4 or 5.
7. The recombinant bacteria as described in claim 6, characterized in that, The recombinant bacteria use Corynebacterium glutamicum or Escherichia coli as the host bacteria.
8. The use of the gene as described in claim 2 or 3, the recombinant expression vector as described in claim 4 or 5, or the recombinant bacteria as described in claim 6 or 7 in the synthesis of γ-aminobutyric acid.
9. The application as described in claim 8, characterized in that, Using glutamic acid or monosodium glutamate as a substrate, and the recombinant bacteria of claim 7 as a fermentation strain, γ-aminobutyric acid is generated.