Primer probe set for detecting leiognathus bindus environment DNA, detection method and application

Abstract

The invention relates to the technical field of molecular biology, in particular to a primer probe set for detecting leiognathus bindus environment DNA, a detection method and application. The primer probe group comprises a specific primer and a specific fluorescent probe; wherein the specific primer comprises a forward primer NC-F, a reverse primer NC-R and a specific fluorescent probe NC-Taq. The primer probe group provided by the invention can accurately distinguish leiognathus bindus and related species thereof and common fishes in yellow and Bohai Sea, and has strong specificity. According to the invention, a real-time fluorescence qualitative and / or quantitative PCR (qPCR) detection method for the leiognathus bindus environment DNA is established, and high-sensitivity quantitative detection of a trace amount of the leiognathus bindus environment DNA in a water body can be realized. The method can be directly applied to field population distribution investigation and expansion trend tracking of Yellow and Bohai sea expansion species leiognathus bindus, so that theoretical support is provided for dynamic management of fishery resources and early warning of marine ecological risks.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a primer and probe set, detection method, and application for detecting environmental DNA in the spotted catfish. Background Technology

[0002] Neck-spotted bream ( Nuchequula nuchalis Also known as the necked chub, it belongs to the genus *Ctenopharynx* of the family Squamatae in the order Perciformes of the class Actinopterygii. It is a warm-water economic fish mainly distributed in the South China Sea and the tropical western Pacific Ocean. Due to global ocean warming, this species has frequently appeared in temperate waters outside its traditional distribution areas, such as the Yellow Sea and Bohai Sea, in recent years, with a significant northward expansion of its distribution area. This expansion may alter the local food chain structure and pose a potential threat to the stability of native temperate marine ecosystems, necessitating the establishment of an efficient population monitoring technology system.

[0003] Traditional fisheries survey methods, primarily relying on trawling, have significant limitations when monitoring early-stage dispersing populations: insufficient detection rates at low population densities, time-consuming, labor-intensive, and costly surveys, and the potential for habitat disturbance, making large-scale, continuous monitoring difficult. Environmental DNA technology, as an emerging non-invasive monitoring method, extracts trace amounts of DNA released by species from environmental samples. This allows for rapid capture of target species presence information and accurate biomass assessment via qPCR. It offers significant advantages such as high sensitivity, non-destructiveness, no ecosystem disruption, and independence from weather and temporal / spatial limitations, making it particularly suitable for the early detection and continuous monitoring of expanding species like the spotted chub.

[0004] Therefore, designing a specific primer and probe set that can rapidly, accurately, and quantitatively monitor the environmental DNA of the spotted catfish, and establishing a corresponding qPCR detection method, is of great significance for understanding its northward expansion rate, assessing ecological risks, and formulating scientific fishery resource management strategies. Summary of the Invention

[0005] The purpose of this invention is to provide a primer and probe set, detection method, and application for detecting environmental DNA in spotted catfish.

[0006] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: A primer and probe set for detecting environmental DNA in spotted catfish. The primer-probe set includes specific primers and specific fluorescent probes; among which, the specific primers include: The sequence of the forward primer NC-F is: 5'-CGGAGGGTTTGGCAACTGATTA-3'; The sequence of the reverse primer NC-R is: 5'-TGGATAAACTGTTCATCCTGCA-3'; The sequence of the specific fluorescent probe NC-Taq is: 5'-FAM-CCCCTTATAATTGGTGCCCCCGAC-MGB-3'.

[0007] Among the aforementioned specific fluorescent probes, FAM is a 5' end-labeled carboxyfluorescein label, and MGB is modified at the 3' end, which has both quenching function and can significantly increase the melting temperature of the probe, thereby enhancing the binding specificity and stability of the probe to the target sequence.

[0008] The primer and probe set was designed with the COI nucleotide sequence of the mitochondria of the spotted catfish as the target gene, and the COI nucleotide sequence of the mitochondria of the spotted catfish is shown in SEQ ID No. 1.

[0009] An application of the primer-probe set for detecting environmental DNA in spotted catfish, wherein the primer-probe set is used for qualitative and / or quantitative detection of environmental DNA in spotted catfish.

[0010] A method for detecting environmental DNA in spotted catfish using the aforementioned primer and probe set. (1) Collect water samples from the target water area, enrich environmental DNA through a filter membrane, cut the filter membrane into pieces, and extract total environmental DNA using an animal tissue DNA extraction kit; (2) Using the total environmental DNA extracted in step (1) as a template, qPCR amplification was performed using the specific primer and probe set, and the Ct value was recorded; (3) Calculate the environmental DNA biomass of the spotted catfish in the sample based on the amplification curve and Ct value.

[0011] To elaborate further, (1) Using the genomic DNA of the spotted catfish as a template, the target fragment of the COⅠ gene was amplified by PCR using primers NC-F / NC-R; the PCR product was ligated into the pUC57 plasmid vector and transduced into DH5α competent cells for amplification culture; the recombinant plasmid was extracted and the copy number was calculated; the plasmid was divided into 10 8 ~10 1 The plasmid was serially diluted to copies / μL and used as a template for qPCR amplification with the primer and probe set. A standard curve was plotted. (2) Collect seawater samples in the target sea area, enrich environmental DNA with filter membrane, and extract environmental DNA after cutting the filter membrane into pieces; (3) Using the extracted environmental DNA as a template, qPCR amplification was performed using the primer and probe set described above; (4) Based on the standard curve drawn in step (1), combined with the amplification curve and Ct value in step (3), calculate the biomass of environmental DNA of the spotted catfish in the water.

[0012] The PCR reaction system in step (1) is as follows: forward primer NC-F 10 μM 1 μL, reverse primer NC-R 10 μM 1 μL, 2×T5 Super PCR Mix (Basic) 12.5 μL, template DNA 1 μL, ddH2O 9.5 μL, totaling 25 μL.

[0013] The PCR reaction program in step (1) is as follows: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 sec, annealing at 58℃ for 10 sec, extension at 72℃ for 15 sec, final extension at 72℃ for 5 min, for 35 cycles.

[0014] In step (2), a 3L seawater sample is collected.

[0015] The filter membrane used for environmental DNA enrichment in step (2) is a mixed fiber filter membrane with a diameter of 0.47 mm and a pore size of 0.45 μm.

[0016] The preferred reaction system for qPCR amplification is as follows: forward primer NC-F 10 μM 0.4 μL, reverse primer NC-R 10 μM 0.4 μL, 2×Hieff Union qPCR Taqman Probe Master Mix 10 μL, 50×High ROX 0.4 μL, probe NC-Taq 10 μM 0.2 μL, template DNA 1 μL, ddH2O 7.6 μL, totaling 20 μL.

[0017] The preferred reaction program for qPCR amplification is as follows: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 10 sec; annealing at 58°C for 30 sec, for a total of 40 cycles.

[0018] The advantages and beneficial effects of this invention are: This invention, based on the mitochondrial COI gene fragment of the spotted catfish, designs a probe and primer set for specific testing, exhibiting high species specificity. This allows for accurate identification of the spotted catfish and effectively eliminates interference from non-target species. The established qPCR detection method accurately quantifies the copy number of the spotted catfish COI gene fragment, demonstrating good linearity in the standard curve. It can detect at least 33.2 copies / μL of spotted catfish environmental DNA, exhibiting high sensitivity. The detection process of this invention does not require the capture of the target species, causing no damage to the ecological environment. It is convenient, efficient, and enables large-scale, continuous field monitoring. It is suitable for monitoring low-density populations of the spotted catfish in the early stages of its dispersal, providing a reliable technical tool for fisheries resource management, expansion trend assessment, and ecological risk early warning of the spotted catfish in the Yellow and Bohai Seas. Attached Figure Description

[0019] Figure 1 This is an electrophoresis image used to verify the specificity of primers for *Scutigera fasciatus*. In the image, M is the DL2000 DNA Marker, 1 is a tissue DNA sample from *Scutigera fasciatus*, 2-8 represent *Scutigera fasciatus*, *Scutigera fasciatus*, *Scutigera fasciatus*, *Scutigera fasciatus*, *Hexagrammos dauren*, *Goby fasciatus*, and *Scorpionfish schlegelii*, respectively, and 9 is the negative control (ddH2O).

[0020] Figure 2 This is a standard curve of the logarithmic concentration of the COⅠ gene plasmid of the spotted catfish versus the Ct value.

[0021] Figure 3 This image shows the qPCR amplification curves of the environmental DNA of spotted catfish in aquaculture water and wild water samples from Jiaozhou Bay, obtained using the method described in this invention. Detailed Implementation

[0022] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0023] Unless otherwise specified, the experimental reagents, methods, and equipment used in the following examples are all conventional reagents, methods, and equipment in the art. The animal tissue genomic DNA extraction kit, 2×T5 Super PCR Mix (Basic), DNA gel recovery kit, cloning vector pUC57 and DH5α competent cells, and plasmid extraction kit were purchased from Beijing Qingke Biotechnology Co., Ltd., and the 2×Hieff Union qPCR Taqman Probe Master Mix and 50×High ROX were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0024] Example 1: Design and Specificity Verification of Environmental DNA Primer-Probe Sets for Spotted Catfish (1) Primer and probe set design This invention uses the COⅠ fragment of the mitochondrial carp (as shown in SEQ ID No. 1) as a template, and designs primers NC-F / NC-R (synthesized by Qingdao NIO Biotechnology Co., Ltd.) and probe NC-Taq (synthesized by Beijing Qingke Biotechnology Co., Ltd.) in specific conserved regions. The specific sequences are as follows: Forward primer NC-F: 5'-CGGAGGGTTTGGCAACTGATTA-3 (SEQ ID No. 2); Reverse primer NC-R: 5'-TGGATAAACTGTTCATCCTGCA-3' (SEQ ID No. 3); Probe NC-Taq: 5'-FAM-CCCCTTATAATTGGTGCCCCCGAC-MGB-3' (SEQ ID No. 4).

[0025] FAM is a 5'-terminal labeled carboxyfluorescein reporter group, and MGB is modified at the 3' end of the probe, which has both quenching function and the effect of increasing the probe melting temperature, thereby enhancing the binding specificity and stability of the probe to the target sequence.

[0026] (2) Specificity verification of primer and probe sets Select healthy spotted catfish and closely related species, ringed catfish. Nuchequula mannusella If shield-shaped bream Nuchequula gerreoides、 Deer-spotted upmouth bream Secutor ruconius Jonesbrook Eubleekeria jonesi And the common species of the Yellow and Bohai Seas, the large-scaled rockfish. Hexagrammos otakii Spear-tailed goby Chaeturichthys stigmatias , Xu's flatfish Gymnocor ymbus Genomic DNA was extracted from muscle tissue according to the instructions of the animal genomic DNA extraction kit and stored at -20°C.

[0027] The primer specificity was initially verified using conventional PCR. The PCR reaction system consisted of: 1 μL of forward primer NC-F (10 μM), 1 μL of reverse primer NC-R (10 μM), 12.5 μL of 2×T5 Super PCR Mix (Basic), 1 μL of template DNA, and 9.5 μL of ddH2O, for a total of 25 μL. The reaction program was as follows: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 sec, annealing at 58℃ for 10 sec, extension at 72℃ for 15 sec, and final extension at 72℃ for 5 min, for 35 cycles.

[0028] Prepare a 1% agarose gel, take 3 μL of PCR product, and electrophores at a constant voltage of 120 V for 30 min; observe the bands using a gel imaging system.

[0029] The results showed that only the *Amur cormorant* DNA sample amplified a single bright band, with a fragment size of 166 bp; DNA samples from closely related species, common fish species in the Yellow and Bohai Seas, and the negative control showed no specific bands. (See details...) Figure 1 As shown: M is DL2000 DNA Marker, 1 is *Hemiberlesia lataniae*, 2 is *Hemiberlesia lataniae*, 3 is *Hemiberlesia serratifolia*, 4 is *Hemiberlesia serratifolia*, 5 is *Hemiberlesia juncea*, 6 is *Hexagrammos dauren*, 7 is *Gnaphalium affine*, 8 is *Scorpionfish schlegelii*, and 9 is the negative control (ddH2O). The amplification results show that, without the addition of probes that significantly enhance specificity, the primers achieved specific amplification of *Hemiberlesia lataniae*.

[0030] Example 2: Establishment of qPCR quantification system (1) The PCR amplification product (166 bp) of spotted catfish from Example 1 was recovered and purified according to the instructions of the gel recovery kit; the recovered product was ligated into the cloning vector pUC57, transduced into DH5α competent cells for amplification culture, and the recombinant plasmid was extracted using a plasmid extraction kit. The correctness of the inserted fragment in the recombinant plasmid was verified by Sanger sequencing, and the obtained spotted catfish plasmid standard had a concentration of 100 ng / μL.

[0031] (2) The initial copy number of the plasmid standard was calculated to be 3.32 × 10⁻⁶ according to the formula. 10 copies / μL. The plasmid standard was diluted to 3.32 × 10⁻⁶ copies / μL using a concentration gradient. 8 copies / μL, 3.32×10 7 copies / μL, 3.32×10 6 copies / μL, 3.32×10 5 copies / μL, 3.32×10 4 copies / μL, 3.32×10 3 copies / μL, 3.32×10 2 copies / μL and 3.32×10 1 Copies / μL were used to plot a standard curve of the concentration of the spotted catfish quality standard versus the Ct value.

[0032] (3) Using the specific primer and probe set of the present invention, the plasmid standard diluted sequentially was used as the template for qPCR reaction. Three replicates were set for each concentration gradient, and three negative controls were set. The qPCR experiment was carried out according to the following reaction system: forward primer NC-F 10 μM 0.4 μL, reverse primer NC-R 10 μM 0.4 μL, 2×Hieff Union qPCRTaqman Probe Master Mix 10 μL, 50×High ROX 0.4 μL, probe NC-Taq 10 μM 0.2 μL, template DNA 1 μL, ddH2O 7.6 μL, total 20 μL; the qPCR reaction program was: pre-denaturation 95℃ 1 min; denaturation 95℃ 10 sec, annealing 58℃ 30 sec, 40 cycles.

[0033] A standard curve was plotted with the logarithm (base 10) of the copy number of the *Amur cormorant* plasmid standard as the x-axis and the corresponding Ct value as the y-axis. The regression equation was: y = -3.47x + 40.39, R0. 2 = 0.9982, amplification efficiency of 94%, see details. Figure 2 As shown in the figure. The results indicate that the standard curve has a good linear relationship, and the specific primer and probe set designed in this invention is sensitive and effective in qPCR quantification experiments, and can detect trace amounts of environmental DNA of at least 33.2 copies / μL, which can be used for the absolute quantitative detection of environmental DNA in spotted catfish.

[0034] Example 3: Application of cDNA detection in actual water bodies of spotted catfish (1) Collection and extraction of DNA samples from aquaculture water bodies Three spotted catfish of uniform size and similar body length (average body length 7.6 cm) were selected and placed in a small aquaculture tank containing 6 L of artificial seawater. An oxygenation pump was connected during the experiment, and no feeding was performed for three days. After three days, the spotted catfish were removed, and 3 L of water samples were collected using a three-point sampling method. Each 1 L water sample was enriched onto a filter membrane using a vacuum filtration device, with a total of three filter membranes. The filter membranes were folded in half and stored at -20℃ until DNA extraction was performed.

[0035] (2) Collection and extraction of DNA samples from the water environment of Jiaozhou Bay On November 12, 2025, two sampling stations were set up in Jiaozhou Bay: Station 1 (36°07' N, 120°17' E; water depth 3.2 m) and Station 2 (36°05' N, 120°16' E; water depth 8.1 m). Three L of bottom seawater were collected from each station. Each L of water sample was enriched onto a filter membrane using a vacuum filtration device. Three filter membranes were used at each station. The filter membranes were folded in half and stored at -20℃ until DNA extraction was performed.

[0036] (3) Extraction of environmental DNA from aquaculture and environmental water bodies Remove the filter membrane, cut it into small pieces with sterile scissors, and extract DNA from the membrane using an animal genomic DNA extraction kit, following the kit's instructions. Combine the environmental DNA extracted from three filter membranes of the same source as a single sample to minimize experimental error.

[0037] (4) Quantitative detection and result analysis using qPCR The qPCR system and procedure established in Example 2 were used to quantitatively detect environmental DNA samples from aquaculture water bodies and environmental DNA samples from two stations in Jiaozhou Bay. Three technical replicates were set for each sample, and a negative control (ddH2O) was also included. Based on the standard curve generated in Example 2 and the Ct values ​​of the aquaculture water bodies and Jiaozhou Bay water samples, the eDNA copy number of *Scutigera chinensis* in the aquaculture water bodies and Jiaozhou Bay water samples was calculated. The results are shown in Table 1. Figure 3 As shown.

[0038] Table 1. Biomass of environmental DNA of *Siniperca fasciatus* in aquaculture waters and Jiaozhou Bay.

[0039] The results showed that the biomass of *Siniperca fasciatus* in the cultured water was 10815.63 ± 1426.86 copies / μL, significantly higher than that in the field waters of Jiaozhou Bay, consistent with actual species density differences. The biomass of *Siniperca fasciatus* at station 1 in Jiaozhou Bay was 127.47 ± 23.97 copies / μL, and at station 2 it was 57.48 ± 10.04 copies / μL, proving that this species is already distributed in Jiaozhou Bay. The primer-probe set can effectively detect different concentrations, especially low concentrations, of *Siniperca fasciatus*, which has potential application value in the field distribution survey and dynamic monitoring of expanded species.

[0040] In summary, the primer and probe set designed in this invention has high specificity and sensitivity; the established qPCR qualitative and / or quantitative method can accurately detect the copy number of the environmental DNA of the spotted catfish in water, which helps to reflect the distribution and biomass of the spotted catfish in the marine environment, thus providing theoretical support for the fisheries management and assessment of this expanding species.

[0041] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit its scope of protection. Although the preferred embodiments have been described in detail, any modifications to the technical solutions or equivalent substitutions of some technical features made by those skilled in the art, provided they fully understand the core ideas of the present invention, do not depart from the substantial scope of protection defined by the claims of the present invention.

[0042] sequence list SEQ ID No.1 ATGTTATCGTTACTGCACATGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATGATCGGAGGGTTTGGCAACTGATTAATTCCCCTTATAATTGGTGCCCCCGACATGGCATTTCCCCGAATAAACAATATAAGCTTTTGACTTCTCCCTCCCTCGTTTCTTCTTCTTCTAGCATCCTCCGGCATTGAGGCTGGTGCAGGTACAGGATGAACAGTTTATCCACCCCTGGCGGGCAATCTTGCCCACGCAGGCGCATCCGTTGACCTAACGATTTTTTCCCTACACTTGGCCGGAATCTCCTCAATTCTAGGAGCAATCAACTTTATTACCACAATCATTAATATAAAACCCCCAGCAATTACACAATTCCAAACCCCCCTATTTGTATGAGCGGTTTTAATTACAGCAGTTTTACTACTCCTTTCCCTCCCAGTCCTTGCAGCAGGAATTACCATGCTCCTTACCGATCGTAACCTCAACACCACTTTCTTTGACCC。

Claims

1. A primer-probe set for detecting environmental DNA in spotted catfish, characterized in that: The primer-probe set includes specific primers and specific fluorescent probes; among which, the specific primers include: The sequence of the forward primer NC-F is: 5'-CGGAGGGTTTGGCAACTGATTA-3'; The sequence of the reverse primer NC-R is: 5'-TGGATAAACTGTTCATCCTGCA-3'; The sequence of the specific fluorescent probe NC-Taq is: 5'-FAM-CCCCTTATAATTGGTGCCCCCGAC-MGB-3'.

2. The application of the primer and probe set according to claim 1 for detecting environmental DNA of the spotted catfish, characterized in that: The primer-probe set is used for qualitative and / or quantitative detection of environmental DNA in spotted catfish.

3. A method for detecting environmental DNA of the spotted catfish using the primer and probe set described in claim 1, characterized in that, (1) Collect water samples from the target water area, enrich environmental DNA through a filter membrane, cut the filter membrane into pieces, and extract total environmental DNA using an animal tissue DNA extraction kit; (2) Using the total environmental DNA extracted in step (1) as a template, qPCR amplification was performed using the primer and probe set described in claim 1, and the Ct value was recorded; (3) Calculate the environmental DNA biomass of the spotted catfish in the sample based on the amplification curve and Ct value.

4. The method according to claim 3, characterized in that, The reaction system for qPCR amplification was as follows: forward primer NC-F 10 μM 0.4 μL, reverse primer NC-R 10 μM 0.4 μL, 2×Hieff Union qPCR Taqman ProbeMaster Mix 10 μL, 50×High ROX 0.4 μL, probe NC-Taq 10 μM 0.2 μL, template DNA 1 μL, ddH2O 7.6 μL, totaling 20 μL.

5. The method according to claim 3, characterized in that, The reaction program for qPCR amplification is as follows: pre-denaturation at 95℃ for 1 min; denaturation at 95℃ for 10 sec; annealing at 58℃ for 30 sec, for a total of 40 cycles.

Images