SNP (Single Nucleotide Polymorphism) site, DNA (Deoxyribose Nucleic Acid) fragment, molecular marker primer and method for identifying cerasus humilis pulp color

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site, a DNA (Deoxyribose Nucleic Acid) fragment, a molecular marker primer and a method for identifying the color of cerasus humilis flesh, the SNP site is located at the 422nd basic group site of a cerasus humilis DFR gene, the polymorphism is T / G, the SNP site of red flesh is T, and the SNP site of yellow flesh is G. The nucleotide sequence of the DNA fragment is as shown in SEQ ID NO.1 or SEQ ID NO.2, and the molecular marker primer comprises a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4. The molecular marker primer has the advantages that the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO.1 or SEQ ID NO.2; the method comprises the following steps: (1) collecting a to-be-detected cerasus humilis plant tissue sample and extracting total RNA (Ribonucleic Acid); (2) carrying out reverse transcription on the total RNA to obtain cDNA (complementary deoxyribonucleic acid); step (3), amplifying the cerasus humilis DFR gene by using the molecular marker primer by taking the cDNA as a template; (4) purifying and sequencing an amplification product; and (5) judging whether the pulp of the to-be-detected cerasus humilis sample is red or yellow according to a sequencing result. The technical problems that a traditional cerasus humilis pulp color identification method is long in period and not beneficial to popularization can be solved.

Description

Technical Field

[0001] This invention relates to the field of plum pulp color identification technology. Specifically, it relates to an SNP site, DNA fragment, molecular marker primer, and method for identifying the color of plum pulp. Background Technology

[0002] *Prunus humilis*, a low-growing, clump-forming shrub belonging to the genus *Prunus* in the family Rosaceae, is a third-generation afforestation fruit tree unique to northern China. The plant grows to a height of 0.4-1.5 m, with indistinct main branches and a well-developed underground root system, achieving a root-to-crown ratio of up to 9:1 in a network structure. The dense foliage reduces surface runoff and soil erosion, exhibiting strong cold, drought, and poor soil tolerance. It thrives primarily on sand dunes and barren slopes and possesses strong regenerative capacity. Therefore, *Prunus humilis* is an ideal forestry material for studying plant resistance to abiotic stresses.

[0003] The fruit of the European plum is brightly colored, has a unique flavor, and is arranged in clusters. It is rich in flavonoids, organic acids, tannins, and other bioactive substances, especially calcium, hence its commercial name "calcium fruit." As a plant used for both food and medicine, years of selection, cultivation, and utilization research have shown that this species has a high survival rate, grows quickly, and is used for fruit, animal husbandry, flowering, and medicinal purposes. Its fruit can be eaten fresh, juiced, or processed into vinegar, preserves, and wine. The seeds of the European plum, also known as "Yu Li Ren," have heat-clearing and diuretic effects; the leaves have also been developed into tea beverages in recent years. Furthermore, the fruit contains abundant polyphenols, with higher levels of total phenols, total flavonoids, and flavonols than blackberries and blueberries. The flavonoid content is about three times that of cherries and strawberries; anthocyanins, an important component of flavonoids, are also present in higher amounts than in cranberries and apples. The flesh of the European plum is brightly colored, with shades of red, yellow, and purple. The accumulation of anthocyanins has a significant impact on the quality of European plums. It not only determines the vibrancy of the skin and flesh color, but also serves as an important natural antioxidant, offering positive effects on human health. European plums with red flesh are richer in anthocyanins, better meeting market demands. Therefore, finding an accurate and rapid method for identifying the color of European plum flesh is crucial.

[0004] Currently, the identification of red and yellow-fleshed Prunus cerasifera fruits is mainly accomplished through traditional morphological identification methods. However, these traditional methods require a 3-5 year growth cycle, hindering widespread adoption. With advancements in molecular biology techniques, molecular marker technologies based on DNA sequence polymorphism have emerged, such as RFLP, RAPD, and SSR. These technologies require specific primers to amplify target DNA fragments, enabling the detection and analysis of specific sites in the genome. The advent of molecular marker primers has made molecular marker technologies more efficient, accurate, and convenient, providing powerful tools for research in fields such as genetic breeding, gene mapping, and species identification.

[0005] Molecular marker primers play a crucial role in identifying fruit flesh color. By specifically binding to target gene fragments, they amplify specific DNA fragments, and the differences in bands can be analyzed using techniques such as electrophoresis to accurately distinguish the genotypes corresponding to different flesh colors. This method is unaffected by environmental factors and provides a highly efficient molecular tool for fruit color genetic research, variety breeding, and quality identification. However, there are currently no reports on using molecular markers to identify the flesh color of Prunus cerasifera (European plum). Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to provide an SNP site, molecular marker primer and method for identifying the color of Prunus cerasifera pulp, so as to solve the technical problems of long cycle and unfavorable promotion of traditional identification methods.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0008] A SNP site for identifying the flesh color of Prunus cerasifera is located at the 422nd base site of the Prunus cerasifera DFR gene; the polymorphism of the SNP site is T / G, with the SNP site for red flesh being T and the SNP site for yellow flesh being G.

[0009] A DNA fragment for identifying the color of Prunus cerasifera pulp, characterized in that it is a Prunus cerasifera DFR gene fragment containing the aforementioned SNP site for identifying the color of Prunus cerasifera pulp, and the nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0010] SEQ ID NO.1:

[0011] ATGGGACTAGAGTCTGAATCTGTTTGTGTGACGGGCGCTTCCGGTTTCATCGGCTCATGGCTCGTCATGAGACTCTTAGAGCGCGGTTACACTGTTCGAGCCACCGTGAGGGATCCTGCGAATCAGAAGAAGGTGAAGCATCTGCTGGACTTGCCAAAGGCCGAGACGCACTTGACGCTGTGGAAGGCTGACCTGGCCGACGAGGGAAGCTTTGATGAAGCCATTCAAGGCTGCACCGGAGTGTTCCATGTCGCCACTCCTATGGATTTTGAGTCCAAAGACCCCGAGAACGAAGTGATCAAGCCAACAATAAATGGGGTGCTAGACATCCTGAAGGCATGCCTCAAGGCAAAAACAGTTCGAAGGCTGGTGTTTACATCCTCAGCAGGAACCGTGAATGTCGAAGAGCACCAGAAGTCAT TCTACGACGAAACCAACTGGAGCGATGTTGAATTTTGCCGCTCTGTCAAAATGACTGGTTGGATGTACTTCGTCTCCAAGACTCTAGCTGAGCAAGCTGCATGGAAGTTTGCCAAAGAAAACAACATTGATTTCATTACCATTATCCCAACTCTTGTGATTGGCCCATTTCTCATGCCATCCATGCCACCAAGCCTCATCACCGGACTTTCCCCACTCACTGGAAATACATCTCATTATTCGATTATAAAGCGGGGGCAGTTCGTTCACTTGGACGACCTCTGCCTCTCTCACATATACTTGTACGAGCACCCGAAAGCAGAGGGCCGCTACATTTGTTCTTCCCATGATGCTACAATTTACGACATTGCAAAATTGCTGAGAGAAAAATACCCCGAGTACAATATTCCCACAAAGTTCGATAACATTGAGGAGAACTTGACCAACATCCATTTTTCTTCAAAGAAGTTGACGGACCATGGGTTTGAGTTCAAATACAGCTTGGAGGACATGTTCGTAGGTGCTGTTGATACCTGCAGAGCAAAGGGTTTGATCCCAATTCCTGCTGAGAAACATGAGGCTGACGACAACACCGTCGTCGATGTCAAAGTCTCCGGTTAA;

[0012] SEQ ID NO.2:

[0013] ATGGGACTAGAGTCTGAATCTGTTTGTGTGACGGGCGCTTCCGGTTTCATCGGCTCATGGCTCGTCATGAGACTCTTAGAGCGCGGTTACACTGTTCGAGCCACCGTGAGGGATCCTGCGAATCAGAAGAAGGTGAAGCATCTGCTGGACTTGCCAAAGGCCGAGACGCACTTGACGCTGTGGAAGGCTGACCTGGCCGACGAGGGAAGCTTTGATGAAGCCATTCAAGGCTGCACCGGAGTGTTCCATGTCGCCACTCCTATGGATTTTGAGTCCAAAGACCCCGAGAACGAAGTGATCAAGCCAACAATAAATGGGGTGCTAGACATCCTGAAGGCATGCCTCAAGGCAAAAACAGTTCGAAGGCTGGTGTTTACATCCTCAGCAGGAACCGTGAATGTCGAAGAGCACCAGAAGTCAT G.

[0014] A molecular marker primer for identifying the flesh color of Prunus cerasifera, used to amplify the Prunus cerasifera DFR gene containing the SNP site for identifying the flesh color of Prunus cerasifera, includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4;

[0015] SEQ ID NO.3: ATGGGACTAGAGTCTGAATCTG;

[0016] SEQ ID NO. 4: TTAACCGGAGACTTTGACATCG.

[0017] A method for identifying the color of European plum pulp includes the following steps:

[0018] Step (1): Collect tissue samples from the *Prunus cerasifera* plant to be tested and extract total RNA;

[0019] Step (2): Obtain cDNA by reverse transcription of the extracted total RNA;

[0020] Step (3): Using cDNA as a template, the DFR gene of Prunus cerasifera was amplified using the molecular marker primers for identifying the color of Prunus cerasifera pulp, and the amplification product was obtained.

[0021] Step (4): Purify and sequence the amplification products;

[0022] Step (5): Based on the sequencing results, compare and determine the base type of the SNP sites used to identify the color of the plum flesh, and determine whether the plum flesh of the sample to be tested is red or yellow.

[0023] In the above method for identifying the color of Prunus cerasifera pulp, in step (1), the Prunus cerasifera plant tissue can be roots, stems, leaves, flowers, or fruits, etc.

[0024] In the above method for identifying the color of Prunus cerasifera pulp, step (1) involves using the FastPure UniversalPlant Total RNA Isolation Kit to extract total RNA from Prunus cerasifera plant tissue samples.

[0025] In the above method for identifying the color of Prunus cerasifera pulp, step (2) involves using the HiScript II Q RTSuperMix for qPCR (+gDNA wiper) kit to reverse transcribe the extracted total RNA to obtain cDNA.

[0026] In the above method for identifying the color of Prunus cerasifera pulp, in step (3), the PCR amplification reaction system is a 50 μL mixed system: 20 μL of ddH2O, 1 μL of sample cDNA, 25 μL of 2×Phanta Flash Master Mix (Dye Plus), 2 μL of 10 μmol / L forward primer and 2 μL of 10 μmol / L reverse primer;

[0027] In the above method for identifying the color of European plum pulp, in step (3), the PCR reaction procedure is as follows: first, pre-denaturation at 98℃ for 30s; then, denaturation, annealing and extension are repeated 34 times; finally, final extension at 72℃ for 1min; the denaturation conditions are 98℃ for 10s; the annealing conditions are 56℃ for 5s; and the extension conditions are 72℃ for 10s.

[0028] In the above method for identifying the color of the flesh of the European plum, in step (4), if the sequencing result is as shown in SEQ ID NO.1, then the flesh of the European plum sample to be tested is determined to be red; if the sequencing result is as shown in SEQ ID NO.2, then the flesh of the European plum sample to be tested is determined to be yellow.

[0029] The technical solution of the present invention achieves the following beneficial technical effects:

[0030] 1. This invention relates to molecular marker primers and methods for identifying the flesh color of *Prunus cerasifera* (European plum). Using forward primer DFR-F and reverse primer DFR-R, total genomic DNA from red and yellow *Prunus cerasifera* flesh samples is amplified. Alignment of the amplified DFR intergenic spacer sequence reveals a single base variation between the red and yellow flesh sequences. The amplification results are consistent across individuals in both the red and yellow flesh populations, demonstrating a high degree of uniformity. The method of this invention is stable, highly reproducible, and guarantees extremely high accuracy. Therefore, base differences based on the DFR intergenic spacer region can serve as a molecular marker for distinguishing the flesh color of *Prunus cerasifera*, and the identification method is simple and easy to operate.

[0031] 2. Traditional methods for identifying the flesh color of Prunus cerasifera require waiting until the fruit is ripe before observation and identification can be performed. Seedlings typically take 3-5 years to bear fruit, resulting in a long growth cycle that is easily affected by environmental and human factors. Utilizing the SNP sites, primers, and methods for identifying the flesh color of Prunus cerasifera provided in this invention, only one plant tissue sample (root, stem, leaf, flower, or fruit, etc.) is needed for rapid identification of the flesh color, significantly improving detection speed and efficiency. This invention establishes a rapid and convenient detection system based on this method. Attached Figure Description

[0032] Figure 1 In this embodiment of the invention, agarose gel electrophoresis was used to detect the RNA quality of extracted red and yellow pulp samples of Prunus armeniaca (1-5 are yellow pulp samples, 6-10 are red pulp samples).

[0033] Figure 2 In this embodiment of the invention, agarose gel electrophoresis was used to detect the DFR gene-specific PCR amplification products of red and yellow flesh samples of Prunus armeniaca (HUANG1 to HUANG5 are yellow flesh samples, and HONG1 to HONG5 are red flesh samples).

[0034] Figure 3 A schematic diagram of the method for identifying red and yellow flesh samples of Prunus armeniaca in this embodiment of the invention (1-5 are yellow flesh samples, 6-10 are red flesh samples). Detailed Implementation

[0035] 1. Experimental Instruments and Materials

[0036] PCR instrument (Eppendorf, model 5332), low-temperature refrigerated centrifuge (Eppendorf, model 5810R), micropipette (Eppendorf), electrophoresis system (Beijing Liuyi Instrument Factory, model DYY-12), gel imaging analyzer (BIO-RADChemiDoc XRS).

[0037] FastPure Universal Plant Total RNA Isolation Kit (Novizan), HiScript IIQ RT SuperMix for qPCR (+gDNA wiper) (Novizan), 2×Phanta Flash Master Mix (DyePlus) (Novizan), TAE buffer (Solepro), agarose (White Shark), etc.

[0038] 2. Comparative analysis of the DFR sequence of the target gene in yellow and red-fleshed Prunus cerasifera.

[0039] (1) Collection of fruit pulp samples

[0040] Fruit pulp samples were collected from the nursery of the College of Forestry, Inner Mongolia Agricultural University. Five samples each of mature, healthy, and disease-free red and yellow Prunus cerasifera pulp were collected to form red and yellow Prunus cerasifera pulp sample groups, as shown in Table 1.

[0041] Table 1. Fruit pulp samples and sources of Prunus armeniaca.

[0042]

[0043] (2) Extraction of total RNA from fruit pulp samples

[0044] Total RNA was extracted from red and yellow plum pulp samples using the FastPure Universal Plant Total RNA Isolation Kit, and its quality was assessed by 1% agarose gel electrophoresis. The results showed... Figure 1 As shown, the 28S, 18S, and 5S rRNA bands are distinct, and the 28S rRNA band is about twice as bright as the 18S rRNA band. This result indicates that the sample is of high purity and free from contamination, and can be directly used for subsequent molecular biology experiments.

[0045] (3) Obtaining cDNA from fruit pulp samples

[0046] cDNA was obtained by reverse transcription of total RNA from fruit pulp samples using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) for subsequent amplification of the target gene fragment.

[0047] (4) PCR amplification of the target gene sequence in the total genomic DNA of the pulp sample

[0048] The target gene DFR sequence was amplified from the cDNA of the obtained pulp sample using specific primers (forward primer DFR-F and reverse primer DFR-R) for identifying the color of the European plum pulp, and the amplification product was obtained.

[0049] The sequence of the forward primer DFR-F is as shown in SEQ ID NO.3:

[0050] SEQ ID NO.3: ATGGGACTAGAGTCTGAATCTG;

[0051] The sequence of the reverse primer DFR-R is as shown in SEQ ID NO.4:

[0052] SEQ ID NO. 4: TTAACCGGAGACTTTGACATCG.

[0053] The PCR amplification reaction system was a 50 μL mixture, including 20 μL of ddH2O, 1 μL of fruit pulp sample cDNA, 25 μL of 2×Phanta Flash Master Mix (Dye Plus), 2 μL of 10 μmol / L forward primer and 2 μL of 10 μmol / L reverse primer.

[0054] The PCR reaction procedure is designed as follows:

[0055] (P-1), pre-denaturation at 98℃ for 30 seconds;

[0056] (P-2), denatured at 98℃ for 10 seconds;

[0057] (P-3), Annealing at 56℃ for 5 seconds;

[0058] (P-4), extend at 72℃ for 10 seconds;

[0059] (P-5), Steps (P-2) to (P-4) are repeated 34 times;

[0060] (P-6), 72℃ for 1 min final extension.

[0061] (5) Purify and sequence the amplification products.

[0062] The obtained PCR amplification products were sent to a biotechnology company for sequencing.

[0063] (6) Comparative analysis of sequencing results

[0064] The DFR gene spacer fragment sequences of 10 fruit pulp samples obtained from sequencing were sequenced and sequenced using DNAMAN software to obtain specific SNPs for red and yellow flesh of Prunus cerasifera.

[0065] (7) Sequencing results analysis

[0066] After purification of the PCR products, bidirectional sequencing was performed, and the sequences of the red and yellow flesh samples of Prunus armeniaca were compared. The comparison results of the DFR target fragment sequences of the red and yellow flesh samples are as follows, where the bolded and underlined bases are the different bases between the red and yellow flesh. The difference at the 422nd base position of the DFR sequence of the red and yellow flesh samples of Prunus armeniaca was used as a molecular marker to identify whether the flesh of Prunus armeniaca is red (T) or yellow (G).

[0067] DFR gene sequence of red pulp (SEQ ID NO.1):

[0068] ATGGGACTAGAGTCTGAATCTGTTTGTGTGACGGGCGCTTCCGGTTTCATCGGCTCATGGCTCGTCATGAGACTCTTAGAGCGCGGTTACACTGTTCGAGCCACCGTGAGGGATCCTGCGAATCAGAAGAAGGTGAAGCATCTGCTGGACTTGCCAAAGGCCGAGACGCACTTGACGCTGTGGAAGGCTGACCTGGCCGACGAGGGAAGC TTTGATGAAGCCATTCAAGGCTGCACCGGAGGTGTTCCATGTCGCCACTCCTATGGATTTTGAGTCCAAAGACCCCGAGAACGAAGTGATCAAGCCAACAATAAATGGGGTGCTAGACATCCTGAAGGCATGCCTCAAGGCAAAAACAGTTCGAAGGCTGGTTTACATCCTCAGCAGGAACCGTGAATGTCGAAGAGCACCAGAAGTCAT TCTACGACGAAACCAACTGGAGCGATGTTGAATTTTGCCGCTCTGTCAAAATGACTGGTTGGATGTACTTCGTCTCCAAGACTCTAGCTGAGCAAGCTGCATGGAAGTTTGCCAAAGAAAACAACATTGATTTCATTACCATTATCCCAACTCTTGTGATTGGCCCATTTCTCATGCCATCCATGCCACCAAGCCTCATCACCGGACTTTCCCCACTCACTGGAAATACATCTCATTATTCGATTATAAAGCGGGGGCAGTTCGTTCACTTGGACGACCTCTGCCTCTCTCACATATACTTGTACGAGCACCCGAAAGCAGAGGGCCGCTACATTTGTTCTTCCCATGATGCTACAATTTACGACATTGCAAAATTGCTGAGAGAAAAATACCCCGAGTACAATATTCCCACAAAGTTCGATAACATTGAGGAGAACTTGACCAACATCCATTTTTCTTCAAAGAAGTTGACGGACCATGGGTTTGAGTTCAAATACAGCTTGGAGGACATGTTCGTAGGTGCTGTTGATACCTGCAGAGCAAAGGGTTTGATCCCAATTCCTGCTGAGAAACATGAGGCTGACGACAACACCGTCGTCGATGTCAAAGTCTCCGGTTAA;

[0069] DFR gene sequence (SEQ ID NO.2) of yellow pulp:

[0070] ATGGGACTAGAGTCTGAATCTGTTTGTGTGACGGGCGCTTCCGGTTTCATCGGCTCATGGCTCGTCATGAGACTCTTAGAGCGCGGTTACACTGTTCGAGCCACCGTGAGGGATCCTGCGAATCAGAAGAAGGTGAAGCATCTGCTGGACTTGCCAAAGGCCGAGACGCACTTGACGCTGTGGAAGGCTGACCTGGCCGACGAGGGAAGCTTTGATGAAGCCATTCAAGGCTGCACCGGAGTGTTCCATGTCGCCACTCCTATGGATTTTGAGTCCAAAGACCCCGAGAACGAAGTGATCAAGCCAACAATAAATGGGGTGCTAGACATCCTGAAGGCATGCCTCAAGGCAAAAACAGTTCGAAGGCTGGTGTTTACATCCTCAGCAGGAACCGTGAATGTCGAAGAGCACCAGAAGTCAT G.

[0071] Sequencing results showed that the amplification results of the five individuals in the red-fleshed group and the five individuals in the yellow-fleshed group of Prunus cerasifera were consistent, demonstrating a high degree of consistency. The results were stable and highly reproducible, ensuring extremely high accuracy. Therefore, the base differences based on the DFR gene spacer region can serve as a molecular marker for distinguishing between red and yellow-fleshed Prunus cerasifera, and the identification method is simple and easy to operate.

[0072] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of the claims of this patent application.

Claims

1. A SNP site for identifying the color of Prunus cerasifera pulp, characterized in that, Located at the 422nd base site of the Prunus cerasifera DFR gene; the polymorphism of the SNP site is T / G, with the SNP site of red flesh being T and the SNP site of yellow flesh being G.

2. A DNA fragment for identifying the color of Prunus cerasifera pulp, characterized in that, It is a Prunus cerasifera DFR gene fragment containing the SNP site for identifying the color of Prunus cerasifera pulp as described in claim 1, and the nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. A molecular marker primer for identifying the color of Prunus cerasifera pulp, characterized in that, The DNA fragment used to amplify the SNP site containing the identification of the color of the plum pulp as described in claim 1 includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.

4.

4. A method for identifying the color of European plum pulp, characterized in that, Includes the following steps: Step (1): Collect tissue samples from the *Prunus cerasifera* plant to be tested and extract total RNA; Step (2): Obtain cDNA by reverse transcription of the extracted total RNA; Step (3): Using cDNA as a template, the DFR gene of Prunus cerasifera is amplified using the molecular marker primers for identifying the flesh color of Prunus cerasifera as described in claim 3, to obtain the amplification product; Step (4): Purify and sequence the amplification products; Step (5): Based on the sequencing results, compare and determine the base type of the SNP site for identifying the color of the flesh of the European plum as described in claim 1, and determine whether the flesh of the European plum sample to be tested is red or yellow.

5. The method for identifying the color of Prunus cerasifera pulp according to claim 4, characterized in that, In step (1), the plant tissues of Prunus cerasifera are roots, stems, leaves, flowers or fruits.

6. The method for identifying the color of Prunus cerasifera pulp according to claim 4, characterized in that, In step (1), total RNA was extracted from Prunus cerasifera plant tissue samples using the FastPure Universal Plant Total RNA Isolation Kit.

7. The method for identifying the color of Prunus cerasifera pulp according to claim 4, characterized in that, In step (2), the total RNA extracted was reverse transcribed to obtain cDNA using the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit.

8. The method for identifying the color of Prunus cerasifera pulp according to claim 5, characterized in that, In step (3), the PCR amplification reaction system is a 50 μL mixture: 20 μL of ddH2O, 1 μL of sample cDNA, 25 μL of 2×Phanta FlashMaster Mix (Dye Plus), 2 μL of 10 μmol / L forward primer and 2 μL of 10 μmol / L reverse primer.

9. The method for identifying the color of Prunus cerasifera pulp according to claim 8, characterized in that, In step (3), the PCR reaction procedure is as follows: first, pre-denaturation at 98℃ for 30s; then, denaturation, annealing and extension are repeated 34 times; finally, final extension at 72℃ for 1min; the denaturation conditions are 98℃ for 10s; the annealing conditions are 56℃ for 5s; and the extension conditions are 72℃ for 10s.

10. The method for identifying the color of Prunus cerasifera pulp according to claim 4, characterized in that, In step (4), if the sequencing result is as shown in SEQ ID NO.1, the flesh of the plum sample to be tested is determined to be red; if the sequencing result is as shown in SEQ ID NO.2, the flesh of the plum sample to be tested is determined to be yellow.

Images