ModRNA for treating obliterated bronchitis

Abstract

The invention provides modRNA (Ribonucleic Acid) for treating obliterated bronchitis, and belongs to the technical field of bioengineering. The modRNA for treating obliterated bronchitis provided by the invention is composed of an IL-10 modRNA (Interleukin-10) and an IFN (Interferon)-alpha modRNA (Interferon-alpha) modRNA. The BO treatment effect is achieved by inhibiting bronchial epithelial cell epithelial-mesenchymal transition (EMT), the expression of alpha-SMA and Vimentin in lung tissue can be remarkably reduced, the expression of E-cadherin and Cytokeratin 5 can be up-regulated, microbronchial epithelial injury is repaired, collagen deposition is reduced, and the lung function is improved. The synergistic effect of the two is better than that of single gene therapy, the safety is high, and the controllability is strong.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more particularly to a modRNA for treating bronchiolitis obliterans. Background Technology

[0002] Bronchiolitis obliterans (BO) is a serious lung disease characterized by granulation tissue formation and / or fibrosis within the bronchioles, leading to narrowing or occlusion of the bronchioles. Its etiology is diverse, commonly occurring as chronic rejection after lung or hematopoietic stem cell transplantation, but can also be caused by infection, inhalation injury, or autoimmune diseases. Currently, clinical treatment for BO is very limited, primarily relying on high-dose glucocorticoids and immunosuppressants, but these are ineffective and long-term use is accompanied by severe side effects. Due to the lack of specific therapies that can reverse the fibrotic process, BO patients have a very poor prognosis, with the condition often progressively worsening to respiratory failure, posing a major obstacle to long-term survival in transplant recipients. Therefore, developing novel treatment strategies that can target key aspects of BO pathogenesis, particularly inhibiting the fibrotic process, is of significant clinical need and practical importance.

[0003] In recent years, gene therapy has offered new hope for many intractable diseases. Chemically synthesized modified message RNA (modRNA) technology, as an emerging gene expression platform, utilizes chemically modified mRNA synthesized in vitro and delivered to target cells via carriers such as liposomes or nanoparticles, thereby transiently expressing biologically active target proteins in vivo. Compared to traditional gene therapy vectors (such as viral vectors), modRNA does not pose a risk of insertion into the host genome, offering greater safety. Furthermore, it boasts advantages such as rapid expression, high efficiency, controllable half-life, and low immunogenicity, demonstrating significant application potential in cardiovascular diseases, tissue regeneration, and vaccine development. Therefore, developing a technology based on chemically synthesized modified message RNA for the treatment of bronchiolitis obliterans is of great importance. Summary of the Invention

[0004] The purpose of this invention is to provide a modRNA for treating bronchiolitis obliterans, thereby achieving efficient and targeted treatment of bronchiolitis obliterans.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a modRNA for treating bronchiolitis obliterans, the modRNA being composed of IL-10 modRNA and IFN-α modRNA.

[0006] Preferably, the nucleotide sequence of the IL-10 modRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the IFN-α modRNA is shown in SEQ ID NO.2.

[0007] Preferably, the mass ratio of IL-10 modRNA to IFN-α modRNA in the modRNA is 0.5~1:0.5~1.

[0008] The present invention also provides the application of the modRNA described above in the preparation of a medicament for treating bronchiolitis obliterans.

[0009] The present invention also provides a medicament for treating bronchiolitis obliterans, comprising the modRNA for treating bronchiolitis obliterans.

[0010] Preferably, mesenchymal stem cells are also included.

[0011] Preferably, the IL-10 modRNA and IFN-α modRNA are introduced into mesenchymal stem cells.

[0012] Preferably, the ratio of mesenchymal stem cells to modRNA is 0.5~1.5×10⁻⁶. 6 Individual doses: 3~7 μg.

[0013] Preferably, the drug dosage form includes drops, injections, and nebulizers.

[0014] Beneficial effects

[0015] The IL-10 and IFN-α modRNAs of this invention exhibit efficient and sustained expression both in vivo and in vitro. Synergistic treatment with IL-10 modRNA and IFN-α modRNA significantly improves the pathological changes and fibrosis in the lung tissue of DA-induced BO mice, restoring them to near-normal levels. This invention effectively downregulates the expression of EMT marker proteins α-SMA and Vimentin, while upregulating the expression of epithelial cell marker proteins E-cadherin and Cytokeratin 5, thereby reversing the EMT process and fundamentally alleviating airway fibrosis and occlusion. Furthermore, using mesenchymal stem cells (MSCs) as the modRNA delivery carrier leverages the natural lung homing characteristics of MSCs, enhancing the targeted nature of the treatment. Attached Figure Description

[0016] Figure 1 The images show the results of HE staining and Masson staining of lung tissue in Example 1; Figure 2 This is a diagram showing the results of the in vitro tracing experiment of GFP modRNA in Example 2; Figure 3 This is a flow cytometry result of GFP modRNA expression level 24h in Example 2; Figure 4 The results of the in vivo GFP modRNA tracing experiment in Example 2; Figure 5 This is a graph showing the in vitro expression levels of IL-10 and IFN-α modRNA in Example 3; Figure 6 This is a graph showing the in vivo expression levels of IL-10 and IFN-α modRNA in Example 3; Figure 7 This is a diagram showing the HE staining results in Example 4; Figure 8 This is a diagram showing the Masson staining results in Example 4; Figure 9 The figures show the fibrosis scoring results from HE staining and the semi-quantitative analysis results from Masson staining in Example 4. Figure 10 This is a graph showing the WB analysis results from Example 4; Figure 11 This is an image showing the immunofluorescence staining evaluation of mouse lung tissue in Example 4; Figure 12 This is a diagram illustrating the treatment mechanism in Example 4. Detailed Implementation

[0017] IL-10 modRNA sequence, SEQ ID NO.1: ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGA IFN-α modRNA sequence, SEQ ID NO.2: ATGGCTAGGCTCTGTGCTTTCCTGATGGTCCTGGCGGTGCTGAGCTACTGGCCAACCTGCTCTCTAGGATGTGACCTTCCTCAGACTCATAACCTCAGGAACAAGAGAGCCTTGACACTCCTGGTACAAATGAGGAGACTCT CCCCTCTCTCCTGCCTGAAGGACAGGAAGGACTTTGGATTCCCGCAGGAGAAGGTGGATGCCCAGCAGATCAAGAAGGCTCAAGCCATCCCTGTCCTGAGTGAGCTGACCCAGCAGATCCTGAACATCTTCACATCAAAGGAC TCATCTGCTGCATGGAATACAACCCTCCTAGACTCATTCTGCAATGACCTCCACCAGCAGCTCAATGACCTGCAAGGCTGTCTGATGCAGCAGGTGGGGGTGCAGGAATTTCCCCTGACCCAGGAAGATGCCCTGCTGGCTG TGAGGAAATACTTCCACAGGATCACTGTGTACCTGAGAGAGAAGAAACACAGCCCCTGTGCCTGGGAGGTGGTCAGAGCAGAAGTCTGGAGAGCCCTGTCTCTCCTGCCAATGTGCTGGGAAGACTGAGAGAAGAGAAATGA The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0018] Example 1

[0019] Seven-week-old C57BL / 6 mice were randomly divided into control and experimental groups: a blank control group and a disease (BO) group. Lung fibrosis was induced via endotracheal infusion. On day 0, mice were anesthetized and intubated. The BO group received 200 mg / kg DA via infusion, while the control group received an equal volume of PBS. Mouse weight and respiratory status were monitored daily. Lung function was assessed on days 7 and 14, and serum and lung tissue were collected for subsequent experiments. This included fixing and embedding sections of lung tissue for HE and Masson staining. The degree of fibrosis and fibrosis deposition in the lung tissue was calculated based on HE and Masson staining results. Figure 1 As shown.

[0020] Depend on Figure 1It can be seen that A is the HE staining result of the blank control group, B is the Masson staining result of the disease group, C is the Masson staining result of the blank control group, and D is the Masson staining result of the disease group. HE staining shows a difference compared to the control group ( Figure 1 Compared to group A, group B ( Figure 1 C) The epithelial cells of the bronchioles were significantly damaged, with subepithelial inflammatory cell infiltration, thickened bronchial walls, and mucus secretion visible within the bronchial lumen. Simultaneously, Masson staining also showed differences compared to the control group ( Figure 1 Compared to group B), group BO ( Figure 1 D) There is a large amount of collagen deposits around the bronchioles.

[0021] Example 2

[0022] We used green fluorescent protein (GFP) for in vitro tracking experiments. GFP modRNA was transferred into MSCs via electroporation, followed by culturing. GFP expression levels were recorded at 4h, 12h, 24h, 48h, 80h, and 120h. Fluorescence tracking revealed that GFP expression peaked 24 hours after electroporation, and its efficiency gradually decreased with MSC expansion (results are shown in Figure 1). Figure 2 (As shown). We selected the 24-hour period with the highest expression level for flow cytometry analysis and found that the expression efficiency of GFP could reach as high as 90.3% (results are shown in the figure). Figure 3 As shown in the figure, where a and b are control groups, and c and d are experimental groups.

[0023] We performed a GFP modRNA tracing experiment in the lung tissue of C57BL / 6 mice. After culturing P3 generation MSCs, the MSCs were first stained with red fluorescence using a cell membrane staining reagent (CM-Dil), then electroporated to carry GFP modRNA carrying green fluorescence. The MSCs carrying GFP modRNA were then transferred into mouse lung tissue via intratracheal instillation. Frozen sections of mouse lung tissue were collected on days 1, 3, 5, and 7 to observe the expression and duration of MSCs and the transferred RNA in the lung tissue (results are shown in Figure 1). Figure 4 (As shown in the figure). The results showed that the expression level of GFP was the highest on the first day. As time went on, the expression levels of both MSC and GFP gradually decreased, and by the 7th day, both had disappeared.

[0024] Example 3

[0025] MSCs isolated from neonatal umbilical cords were cultured and used in experiments after reaching passage P3. They were divided into four groups: MSCs + GFP modRNA, MSCs + IL-10 modRNA, MSCs + IFN-α modRNA, and MSCs + IL-10 + IFN-α modRNA. The ratio of MSCs electroporated with modRNA was 1 × 10⁻⁶.6 MSCs: 5 μg modRNA. After centrifugation and resuspending the cells, prepare a 100 μl suspension for electroporation. After electroporation, resuspend the MSCs in PBS and incubate at 37°C for 30 min before use.

[0026] (1) In vitro experiments: We validated the in vitro expression of IL-10 and IFN-α modRNA. There were four groups: MSC+IL-10 modRNA group, MSC+IFN-α modRNA group, MSC+IL-10+IFN-α modRNA group, and MSC+GFP modRNA group. MSCs and modRNA were electroporated at a ratio of 200,000 cells: 1 μg modRNA and seeded in 6-well plates. Cell culture supernatants were collected at 24h, 48h, 72h, 96h, and 120h, and the levels of IL-10 and IFN-α secreted in vitro were detected by ELISA. The results are as follows: Figure 5 As shown.

[0027] Depend on Figure 5 It was found that both IL-10 and IFN-α modRNA were highly expressed after electroporation. IL-10 modRNA showed the highest expression level in the first 24 hours, gradually decreasing thereafter. While IFN-α modRNA began expression within 24 hours, it reached its peak expression between 24 and 48 hours. Cumulative expression levels over each 24-hour period showed that both IL-10 and IFN-α modRNA exhibited continuous expression, with a relatively rapid expression rate in the first 72 hours. However, overall, the secretory expression level of IFN-α modRNA was lower than that of IL-10 modRNA.

[0028] (2) In vivo experiments: After incubation, the MSCs were re-centrifuged and resuspended, with each mouse receiving 20 μl of cell suspension containing 1×10⁻⁶ cells. 6 MSC proportions were determined. In vivo experiments were also conducted in four groups as described above. On day 0, MSCs containing modRNA were administered into lung tissue via intratracheal instillation. Subsequently, from day 1 to day 7, lung tissue was collected daily from different groups of mice, with six mice per group each time. Lung tissue homogenates were analyzed using ELISA to detect IL-10 and IFN-α levels. Results are as follows... Figure 6 As shown.

[0029] Depend on Figure 6Based on the duration of GFP modRNA expression in vivo, we examined the in vivo expression efficiency of IL-10 and IFN-α modRNA within 3 days. The results showed that, similar to in vitro expression, both IL-10 and IFN-α modRNA were efficiently expressed and translated in vivo on day 1, and effective IL-10 and IFN-α proteins remained in lung tissue until day 3.

[0030] Example 4

[0031] 1. C57BL / 6 mice were used to establish BO and control models using the method described in Example 1. Mice were divided into a blank control group, a BO group, a treatment control group (BO-MSC+GFP), a single-gene treatment group (BO-MSC+IL-10 and BO-MSC+IFN-α), and a double-gene treatment group (BO-MSC+IL-10+IFN-α). Treatment group mice were intratracheally infused with MSCs containing different modRNAs 6 hours after DA administration, on day 3, and day 5. Specifically, the MSCs incubated for 30 min were re-centrifuged and resuspended, with each mouse receiving 20 μL of cell suspension containing 1 × 10⁻¹⁰ MSCs. 6 MSCs were prepared into a suspension and administered via intratracheal drip. The Control and BO groups received the same volume of PBS instead. Lung function tests were performed on mice in each group on days 7 and 14, and serum and lung tissue were collected for subsequent experiments, including: fixing and embedding sections of lung tissue after collection, performing HE and Masson staining, and statistically analyzing the degree of lung fibrosis and fiber deposition. E-cadherin and CK-5 immunofluorescence staining was performed on selected lung tissue sections. Proteins and RNA were extracted from selected lung tissue sections, and the expression of α-SMA and Vimentin proteins and genes was determined using Western blotting and RT-PCR. Results are as follows: Figures 7-9 As shown.

[0032] in Figure 7 The results of HE staining are shown in the figure (a is the blank control group, b is the BO group, c is the treatment control group (BO-MSC+GFP), d is the single gene therapy group (BO-MSC+IL-10), e is the single gene therapy group (BO-MSC+IFN-α), and f is the double gene therapy group (BO-MSC+IL-10+IFN-α)). Figure 8 The images show the Masson staining results (a) blank control group, b) BO group, c) treatment control group (BO-MSC+GFP), d) single gene therapy group (BO-MSC+IL-10), e) single gene therapy group (BO-MSC+IFN-α), f) double gene therapy group (BO-MSC+IL-10+IFN-α) Figure 9In the figure, A represents the fibrosis scoring results from HE staining, and B represents the semi-quantitative analysis results from Masson staining.

[0033] Depend on Figures 7-9 It can be seen that IL-10+IFN-α modRNA can significantly improve BO-like changes in mouse lung tissue, as shown by HE staining results ( Figure 7 -f) and Masson staining results ( Figure 8 -f) and control group ( Figure 7 -a; Figure 8 -a) showed no significant difference. However, IL-10 modRNA alone ( Figure 7 -d; Figure 8 -d) or IFN-α modRNA ( Figure 7 -e; Figure 8 -e), its therapeutic effect is superior to MSC+GFP modRNA ( Figure 7 -c; Figure 8 -c) treatment, but less effective than a combination of two modRNAs. Furthermore, fibrosis scoring was performed using HE staining and semi-quantitative analysis using Masson staining. Figure 9 This further confirms that the simultaneous use of IL-10+IFN-α modRNA provides the best therapeutic effect for BO.

[0034] 2. Western blot analysis was performed on the mice in each group, and the results are as follows: Figure 10 As shown in the figure (where A is the expression level of α-SMA and Vimentin proteins, and B is the electrophoresis result of α-SMA and Vimentin proteins). The results showed that the expression levels of α-SMA and Vimentin proteins in the lung tissue of the BO group were significantly increased. After treatment with IL-10 and IFN-α modRNA, the levels of α-SMA and Vimentin decreased significantly, with the IL-10 combined with IFN-α modRNA treatment group showing the most significant effect.

[0035] Cytokeratin 5 and E-cadherin provide structural support and protection for bronchial epithelial cells. Therefore, we performed immunofluorescence staining on lung tissues from each group of mice to assess the level of bronchial epithelial damage and repair. Results are as follows: Figure 11 As shown in the figure (where A is an immunofluorescence image of mouse lung tissue and B is a fluorescence intensity image of E-cadherin and CK-5), the results show that the expression levels of Cytokeratin 5 (CK-5) and E-cadherin proteins in the lung tissue of the BO group were significantly decreased. After treatment with IL-10 and IFN-α modRNA, the levels of both proteins were significantly increased. The treatment group treated with IL-10 combined with IFN-α modRNA showed the most significant effect, and the level could be basically restored to normal.

[0036] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A modRNA for treating bronchiolitis obliterans, characterized in that, The modRNA consists of IL-10 modRNA and IFN-α modRNA.

2. The modRNA as described in claim 1, characterized in that, The nucleotide sequence of the IL-10 modRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the IFN-α modRNA is shown in SEQ ID NO.

2.

3. The modRNA as described in claim 1, characterized in that, The mass ratio of IL-10 modRNA to IFN-α modRNA in the modRNA is 0.5~1:0.5~1.

4. The use of the modRNA according to any one of claims 1 to 3 in the preparation of a medicament for treating bronchiolitis obliterans.

5. A drug for treating bronchiolitis obliterans, characterized in that, Includes the modRNA for treating bronchiolitis obliterans as described in claim 1.

6. The drug as described in claim 5, characterized in that, It also includes mesenchymal stem cells.

7. The drug as described in claim 6, characterized in that, The IL-10 modRNA and IFN-α modRNA were introduced into mesenchymal stem cells.

8. The drug as described in claim 7, characterized in that, The ratio of mesenchymal stem cells to modRNA is 0.5~1.5×10⁻⁶. 6 Individual doses: 3~7 μg.

9. The medicament as described in claim 8, characterized in that, The drug dosage forms include drops, injections, and nebulizers.

Images