Label-free screening method and application of FPR1 bias agonist screened by label-free screening method in acute lung injury

The use of a label-free screening method to identify kinetin riboside solves the problem of the lack of drugs for treating acute lung injury in existing technologies, enabling safe and efficient treatment of lung injury, reducing the risk of adverse reactions and improving treatment efficacy.

CN121521807AActive Publication Date: 2026-02-13JINAN UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511700174.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-19
Publication Date
2026-02-13
Estimated Expiration
2045-11-19

AI Technical Summary

Technical Problem

Currently, there is a lack of specific drugs for the effective treatment of acute lung injury. Existing treatments such as glucocorticoids can only relieve symptoms, and the hospital mortality rate is still as high as 40%. Moreover, existing screening methods rely on fluorescent or radioactive labeling, which poses safety risks.

Method used

A label-free screening method was used to screen for FPR1-biased agonists using the Epic label-free screening instrument and calcium ion indicators. Combined with G protein dissociation and β-arrestin recruitment experiments, kinetin riboside (KR) was screened out. This method does not rely on fluorescent or radioactive labeling and uses the Corning Epic® screening platform to monitor changes in cell signaling.

Benefits of technology

We screened out kinetin nucleosides that have therapeutic effects on acute lung injury, significantly inhibiting superoxide production and degranulation, reducing neutrophil infiltration, alleviating lung injury, reducing the risk of adverse reactions, and improving treatment precision.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121521807A_ABST
    Figure CN121521807A_ABST
Patent Text Reader

Abstract

The invention discloses a label-free screening method and application of an FPR1 bias agonist screened by the label-free screening method to acute lung injury. According to the invention, Epic label-free screening is combined with calcium flow screening, such that a preliminarily screened FPR1 agonist is obtained; the FPR1 biased agonist is obtained through a G protein dissociation experiment and a beta-arrest collection experiment; the FRP1 antagonist is obtained through screening of a known FPR1 agonist. The FPR1 bias agonist kinetin nucleoside is obtained for the first time, and by detecting the superoxide inhibiting, cast-off cell inhibiting and MPO inhibiting functions of the bias agonist KR, it is proved that the bias agonist KR has the function of treating acute lung injury. The invention discovers that the kinetin nucleoside has the effect of treating the acute lung injury for the first time.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and particularly relates to a label-free screening method and application of a FPR1 biased agonist screened by the method in acute lung injury. BACKGROUND

[0002] Acute lung injury (ALI) is an acute diffuse inflammatory disease of the lung, and the causes of the disease are: trauma, inhalation of toxic / corrosive gas, pneumonia caused by various pathogenic infections, sepsis, pancreatitis, etc. The mortality rate (mortality rate of severe patients is more than 40%) and morbidity of the disease are very high. The pathogenesis of the disease is that inflammatory related cells such as neutrophils and macrophages gather in the lung and release a large amount of proinflammatory cytokines, thereby causing a cytokine storm, leading to sustained damage of the lung vascular endothelium and epithelial barrier, increasing the permeability of the lung alveolar capillary, and thus causing lung injury. Two key pathological processes are: (1) lung vascular endothelial-lung epithelial barrier damage leads to a large amount of protein-rich fluid seeping into the lung tissue; (2) neutrophil migration to lung tissue leads to neutrophil infiltration, releasing cytokines, reactive oxygen species (ROS), granular substances and forming neutrophil extracellular traps (NETs) to damage lung tissue. At present, there is no specific drug for treating acute lung injury. In clinical practice, glucocorticoids are mainly used to inhibit the production and release of proinflammatory factors to alleviate lung injury. In addition, according to the parameters such as tidal volume, oxygenation index and respiratory rate of the patient, a respiratory support strategy is formulated, such as mechanical ventilation, extracorporeal membrane oxygenation, etc. After treatment, although the patient's condition is improved, the hospital mortality rate is still as high as 40%. Therefore, it is very important to find a therapeutic drug and means for treating lung injury. SUMMARY

[0003] The primary purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide a label-free screening method.

[0004] Another purpose of the present application is to provide the application of the above-mentioned label-free screening method in screening FPR1 ligands (including agonists, biased agonists, partial agonists, antagonists, allosteric modulators, etc.).

[0005] Still another purpose of the present application is to provide the application of kinetin riboside (KR) obtained by the above-mentioned label-free screening method in preparing FPR1 biased agonists.

[0006] Still another purpose of the present application is to provide the application of kinetin riboside in preparing a drug for preventing and / or treating acute lung injury.

[0007] The objective of this invention is achieved through the following technical solution: a label-free screening method, comprising the following steps: (1) Prepare RBL-FPR1 cells that can stably express FPR1; (2) RBL-FPR1 cells were seeded into cell culture plates and the baseline signal was observed using an Epic label-free screening instrument; after adding the compound to be tested, the potential active compound was obtained by observing the changes in cell signal. (3) RBL-FPR1 cells were seeded into cell culture plates, calcium ion indicator was added, and then the potential active compound obtained in step (2) was added. The calcium ion flow was detected to obtain the FPR1 agonists that were initially screened. The FPR1 agonists that were initially screened were detected by the NanoBiT-based G protein dissociation detection system and β-arrestin recruitment experiment. Compounds that could selectively activate G protein dissociation or β-arrestin recruitment were identified as FPR1 selective agonists. (4) RBL-FPR1 cells were seeded into cell culture plates, and the potential active compound obtained in step (2) was added and then a calcium ion indicator was added for incubation. Then a known FPR1 agonist was added, and the calcium ion flow was detected to obtain an FPR1 antagonist.

[0008] The RBL-FPR1 cells mentioned in step (1) are recombinant cell lines that express formyl peptide receptor 1 (FPR1); preferably, they are prepared by the following steps: transfecting the encoding nucleic acid that expresses FPR1 into RBL-2H3 cells and selectively performing stress screening to obtain RBL-FPR1 cells.

[0009] The preferred FPR1-encoding nucleic acid is a recombinant eukaryotic expression vector containing FPR1-encoding nucleic acid.

[0010] The eukaryotic expression vector is preferably a pCDNA series vector; more preferably pCDNA3.1.

[0011] The preferred pressure is G418.

[0012] The cell culture plate mentioned in step (2) is preferably a 384-well plate.

[0013] The preferred seeding amount of RBL-FPR1 cells in step (2) is 1.8 × 10⁻⁶. 3 ~7.2×10 3 Cells / well; more preferably 5 × 10⁶ 3 Cells / well

[0014] The cell culture plate mentioned in step (3) is preferably a 96-well plate.

[0015] The inoculation amount of the RBL-FPR1 cells in step (3) is preferably 1×10 4 ~4×10 4 cells / well; more preferably 2×10 4 cells / well.

[0016] The calcium ion indicator in step (3) is preferably FLIPR Calcium 5 Reagent.

[0017] The NanoBiT-based G protein dissociation detection system in step (3) comprises an FPR1 plasmid, a Gβ1 plasmid, a SmBiT-Gγ2 (C68S) plasmid, and a Gαi1-LgBiT plasmid.

[0018] The FPR1 plasmid is a recombinant eukaryotic expression vector into which an FPR1 gene is cloned.

[0019] The Gβ1 plasmid is a recombinant eukaryotic expression vector into which a Gβ1 gene is cloned.

[0020] The SmBiT-Gγ2 (C68S) plasmid is a recombinant eukaryotic expression vector into which a SmBiT gene and a Gγ2 (C68S) gene connected to the SmBiT gene are cloned.

[0021] The Gαi1-LgBiT plasmid is a recombinant eukaryotic expression vector into which a LgBiT gene and a Gαi1 gene connected to the LgBiT gene are cloned.

[0022] The NanoBiT-based G protein dissociation detection in step (3) is performed as follows: the FPR1 plasmid, the Gβ1 plasmid, the SmBiT-Gγ2 (C68S) plasmid, and the Gαi1-LgBiT plasmid are co-transfected into animal cells, the obtained cells are added with a substrate and then transferred to 384 wells for incubation, the baseline luminescence value is recorded by an EnVision plate reader, and then the primary screening FPR1 agonist is added, and the luminescence signal is continuously monitored.

[0023] The animal cells are preferably Hela cells, HEK293 cells, or HEK293T cells.

[0024] The substrate is preferably Coelenterazine h or Furimazine.

[0025] The concentration of the substrate in the cell solution is preferably 10 μM.

[0026] The incubation time is preferably 50-70 min.

[0027] The continuous monitoring time is preferably 10-20 min.

[0028] The steps of the β-arrestin recruitment experiment in step (3) are as follows: co-transfect FPR1-SmBiT plasmid and LgBiT-β-arrestin2 plasmid into animal cells, and then transfer the obtained cells into 384-well plates after adding a substrate, incubate, record the baseline luminescence value in an EnVision plate reader, and then add the primary screening FPR1 agonist, and continuously monitor the luminescence signal.

[0029] The FPR1-SmBiT plasmid is a plasmid capable of expressing FPR1 and SmBiT.

[0030] The LgBiT-β-arrestin2 plasmid is a plasmid capable of expressing LgBiT and β-arrestin2.

[0031] The animal cells are Hela, HEK293 or HEK293T; more preferably, HEK293T.

[0032] The substrate is preferably Coelenterazine h or Furimazine.

[0033] The concentration of the substrate in the cell solution is preferably 10 μM.

[0034] The incubation time is preferably 20-30 min.

[0035] The continuous monitoring time is preferably 30-40 min.

[0036] The cell culture plate in step (4) is preferably a 96-well plate.

[0037] The inoculation amount of RBL-FPR1 cells in step (4) is preferably 1×10 4 ~ 4×10 4 cells / well; more preferably, 2×10 4 cells / well.

[0038] The calcium indicator in step (4) is preferably FLIPR Calcium 5 Reagent.

[0039] The known FPR1 agonist in step (4) is preferably fMLF.

[0040] The above-mentioned label-free screening method is used in screening FPR1 ligands.

[0041] The ligand is preferably an agonist, antagonist or allosteric modulator.

[0042] The agonist includes an agonist, a biased agonist, and a partial agonist.

[0043] The application of kinetin riboside (KR) obtained by the above-mentioned label-free screening method in the preparation of an FPR1 biased agonist.

[0044] Kinetin riboside can inhibit the generation of superoxide and degranulation at the cell level, and can alleviate lung injury in a mouse model of LPS-induced acute lung injury, and therefore, kinetin riboside can be used for the preparation of a drug for preventing and / or treating acute lung injury.

[0045] The dosage form of the drug is preferably an oral dosage, an injection dosage or an aerosol dosage.

[0046] The kinetin riboside is an analogue of a plant hormone cytokinin extracted from coconut water of a Chinese medicine coconut. 15 H 17 N5O5, with a CAS number of 4338-47-0 and a molecular weight of 347.33, and a structural formula as follows: .

[0047] Principles of the present application: The Corning Epic® label-free screening technology is a high-throughput detection platform based on an optical biosensor, which can monitor cells and biochemical reactions in real time without fluorescence or radioactive labeling. The core principle is to use a resonant waveguide grating (RWG) sensor to detect the local refractive index change caused by the binding of cells or molecules, so as to reflect the dynamic mass redistribution (DMR) in the cells. The biased agonist described in the present application is an active compound that can specifically activate a specific signal pathway downstream of the receptor. It only specifically activates a certain specific signal transduction pathway, and does not activate or significantly reduces the activation of other signal pathways. Unlike traditional balanced agonists, biased agonists achieve biased binding and activation of a certain class of signal transduction proteins by stabilizing the specific conformational state of the receptor, such as biased activation of the G protein signal pathway or the beta-arrestin signal pathway. This unique functional selectivity feature can effectively reduce the risk of adverse reactions of drugs and improve the accuracy of treatment. Formyl peptide receptor 1 (FPR1) plays a very important role in the occurrence and development of lung injury. Therefore, the present application uses Epic label-free screening combined with calcium flow screening to obtain a compound acting on FPR1; through G protein dissociation experiment and beta-arrestin recruitment experiment, the FPR1 biased agonist KR is obtained; finally, the function of the biased agonist KR in inhibiting superoxide, degranulation and MPO is detected, confirming that the biased agonist KR has the function of treating acute lung injury.

[0048] The present application has the following advantages and effects relative to the prior art: (1) The present application provides a screening method for FPR1 ligands, through which FPR1 biased agonists can be screened.

[0049] (2) Through the screening method provided by the present application, an agmatine nucleoside having the effect of treating acute lung injury is screened. The agmatine nucleoside used in the present application is extracted from coconut juice. Coconut (Cocos nucifera L.) is included in the National Chinese Herbal Medicine Compilation, and is a plant of the genus Cocos in the family Arecaceae, with pulp, juice and shell used as medicine. The fruit is harvested when it is mature, and the pulp and juice have the functions of tonifying deficiency, promoting saliva production, diuresis and killing insects. They are used for heart disease edema, dry mouth and itching caused by fasciolopsidiasis. The shell has the functions of dispelling wind, removing dampness and relieving itching. It is used externally for treating tinea corporis and tinea pedis. The main biological activity of the agmatine nucleoside reported at present is to inhibit the growth of cancer cells, and it has a killing effect on various cancer cells such as colon cancer cells, cervical cancer cells (HeLa) and mouse melanoma cells (B16F-10). The present application first found that the agmatine nucleoside is a biased agonist of FPR1 and has the effect of treating acute lung injury. BRIEF DESCRIPTION OF DRAWINGS

[0050] Figure 1 is a result map of Epic label-free screening combined with calcium flow screening of the compound to be detected; wherein A is the result of Epic label-free screening, and B is the result of calcium flow screening.

[0051] Figure 2 is a result map of G protein dissociation experiment.

[0052] Figure 3 is a result map of β-arrestin recruitment experiment.

[0053] Figure 4 is a result map of detection of the inhibitory effect of agmatine nucleoside KR on superoxide.

[0054] Figure 5 is a result map of detection of the inhibitory effect of agmatine nucleoside KR on degranulation.

[0055] Figure 6 is a result map of detection of the inhibitory effect of agmatine nucleoside KR on MPO.

[0056] Figure 7 is a result map of HE staining of the relieving effect of agmatine nucleoside KR on acute lung injury. DETAILED DESCRIPTION

[0057] The present application will be further described in detail below in combination with examples and drawings, but the embodiments of the present application are not limited thereto.

[0058] Example 1: Epic label-free screening technology combined with calcium flow detection screened compounds acting on FPR1. (1) Experimental materials The FPR1 gene sequence was obtained by synthesizing the FPR1 gene, which was obtained by referring to positions 128-1180 in GenBank accession number NM_001193306.2.

[0059] Construction of the FPR1 plasmid: FPR1 was inserted into the multiple cloning site of the vector pcDNA3.1(+) using molecular cloning technology. BamH I and EcoR Between I and II, the FPR1 plasmid was obtained.

[0060] Construction of RBL-FPR1 cells: The FPR1 plasmid was transfected into the rat basophilic leukemia cell line RBL-2H3 cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific). After culturing for 1 day, 25% of the cells were digested and added to a 10 cm cell culture dish. The cells were cultured in DMEM + 20% FBS + 700 μg / mL G418 medium and passaged for 2 months to obtain RBL-FPR1 cells that stably express FPR1.

[0061] (2) Experimental procedure After digestion and centrifugation, RBL-FPR1 cells were resuspended in complete culture medium (DMEM + 20% FBS + 250 μg / mL G418) until the cell density was 2 × 10⁻⁶ cells / mL. 5 Cells / mL. Add 40 μL of cell suspension to each well of a Corning Epic® 384-well cell detection microplate and incubate at 37 °C for 12 hours. After incubation, gently wash the cells twice with detection buffer (HBSS containing 20 mM HEPES, pH 7.4). Transfer the microplate to a Corning Epic® BT system and record data continuously for 30 minutes. Then add 10 μL of the target compound (final concentration 10 μM) to the plate and continue monitoring the cell response using the Corning Epic® BT system for 30 minutes. The 18 potentially active compounds selected are then used for the next step of calcium flow screening.

[0062] RBL-FPR1 cells were seeded in 96-well plates (transparent bottom, black wall) at 100 μL / well, and cultured to 90% confluence. Then 90 μL calcium indicator FLIPR Calcium 5 Reagent was added, and incubated at 37 ℃ for 1 hour. Then 10 μL test compound (final concentration 10 μM) was added, and 2 parallel samples were set for each test compound. The changes of calcium signal were detected by FlexStation III (Molecular Devices) in real time.

[0063] The results are shown in Table 1. Figure 1 As shown in Table 1, KR acting on FPR1 was screened by Epic label-free screening technology combined with calcium flow detection.

[0064] Example 2G protein dissociation experiment G protein activation was evaluated by NanoBiT dissociation experiment.

[0065] (1) Experimental materials FPR1 plasmid, same as Example 1.

[0066] Gai1-LgBiT plasmid was prepared according to the sequence and method of Gai1-LgBiT plasmid in the literature 1 “Illuminating G-Protein-Coupling Selectivity of GPCRs. Cell 2019, 177 (7), 1933-1947.e25.”.

[0067] Construction of SmBiT-Gy2 (C68S) plasmid: The base sequence of SmBiT-Gy2 (C68S) gene is: GCCACCATGGTGACCGGCTACCGGCTGTTCGAGGAGATTCTGGGATCGAGCGGTGGTGGCGGGAGCGGAGGTGGAGGGTCGTCAGGTGAATTCGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCAATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCAAGGAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGTTTTTCAGTGCCATCCTTTAA. The SmBiT-Gy2 (C68S) gene was synthesized by General Biosystems. Then the SmBiT-Gy2 (C68S) was inserted into the multiple cloning site of the vector pcDNA3.1 (+) by molecular cloning technology BamH I and XhoI between I and I, to obtain the SmBiT-Gy2 (C68S) plasmid.

[0068] Construction of Gp1 plasmid: The sequence of Gp1 gene is referred to GenBank NM_212609.1 345-1367, and the Gp1 gene was synthesized by General Biosystems. Then the Gp1 was inserted into the multiple cloning site of the vector pcDNA3.1 (+) by molecular cloning technology BamH I and EcoR between I and I, to obtain the Gp1 plasmid.

[0069] (2) Experimental process Human embryonic kidney cell line HEK293T cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. Before transfection, the cells were digested with 0.25% trypsin and passaged at a ratio of 1:3. The cells were passaged 24 h before transfection at a ratio of 0.5 x 10 5Cells were seeded in 24-well plates at a density of 1 cell / well. Each well was co-transfected with the plasmid mixture: FPR1 plasmid 92 ng, Gai1-LgBiT plasmid 46 ng, Gpi plasmid 230 ng, SmBiT-Gy2 (C68S) plasmid 230 ng using Lipofectamine 3000 (Thermo Fisher Scientific). Cells were collected after 24 h, resuspended in HBSS containing 20 mM HEPES (pH 7.4) and dispensed into white 384-well culture plates at 20 pL / well. Coelenterazine h (5 pL / well, final concentration 10 pM) was added and incubated at room temperature for 1 h. Baseline luminescence values were recorded on an EnVision Multilabel Reader (PerkinElmer) followed by injection of KR (final concentrations 1, 10, 100, 1000, 10000, 50000, 100000 nM) or fMLF (final concentration 100 nM) and luminescence signals were continuously monitored for 15 min.

[0070] Results are shown in Figure 6. KR, like the positive control (fMLF, an agonist of FPR1), caused dissociation of the G protein. Figure 2

[0071] Example 3 β-arrestin recruitment assay β-arrestin2 recruitment was determined using a NanoBiT-based assay.

[0072] (1) Materials The cDNA sequence of SmBiT gene is as follows: GTGACCGGCTACCGGCTGTTCGAGGAGATTCTG.

[0073] The sequence of LgBiT gene refers to addgene: Plasmid #234738 CMV-LgBit.

[0074] The cDNA sequence of Linker1 is as follows: GGATCGAGCGGTGGTGGCGGGAGCGGAGGTGGAGGGTCGTCAGGT.

[0075] The cDNA sequence of Linker2 is as follows: GGAGGTTCGGGAGGCGGTGGCTCGGGCGGATCTTCAAGCGGCGGG.

[0076] linker1-SmBiT is the connection of linker1 and SmBiT as described above, which is synthesized by a company.

[0077] ​LgBiT-linker2 was obtained by connecting LgBiT and linker2 mentioned above, which was synthesized by the company.

[0078] The sequence reference accession number of FPR1 gene is 128-1180 in GenBank NM_001193306.2, and the FPR1 gene was synthesized by the company.

[0079] The sequence reference accession number of β-arrestin2 gene is GenBank EU883572.1, and the β-arrestin2 gene was synthesized by the company.

[0080] Construction of FPR1-SmBiT plasmid: linker1-SmBiT was inserted into the multiple cloning site of vector pcDNA3.1(+) by molecular cloning technology EcoR I and Xho FPR1 in GPCR members was inserted into the multiple cloning site between BamH I and EcoR FPR1-SmBiT plasmid was obtained.

[0081] Construction of LgBiT-β-arrestin2 plasmid: LgBiT-linker2 was inserted into the multiple cloning site of vector pcDNA3.1(+) by molecular cloning technology Nhe I and EcoR β-arrestin2 was inserted into the multiple cloning site between EcoR I and EcoR LgBiT-β-arrestin2 plasmid was obtained.

[0082] (2) Experimental process Human embryonic kidney cell line HEK293T cells were inoculated in a 24-well plate at a concentration of 0.5×10 5 Each well was co-transfected with 400 ng of FPR1-SmBiT plasmid and 200 ng of LgBiT-β-arrestin2 plasmid using Lipofectamine 3000. After 24 h, the cells were collected and resuspended in HBSS containing 20 mM HEPES (pH 7.4), and inoculated into a white 384-well plate. Coelenterazine h (final concentration 10 μM) was added, and incubated at 37 ℃ for 30 min. The baseline luminescence value was recorded on an EnVision plate reader, and then KR or fMLF was added, and the luminescence signal was continuously monitored for 30 min.

[0083] The results are as follows Figure 3As shown, the positive control (FPR1 agonist fMLF) can induce the recruitment of β-arrestin2, while KR cannot induce the recruitment of β-arrestin2. Combined with the results of Example 2, KR is a biased agonist of FPR1, which can biasedly activate the G protein signaling pathway and cannot activate the recruitment of β-arrestin2.

[0084] Example 4: Kinetin Riboside (KR) acts on formyl peptide receptor 1 (FPR1) to inhibit superoxide production. Differentiated human promyelocytic leukemia cell line HL60 (dHL60, highly expressing FPR1) was centrifuged and resuspended in HBSS buffer containing 0.5% v / v bovine serum albumin (BSA) at a density of 2 × 10⁻⁶ cells / mL. 6 Cells / mL. Cells were pretreated with HBSS (equal volume to KR) or KR solution (HBSS as solvent), with a KR concentration of 100 μM in the cell slurry, at 37 °C for 1 h. Horseradish peroxidase (HRP, final concentration 40 U / mL) and isoluminol (ISO, final concentration 100 μM) were then added, and the cells were incubated at 37 °C in the dark for 5 min. 200 μL of cell suspension was added to a white opaque 96-well plate, and the chemiluminescence (CL) baseline was measured using an Envision microplate reader at 37 °C. After recording the baseline, fMLF (final concentration 100 nM) was added to stimulate the cells, and the chemiluminescence signal was immediately measured for 5 min.

[0085] The results are as follows Figure 4 As shown, the control group was HBSS treatment without fMLF, the model group was HBSS treatment with fMLF, and the KR treatment group was KR treatment with fMLF. It can be seen that KR can inhibit the production of superoxide caused by fMLF.

[0086] Example 5: Kinetin Riboside (KR) inhibits degranulation by acting on formyl peptide receptor 1 (FPR1). RBL-FPR1 cells stably expressing formyl peptide receptor 1 (FPR1) were digested and centrifuged, then resuspended in HBSS-HB buffer (HBSS + 20 mM Hepes + 0.1% v / v bovine serum albumin) at a density of 2 × 10⁻⁶ cells / mL. 6Cells / mL. HBSS (equal volume to KR) or KR solution was added to 1.5 mL centrifuge tube containing 150 μL cell suspension, the concentration of KR in cell suspension was 100 μM, and incubated at 37 °C for 1 h. Then 10 μM (final concentration) Cytochalasin B was added to 150 μL cell suspension, and incubated at 37 °C for 15 min after 15 min incubation on ice. fMLF (final concentration 100 nM) was added to 1.5 mL centrifuge tube, and incubated at 37 °C for 15 min, then centrifuged at 300 x g for 5 min, and the supernatant A was transferred to 1.5 mL tube for storage. The cell pellet was lysed with 150 μL 0.1% v / v Triton X-100 for 10 min on a shaker. The lysate was diluted 4 times with HBSS-HB and transferred to 1.5 mL centrifuge tube. The lysate and supernatant A were centrifuged at 12000 x g for 1 min, respectively, to obtain supernatant B. 20 μL supernatant B was added to 96-well plate, and 10 μL 4-Nitrophenyl N-acetyl-β-D-glucosaminide solution (1 mM) was added, and incubated at 37 °C for 1 h in the dark. The reaction was terminated by adding 250 μL Na2CO3-NaHCO3 buffer (pH 10, 0.1 mol / L), and the absorbance was measured at 405 nm using FlexStation III (Molecular Devices). The formula for calculating degranulation was: % release = A 上清 / (A 上清 +A 细胞裂解液 *4)。

[0087] The results are shown in Figure 5 , wherein the control is HBSS treatment without fMLF, the model group is HBSS treatment with fMLF, and the KR treatment group is KR treatment with fMLF. It can be seen that KR can inhibit the degranulation caused by fMLF.

[0088] Example 6 LPS-induced acute lung injury in mice and administration Wild type C57BL / 6 male mice (8 weeks old, 20-25 g, purchased from Zhuhai Baitishun Biotechnology Co., Ltd.) were anesthetized and then 100 μL of lipopolysaccharide (LPS) was instilled into the trachea. The dose of LPS used was 2 mg / kg of mouse, which caused acute lung injury in mice. After 30 min, 100 μL of KR was injected intraperitoneally, and the injection dose of KR was 25 mg / kg of mouse. The mice were sacrificed and the lungs were removed after 12 hours and placed in liquid nitrogen for later use. This is the KR treatment group (or referred to as the KR treatment group). In addition, the same volume of normal saline as KR was injected intraperitoneally in wild type C57BL / 6 male mice to serve as the control group. Wild type C57BL / 6 male mice were anesthetized and then instilled with LPS into the trachea to serve as the model group (or referred to as the LPS modeling group).

[0089] Example 7 Inhibitory effect of kinetin riboside (KR) on serum myeloperoxidase (MPO) After weighing the mouse lung tissue, 0.6 mL of PBS solution containing 0.5% w / v cetyltrimethylammonium bromide (CTAB) was added, and the tissue grinder was used at a frequency of 60 Hz for 4 times, 2 min each time. Centrifugation at 13000 x g for 20 min at 4°C, 20 μL of supernatant was added to 180 μL of PBS solution containing 3,3',5,5'-tetramethylbenzidine (final concentration 1.8 mM) and H2O2 (final concentration 1.7 mM), and the absorbance was measured in real time at 655 nm for 5 min. Finally, the myeloperoxidase activity was normalized by the weight of the tissue.

[0090] As shown in Figure 6 , KR can inhibit the production of MPO.

[0091] Example 8 Mitigating effect of kinetin riboside (KR) on acute lung injury The lung tissue specimens of the control group, LPS modeling group and KR treatment group were fixed with 4% (w / v) paraformaldehyde solution for 24 hours, and then paraffin-embedded, with a slice thickness of 5 μm. The slices were stained with hematoxylin-eosin (H&E staining), and the pathological changes were observed under a light microscope.

[0092] As shown in Figure 7 , it can be seen that KR can reduce the infiltration of neutrophils in lung tissue and alleviate lung injury.

[0093] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A label-free screening method, characterized in that... Includes the following steps: (1) Prepare RBL-FPR1 cells that can stably express formyl peptide receptor 1; (2) RBL-FPR1 cells were seeded into cell culture plates and the baseline signal was observed using an Epic label-free screening instrument; after adding the compound to be tested, the potential active compound was obtained by observing the changes in cell signal. (3) RBL-FPR1 cells were seeded into cell culture plates, calcium ion indicator was added, and then the potential active compound obtained in step (2) was added. The calcium ion flow was detected to obtain the FPR1 agonists that were initially screened. The FPR1 agonists that were initially screened were detected by the NanoBiT-based G protein dissociation detection system and β-arrestin recruitment experiment. Compounds that could selectively activate G protein dissociation or β-arrestin recruitment were identified as FPR1 selective agonists. (4) RBL-FPR1 cells were seeded into cell culture plates, and the potential active compound obtained in step (2) was added and then a calcium ion indicator was added for incubation. Then a known FPR1 agonist was added, and the calcium ion flow was detected to obtain an FPR1 antagonist.

2. The label-free screening method according to claim 1, characterized in that: The RBL-FPR1 cells mentioned in step (1) are recombinant cell lines that express formyl peptide receptor 1; The cell culture plate mentioned in step (2) is a 384-well plate; The seeding amount of RBL-FPR1 cells in step (2) is 1.8 × 10⁻⁶. 3 ~7.2×10 3 Cells / well; The cell culture plate mentioned in step (3) is a 96-well plate; The seeding amount of RBL-FPR1 cells in step (3) is 1×10⁻⁶. 4 ~4×10 4 Cells / well; The cell culture plate mentioned in step (4) is a 96-well plate; The seeding amount of RBL-FPR1 cells in step (4) is 1×10⁻⁶. 4 ~4×10 4 Cells / well 3. The label-free screening method according to claim 1, characterized in that: The calcium ion indicator mentioned in step (3) is FLIPR Calcium 5 Reagent; The NanoBiT-based G protein dissociation detection system described in step (3) includes FPR1 plasmid, Gβ1 plasmid, SmBiT-Gγ2 (C68S) plasmid and Gαi1-LgBiT plasmid. The FPR1 plasmid is a recombinant eukaryotic expression vector that clones the FPR1 gene; The Gβ1 plasmid is a recombinant eukaryotic expression vector that clones the Gβ1 gene; The SmBiT-Gγ2(C68S) plasmid is a recombinant eukaryotic expression vector that clones the SmBiT gene and the Gγ2(C68S) gene linked to the SmBiT gene. The Gαi1-LgBiT plasmid is a recombinant eukaryotic expression vector that clones the LgBiT gene and the Gαi1 gene linked to the LgBiT gene. The β-arrestin recruitment experiment described in step (3) uses the FPR1-SmBiT plasmid and the LgBiT-β-arrestin2 plasmid; The FPR1-SmBiT plasmid is a plasmid that can express FPR1 and SmBiT; The LgBiT-β-arrestin2 plasmid is a plasmid that can express LgBiT and β-arrestin2; The calcium ion indicator mentioned in step (4) is FLIPR Calcium 5 Reagent; The known FPR1 agonist mentioned in step (4) is fMLF.

4. The label-free screening method according to claim 3, characterized in that: The steps for the NanoBiT-based G protein dissociation detection described in step (3) are as follows: FPR1 plasmid, Gβ1 plasmid, SmBiT-Gγ2 (C68S) plasmid and Gαi1-LgBiT plasmid are co-transfected into animal cells. After adding substrate, the cells are transferred to 384 wells for incubation. The baseline luminescence value is recorded using an EnVision plate reader. Then, the FPR1 agonist is added for initial screening, and the luminescence signal is continuously monitored. The steps of the β-arrestin recruitment experiment described in step (3) are as follows: FPR1-SmBiT plasmid and LgBiT-β-arrestin2 plasmid are co-transfected into animal cells. After adding substrate, the cells are transferred to 384 wells for incubation. Baseline luminescence values ​​are recorded using an EnVision plate reader. Then, the FPR1 agonist that was initially screened is added, and the luminescence signal is continuously monitored.

5. The label-free screening method according to claim 4, characterized in that: In the steps of the NanoBiT-based G protein dissociation detection described above: The animal cells mentioned are HeLa cells, HEK293 cells, or HEK293T cells; The substrates are coelenterin h or formazan; The concentration of the substrate in the cell sap is 10 μM; The incubation time is 50-70 minutes; The continuous monitoring time is 10-20 minutes; In the steps of the β-arrestin recruitment experiment described above: The animal cells mentioned are HeLa cells, HEK293 cells, or HEK293T cells; The substrates are coelenterin h or formazan; The concentration of the substrate in the cell sap is 10 μM; The incubation time is 20-30 minutes; The continuous monitoring time is 30-40 minutes.

6. The application of the label-free screening method according to any one of claims 1 to 5 in screening FPR1 ligands.

7. The application according to claim 6, characterized in that: The ligand is an agonist, antagonist, or allosteric modulator.

8. Application of kinetin nucleoside in the preparation of FPR1 biased agonists.

9. Use of kinetin nucleoside in the preparation of drugs for the prevention and / or treatment of acute lung injury.

10. The application according to claim 9, characterized in that: The dosage form of the drug is oral, injectable, or nebulized.

Citation Information

Patent Citations

  • Hair composition

    CN107106628A

  • Cell screening model of unmarked cell membrane receptor GPR88 and application thereof

    CN113005089A

  • Cell screening model of unmarked membrane receptor GPR84 and application of cell screening model

    CN114107210A

  • Agents which regulate, inhibit, or modulate the activity and / or expression of formyl peptide receptors as a unique means to both lower intraocular pressure and treat glaucomatous retinopathies / optic neuropathies

    US20060134171A1

  • Method for determining the binding of a given compound to a membrane receptor

    US20120190048A1