Use of anti-CD3 antibodies in selective clearance of activated T cells
By using monovalent antibodies or their antigen-binding fragments to specifically bind to the heavy chain and light chain variable regions of CD3, the problem of overall reduction and inflammatory response when existing antibodies clear T cells is solved. This achieves selective clearance of activated T cells, reduces the risk of inflammation, and preserves inactive T cells, making it suitable for the treatment of related diseases.
Patent Information
- Application Number
- CN202480047992.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-19
- Filing Date
- 2024-05-20
- Publication Date
- 2026-02-13
AI Technical Summary
Existing antibodies tend to reduce the overall number of T cells when they clear T cells, increasing the risk of infection and potentially triggering strong inflammatory responses, such as cytokine release syndrome. They are also difficult to effectively clear activated T cells without affecting inactive T cells.
Monovalent antibodies or their antigen-binding fragments are used to specifically bind to the heavy chain and light chain variable regions of CD3, selectively eliminating activated T cells and inhibiting T cell immune responses.
It effectively eliminates activated T cells, reduces the risk of inflammatory response, and preserves the pool of unactivated T cells. It is suitable for the treatment of autoimmune diseases, graft-versus-host disease, and organ transplant rejection, reducing the mortality rate of graft-versus-host disease and the severity of organ transplant rejection.
Smart Images

Figure CN121532428A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the use of a monovalent antibody or its antigen-binding fragment comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3 in the selective scavenging of activated T cells. The monovalent anti-CD3 antibody or its antigen-binding fragment according to the invention can be effectively used as a T cell scavenger and a T cell immunosuppressant. Background Technology
[0002] T cells play a crucial role in antigen-specific immune responses. When pathogens invade the body, they mediate specific immune responses against the pathogen's antigens, thus protecting the body from infection. However, when T cell responses are over-induced, they can trigger excessive inflammation, potentially leading to inflammatory diseases. As a representative example, an excessive T cell response to self-antigens can induce autoimmune diseases. In organ transplantation, the T cell response to the graft can lead to transplant rejection and failure. Furthermore, in anti-tumor allogeneic T cell therapy for cancer treatment, these donor T cells attack the patient's normal tissues, potentially inducing graft-versus-host disease (GVHD) and triggering inflammation.
[0003] In response, continuous efforts have been made to develop T-cell-specific antibodies to eliminate T cells and thus suppress T-cell-mediated inflammatory responses. For example, antibodies such as anti-CD3 antibodies, anti-thymocyte globulin (ATG), and anti-CD52 antibodies have been developed for T-cell elimination, with ATG and anti-CD52 antibodies currently commercially available. However, these antibodies are known to have the following problems: inducing a reduction in overall T cells, thereby increasing the risk of infection. In particular, T-cell elimination antibodies in their intact IgG form can induce excessive T-cell activation before eliminating T cells, thus increasing the risk of severe inflammatory responses such as cytokine release syndrome.
[0004] Therefore, compared to a strategy of completely eliminating T cells, it is necessary to develop a new strategy: to temporarily eliminate only those activated T cells (effector T cells) that immediately induce inflammation, so as to minimize the risk of cytokine release syndrome and thus retain a sufficient T cell reservoir to deal with infection.
[0005] In response, the inventors constructed anti-CD3 antibodies in various forms and ultimately confirmed that monovalent antibodies, particularly single-chain variable fragment (scFv) anti-CD3 antibodies, can selectively eliminate activated T cells with relatively little impact on unactivated T cells, thus completing the present invention. Summary of the Invention
[0006] The problem the invention aims to solve The present invention aims to provide a pharmaceutical composition for the prevention or treatment of T-cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection, wherein the pharmaceutical composition comprises a monovalent antibody or an antigen-binding fragment thereof, the monovalent antibody or the antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0007] Furthermore, the present invention aims to provide a pharmaceutical composition for inhibiting T-cell immunity or eliminating activated T-cells, wherein the pharmaceutical composition comprises a monovalent antibody or an antigen-binding fragment thereof, the monovalent antibody or the antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0008] The present invention aims to provide a method for suppressing T-cell immunity, comprising the steps of administering a monovalent antibody or an antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0009] The present invention aims to provide a method for eliminating T cell receptor (TCR) positive CAR-T cells, comprising: (a) downregulating T cell receptor (TCR) expression in T cells; (b) introducing a chimeric antigen receptor (CAR) into T cells; and (c) treating the cells obtained in steps (a) and (b) with a monovalent antibody or an antigen-binding fragment thereof, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, and steps (a) and (b) are performed sequentially.
[0010] The present invention aims to provide a monovalent antibody or its antigen-binding fragment thereof, wherein the monovalent antibody or its antigen-binding fragment comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0011] The present invention aims to provide a polynucleotide encoding the above-mentioned monovalent antibody or its antigen-binding fragment, an expression vector including the polynucleotide, and a cell including the above-mentioned polynucleotide or an expression vector including the polynucleotide.
[0012] means for solving problems One aspect of the present invention provides a pharmaceutical composition comprising a monovalent antibody or an antigen-binding fragment thereof, for the prevention or treatment of T-cell-mediated autoimmune diseases, graft-versus-host disease, or organ transplant rejection, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0013] In this specification, the term "antibody" refers to an antibody that specifically binds to a particular antigen, including not only the complete antibody morphology but also the antigen-binding fragment of the antibody molecule. A complete antibody has a structure consisting of two full-length light chains and two full-length heavy chains, with each light chain linked to the heavy chain by disulfide bonds. The constant regions of the heavy chain have γ, μ, α, δ, and ε types, with subclasses including γ1, γ2, γ3, γ4, α1, and α2. The constant regions of the light chains have κ and λ types.
[0014] In this specification, the term "antigen-binding fragment" refers to a fragment that retains antigen-binding function, including Fab, F (ab'), Fv, scFv, or single-domain antibody (sdAB), etc. In antibody fragments, Fab (fragment antigen binding) includes variable regions of the light and heavy chains, an invariant region of the light chain, and a first invariant region (CH1) of the heavy chain, possessing one antigen-binding site. The difference between Fab' and Fab is that Fab' includes a hinge region at the C-terminus of the CH1 domain of the heavy chain, the hinge region comprising one or more cysteine residues. Fv is the smallest antibody fragment containing only the variable regions of the heavy and light chains. Recombinant techniques for generating Fv fragments have been disclosed in PCT international patent applications WO88 / 10649, WO88 / 106630, WO88 / 07085, WO88 / 07086, and WO88 / 09344.
[0015] In this specification, the term "heavy chain" refers to the total long heavy chain and fragments thereof comprising the variable region domain VH and three invariant region domains CH1, CH2, and CH3 of the antibody, wherein the variable region domain VH of the antibody comprises an amino acid sequence of sufficient variable region sequence required to confer antigen specificity. Furthermore, in this specification, the term "light chain" refers to the total long light chain and fragments thereof comprising the variable region domain VL and invariant region domain CL of the antibody, wherein the variable region domain VL of the antibody comprises an amino acid sequence of sufficient variable region sequence required to confer antigen specificity.
[0016] In this specification, the term "complementarity determining region (CDR)" refers to the amino acid sequence of the hypervariable region of the immunoglobulin heavy and light chains. The heavy chains HCDR1, HCDR2, and HCDR3, and the light chains LCDR1, LCDR2, and LCDR3 each comprise three CDRs. A CDR provides a key contact residue for antibody binding to an antigen or antigenic epitope.
[0017] The aforementioned antibodies that specifically bind to CD3 are antibodies that bind to the CD3 molecule on the surface of T cells. These antibodies can be any of monoclonal, polyclonal, or recombinant antibodies. Furthermore, the antibodies can be full-length antibodies or antibody fragments. In this case, the antibody fragment may include a portion of an anti-CD3 antibody capable of binding to CD3. The antibody fragment can be Fab, Fab', Fv, scFv, or a single-domain antibody (sdAB).
[0018] In this invention, the antibody or antigen-binding fragment that specifically binds to CD3 can be a monovalent antibody. Specifically, the monovalent antibody can be Fab, Fab', Fv, scFv, or a single-domain antibody (sdAB).
[0019] Specifically, the scFv in the aforementioned antibody fragment can be in the following order from its N-terminus to its C-terminus: the light chain variable region, the linker peptide, and the heavy chain variable region of the fragment specifically binding to CD3; or, the heavy chain variable region, the linker peptide, and the light chain variable region of the fragment specifically binding to CD3. Furthermore, the Fab in the aforementioned antibody fragment can be in the form of a molecule comprising the light chain variable region and the light chain invariant region of an antibody specifically binding to CD3, combined with a molecule comprising the heavy chain variable region and the heavy chain invariant region of an antibody specifically binding to CD3.
[0020] The aforementioned monovalent antibodies that specifically bind to CD3, or their binding fragments, may include the complementarity determining region (CDR) of the heavy chain variable region and / or light chain variable region selected from any of the known anti-CD3 antibodies OKT3, UCHT1, teplizumab, octilizumab, visilizumab, and foralumab. Specifically, this may include CDR1, CDR2, or CDR3. The aforementioned known anti-CD3 antibodies are merely examples and are not limited thereto; the aforementioned antibodies or their binding fragments may include combinations of the respective CDR1, CDR2, or CDR3 of known anti-CD3 antibodies.
[0021] The aforementioned monovalent antibody or its binding fragment that specifically binds to CD3 may include: a light chain variable region comprising light chain CDR1 (LCDR1), light chain CDR2 (LCDR2), and light chain CDR3 (LCDR3), represented by the amino acid sequences of SEQ ID NO: 23 to 25, respectively; or a heavy chain variable region comprising heavy chain CDR1 (HCDR1), heavy chain CDR2 (HCDR2), and heavy chain CDR3 (HCDR3), represented by the amino acid sequences of SEQ ID NO: 26 to 28, respectively. Furthermore, it may include a light chain variable region comprising the amino acid sequence of SEQ ID NO: 29 and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30. In one embodiment of the present invention, a linker peptide may be included between the light chain variable region comprising the amino acid sequence of SEQ ID NO: 29 and the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30. The linker peptide may have the amino acid sequence of SEQ ID NO: 1 ((G4S)3 linker peptide), but the type of linker peptide is not limited thereto.
[0022] The aforementioned monovalent antibody or its binding fragment that specifically binds to CD3 may include: a light chain variable region comprising LCDR1, LCDR2, and LCDR3 represented by the amino acid sequences of SEQ ID NO: 32 to 34, respectively; or a heavy chain variable region comprising HCDR1, HCDR2, and HCDR3 represented by the amino acid sequences of SEQ ID NO: 35 to 37, respectively. Furthermore, it may include a light chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 39.
[0023] In one embodiment of the present invention, the aforementioned monovalent anti-CD3 antibody or its binding fragment may be an scFv fragment comprising the amino acid sequences of SEQ ID NO: 13, 22, 31, and 40, or a Fab fragment comprising the amino acid sequences of SEQ ID NO: 41 and 42. Furthermore, the aforementioned anti-CD3 antibody or its binding fragment may comprise the amino acid sequences of SEQ ID NO: 13, 22, 31, 40, 41, and 42, a portion thereof, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity with them.
[0024] The aforementioned monovalent anti-CD3 antibody or its binding fragment may further include a sequence of the immunoglobulin kappa (κ) chain. The aforementioned immunoglobulin kappa (κ) chain sequence may include the amino acid sequence of SEQ ID NO: 2, a portion thereof, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity with it. Additionally, the aforementioned monovalent anti-CD3 antibody or its binding fragment may also include a tag sequence. The aforementioned tag may include, but is not limited to, the amino acid sequence of SEQ ID NO: 3 or 4.
[0025] Even though this invention describes a "gene sequence / amino acid sequence containing a specific sequence number" or "gene sequence / amino acid sequence having a specific sequence number," it is clear that any gene sequence / amino acid sequence that has the same or corresponding function as the gene sequence / amino acid sequence composed of that sequence number can be used in this invention, even if some sequences are missing, modified, substituted, or added. Furthermore, in this invention, gene sequences and base sequences can be used interchangeably.
[0026] For example, it is obvious that as long as it has the same or corresponding function as the monovalent anti-CD3 antibody or its binding fragment, adding meaningless sequences to the sequence or end of the sequence number, or partially deleting sequences from the sequence or end of the sequence number, is also within the scope of this invention.
[0027] Homology and identity refer to the degree of correlation between two given base sequences, and can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.
[0028] Whether any two sequences are homologous or identical can be determined using default parameters (e.g., Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444) and by well-known computer algorithms (such as the “FASTA” program). Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) can be used in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) to determine (including the GCG package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); *Guide to Huge Computers*, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994 and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073. For example, BLAST or ClustalW from the National Center for Biotechnology Information database can be used to determine sequence homology or identity.
[0029] The aforementioned CD3-specific antibodies or their binding fragments may include a portion of a bispecific antibody. Specifically, in the binding sites of the bispecific antibody against two different antigens, one antigen-binding site may include a site capable of recognizing and binding to CD3. Specifically, the aforementioned CD3-specific antibodies may be selected from teratolimab, tebentafusp, blinatumomab, catuxomab, TNB-486, AMG562, duvortuxizumab, AMG910, pertuxizumab, HPN424, and AMG160. JNJ-63898081, CC-1, AMG509, HPN536, odronextamab, epcoritamab, glofitamab, mosunetuzumab, JNJ-75348780, vixtimotamab, AMG330, REGN4018, AMG199, MGD007, EGFR BAT, AMG596, M701, Solitomab, MT110, AMG110, AMG211, MEDI-565, Cibisatamab, Tidutamab, Talquetamab, RG6194, GBR1302, M802, Runimotamab, GEN1044, GEN1047, PF-07062119, AMG757, BI764532, HPN328 The following are examples of CD3-binding antibodies: Hu3F8-BsAb, GEM3PSCA, IMC-C103C, IMC-F106C, JNJ-70218902, AMG424, Elranatamab, ABBV-383, AMG420, CC-93269, Linvoseltamab, Alnuctamab, Cevostamab, and AMG427, wherein the heavy chain variable region and / or light chain variable region of the antibody can be used to target CD3. The above-mentioned types of bispecific antibodies are merely examples and are not limited to; any bispecific antibody including more than one site capable of binding to CD3 is permitted.
[0030] The present invention comprises a monovalent antibody or antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, which can induce the death of activated T cells and inhibit alloreactive immune responses.
[0031] Allogeneic reactive immune responses can be divided into two types: one is the reaction in which donor T cells attack the recipient's normal tissues when donor T cells are administered to the recipient (graft-versus-host reaction); the other is the reaction in which recipient T cells attack donor organs or cells when donor organs or cells are transplanted into the recipient (graft rejection). Since both of these reactions are T cell attack responses resulting from the activation of donor or recipient T cells, the monovalent antibody or its antigen-binding fragment comprising the heavy chain variable region and light chain variable region of an antibody specifically binding to CD3 in this invention can selectively kill activated T cells, thereby inhibiting these allogeneic reactive immune responses.
[0032] The aforementioned T-cell-mediated immune diseases may include T-cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection.
[0033] In this specification, the term "autoimmune disease" refers to a disease resulting from an immune response, which is the result of an inappropriate and excessive response to self-antigens. The aforementioned autoimmune diseases can be selected from, including, rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus, type 1 diabetes, Crohn's disease, scleroderma, Sjogren's syndrome, psoriasis, inflammatory bowel disease, ulcerative colitis, ankylosing spondylitis, interstitial lung disease, uveitis, optic neuritis, peripheral neuropathies, sarcoidosis, antiphospholipid syndrome, inflammatory myopathies, and Behcet's disease. The diseases included in, but not limited to, the following groups: alopecia totalis / universalis, pemphigus vulgaris, myasthenia gravis, Graves' disease, Hashimoto's thyroiditis, Guillain-Barré syndrome, celiac disease, and pernicious anemia.More specifically, T-cell-mediated autoimmune diseases can be selected from, but are not limited to, diseases including, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, multiple sclerosis, lupus nephritis, psoriasis (pSS), focal and segmental glomerulosclerosis, and immune thrombocytopenia.
[0034] In this specification, the term "graft-versus-host disease (GVHD)" refers to a disease in which donor T cells injected into the peripheral blood or bone marrow during allogeneic hematopoietic stem cell transplantation in patients with hematologic malignancies recognize the recipient's normal tissues as targets for attack, triggering an immune response. It is known that donor T cells, in addition to directly attacking cells through cytolysis, can also trigger an excessive immune response throughout the body by secreting pro-inflammatory and fibrotic cytokines or promoting the production of autoantibodies. This type of GVHD is not only seen in allogeneic hematopoietic stem cell transplantation but also includes GVHD caused by TCR-positive CAR-T cells during allogeneic CAR-T cell therapy as described in the embodiments of this invention.
[0035] In this specification, the term "organ transplant rejection" refers to a disease in which alloreactive T cells of the recipient, which recognize the organ transplant graft as a target, are activated and attack the transplant graft, resulting in necrosis of the transplanted graft.
[0036] It has been confirmed in this invention that monovalent anti-CD3 antibodies not only in vitro ( in vitro ), in the body ( in vivoIt can also eliminate activated T cells, suggesting that monovalent anti-CD3 antibodies hold promise as therapeutic agents for T-cell-mediated inflammatory autoimmune diseases caused by activated T cells. This can be easily predicted from existing commercially available T-cell scavenging or suppressing antibodies (such as alemtuzumab (anti-CD52 antibody) and daclizumab (anti-CD25 antibody)) indicated for autoimmune diseases such as multiple sclerosis.
[0037] Furthermore, recently, anti-CD3 antibodies (teplizumab) have also begun to be marketed in the United States with FDA approval for the indication of autoimmune diabetes (type 1 diabetes). Therefore, the monovalent anti-CD3 antibody according to the present invention can be developed as an autoimmune inhibitor for T-cell clearance and inactivation. However, anti-CD3 antibodies in the form of bivalent intact IgG antibodies (intact IgG), such as teplizumab, are structurally different from the monovalent anti-CD3 antibody of the present invention. Since the monovalent anti-CD3 antibody exhibits a more significant T-cell killing ability than the bivalent intact IgG antibody, the monovalent anti-CD3 antibody also differs functionally from the bivalent intact IgG antibody.
[0038] Although the inhibitory effect of anti-CD3 antibodies on autoimmune diseases is difficult to achieve in experimental animal models, their ability to inhibit human T cell-mediated inflammatory diseases can be determined by their inhibitory effect on xenograft-versus-host disease induced by administration of human T cells to immunodeficient mice. In this invention, the severity of human T cell-induced xenograft-versus-host disease was evaluated in an immunodeficient mouse model. The results confirmed that treatment with monovalent anti-CD3 antibodies significantly reduced weight loss, clinical symptoms, and mortality caused by xenograft-versus-host disease in the antibody-treated group. Figure 19 Therefore, monovalent anti-CD3 antibodies can significantly inhibit T-cell-induced inflammatory diseases, and thus have great potential for development as therapeutic agents for autoimmune diseases with similar T-cell-mediated inflammatory diseases. Additionally, as a disease similar to graft-versus-host disease in the aforementioned model, it can also be used to treat allogeneic GVHD, which is induced by donor T cells after allogeneic hematopoietic stem cell transplantation for the treatment of hematologic malignancies.
[0039] Furthermore, monovalent anti-CD3 antibodies or their antigen-binding fragments can be used as therapeutic agents to suppress organ rejection induced by recipient T cells after organ transplantation. In this invention, skin from an allogenic strain of C57BL6 mice was transplanted into immunodeficient NSG mice, and activated human T cells were administered, thereby inducing an immune rejection response that inhibits the survival of the transplanted skin due to T cells. At this time, in the group that only human T cells were administered, a transplant rejection response with most of the transplanted skin tissue sloughing off was observed, while in the group that simultaneously administered monovalent anti-CD3 antibodies, a significant improvement in skin survival was confirmed. Figure 20 Therefore, monovalent anti-CD3 antibodies would be very useful as inhibitors of immune rejection during organ transplantation.
[0040] Therefore, the monovalent anti-CD3 antibody or its antigen-binding fragment according to the present invention can be used as a therapeutic agent for T-cell-mediated inflammatory diseases such as autoimmune diseases, graft-versus-host disease, and organ transplant rejection.
[0041] The above-mentioned pharmaceutical composition may also include an immunosuppressant, or may be used in combination with an immunosuppressant. The above-mentioned combination may refer to the simultaneous, sequential, or separate administration of the above-mentioned monovalent anti-CD3 antibody or its antigen-binding fragment and an immunosuppressant in any order.
[0042] Furthermore, another aspect of the present invention provides a pharmaceutical composition for inhibiting T-cell immunity or eliminating activated T cells, wherein the pharmaceutical composition comprises a monovalent antibody or an antigen-binding fragment thereof, the monovalent antibody or the antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0043] In the above-mentioned pharmaceutical compositions, the terms "antibody", "antigen-binding fragment", or "antibody or antigen-binding fragment that specifically binds to CD3" have the meanings described above.
[0044] The aforementioned monovalent antibodies or antigen-binding fragments that specifically bind to CD3 can induce the death of activated T cells. This death includes T cell apoptosis. In one embodiment of the invention, T cell death may be induced only by the monovalent antibody or antigen-binding fragment, unlike the intact IgG form of the same antibody. Furthermore, the aforementioned monovalent antibodies or antigen-binding fragments that specifically bind to CD3 may not exhibit death-inducing activity in unactivated T cells (specifically, naïve T cells). Specifically, the monovalent antibodies or antigen-binding fragments that specifically bind to CD3 can induce apoptosis by upregulating the dephosphorylation of NFATc2 in activated T cells. In other words, it may induce death through the calcium-NFAT pathway in T cell TCR / CD3 signaling. In other words, the aforementioned monovalent antibodies or antigen-binding fragments can be used to suppress T cell immunity or eliminate activated T cells.
[0045] Another aspect of the present invention provides a method for suppressing T-cell immunity, comprising the step of administering a monovalent antibody or an antigen-binding fragment thereof comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
[0046] Furthermore, the present invention provides a method for eliminating TCR-positive CAR-T cells during the preparation of CAR-T cells for allogeneic CAR-T cell therapy, the method comprising: (a) downregulating the expression of T cell receptor (TCR) in T cells; (b) introducing a chimeric antigen receptor (CAR) into T cells; and (c) treating the cells obtained in steps (a) and (b) with a monovalent antibody or an antigen-binding fragment thereof, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, and steps (a) and (b) are performed sequentially.
[0047] According to one embodiment of the present invention, before performing the above steps (a) or (b), a step of activating T cells may be included. This is because, in order to downregulate TCR expression on T cells or to introduce chimeric antigen receptors, it is necessary to first activate the target T cells.
[0048] More specifically, steps (a) and (b) above can be performed regardless of timing or sequence. Specifically, after the expression of the T cell receptor in the T cells of step (a) is downregulated, the step of introducing the chimeric antigen receptor into the T cells in step (b) can be performed. However, after the introduction of the chimeric antigen receptor in step (b), the expression of the T cell receptor in the T cells of step (a) may be downregulated. In other words, the present invention provides a method in which step (c), i.e., treatment with a monovalent antibody or its antigen-binding fragment comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, is performed after steps (a) and (b) are performed regardless of sequence.
[0049] According to one embodiment of the present invention, in allogeneic CAR-T cell therapy, after preparing CAR-T cells by expressing CAR on donor T cells, when these CAR-T cells are injected into the recipient, the T cell receptor (TCR) of the donor T cells recognizes the recipient's normal cells as antigens and attacks the normal cells, resulting in a side effect of graft-versus-host disease (GVHD). To minimize this side effect, the preparation of CAR-T cells for allogeneic CAR-T cell therapy includes a process of depleting the donor T cells' TCR (specifically, step (a) above). At this time, despite the experimental use of methods to downregulate TCR expression, residual TCR-positive CAR-T cells remain, which may trigger an inflammatory response in the recipient, i.e., GVHD. This can be addressed by step (c) of the present invention, i.e., treatment with a monovalent antibody or its antigen-binding fragment comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, to deplete the residual TCR-positive CAR-T cells. More specifically, CAR-T cells that effectively eliminate residual TCR-positive CAR-T cells can be prepared through the above step (c).
[0050] The steps described above for downregulating TCR expression can be performed using gene editing technology, or by selecting nucleic acids from the group consisting of antisense RNA, antisense oligonucleotide RNA, siRNA, shRNA, and miRNA. The gene editing technology includes the CRISPR system (specifically CRISPR / Cas9), TALEN, zinc finger nuclease, base editing, and prime editing.
[0051] In this specification, the term "disease" may refer to a pathological condition, including, in particular, cancer, infectious diseases, inflammatory diseases, degenerative diseases, apoptosis-related diseases, and graft rejection.
[0052] In this specification, the term "prevention" may refer to preventive or protective treatment of a disease or disease state; the term "treatment" may refer to or include alleviating, inhibiting the progression of or preventing a disease, disorder or pathological state, or one or more of its symptoms; and the terms "active ingredient" or "pharmaceuticalally effective amount" may refer to any amount of composition used in the practice of this invention that is sufficient to alleviate, inhibit the progression of or prevent a disease, disorder or pathological state, or one or more of its symptoms.
[0053] In this specification, the terms "administration," "introduction," and "transplantation" are used interchangeably and can refer to the method or approach of distributing the composition at a desired location within an individual by at least partially localizing the composition of a particular embodiment. According to one embodiment, the composition can be administered via any suitable route for delivering at least a portion of cells or cellular components to a desired location within a living individual. Following administration, the survival period of the cells within the individual can be as short as several hours, e.g., 24 hours to several days, or as long as several years.
[0054] The compositions of the present invention may also contain pharmaceutically acceptable carriers. For oral administration, binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, and fragrances may be used; for injection, buffers, preservatives, analgesics, solubilizers, isotonic agents, and stabilizers may be mixed in; for topical administration, matrices, excipients, lubricants, and preservatives may be used. The dosage forms of the pharmaceutical compositions of the present invention can be prepared by mixing them with the aforementioned pharmaceutically acceptable carriers in various ways. For example, for oral administration, they can be prepared as tablets, lozenges, capsules, elixirs, suspensions, syrups, rice paper, etc.; for injection, they can be prepared as single-dose ampoules or multi-dose formulations. Furthermore, the anticancer compositions typically contain surfactants that facilitate transmembrane transport. These surfactants include surfactants derived from steroids, or cationic lipids such as N-[1-(2,3-dioleoyl)propyl-N,N,N-trimethylammonium chloride (DOTMA), or various compounds such as cholesterol hemisuccinate and phosphatidylglycerol.
[0055] The pharmaceutical compositions of the present invention can be administered orally or non-orally, for example by intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, intraperitoneal injection, intrasternal injection, intratumoral injection, local administration, intranasal administration, intracerebral administration, intracranial administration, intrapulmonary administration, and rectal administration, but are not limited thereto.
[0056] The appropriate dosage of the pharmaceutical composition of the present invention can vary depending on factors such as the formulation method, route of administration, patient's age, weight, sex, pathological state, diet, administration time, route of administration, excretion rate, and response sensitivity. Generally, a skilled physician can easily determine and prescribe a dosage effective for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition is 0.0001~100 mg / kg. In this specification, the term "pharmacologically effective amount" refers to an amount sufficient to prevent or treat the aforementioned diseases.
[0057] Another aspect of the present invention provides a method for preventing or treating diseases (e.g., T-cell-mediated autoimmune diseases, graft-versus-host diseases, or organ transplant rejection), the method comprising the step of administering to an individual in need a monovalent antibody comprising a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, or an antigen-binding fragment thereof, or a composition comprising the thereof.
[0058] Furthermore, another aspect of the present invention provides an antibody or an antigen-binding fragment thereof, the antibody comprising: a light chain variable region comprising LCDR1 of SEQ ID NO: 23, LCDR2 of SEQ ID NO: 24, and LCDR3 of SEQ ID NO: 25, and a heavy chain variable region comprising HCDR1 of SEQ ID NO: 26, HCDR2 of SEQ ID NO: 27, and HCDR3 of SEQ ID NO: 28; or comprising a light chain variable region comprising LCDR1 of SEQ ID NO: 32, LCDR2 of SEQ ID NO: 33, and LCDR3 of SEQ ID NO: 34, and a heavy chain variable region comprising HCDR1 of SEQ ID NO: 35, HCDR2 of SEQ ID NO: 36, and HCDR3 of SEQ ID NO: 37.
[0059] The terms "antibody" and "antigen-binding fragment" mentioned above are as described previously.
[0060] The antibodies or their antigen-binding fragments mentioned above can be antibodies or their antigen-binding fragments that specifically bind to CD3.
[0061] The antibody or its antigen-binding fragment may include: a light chain variable region comprising the amino acid sequence of SEQ ID NO: 29 or 38 and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30 or 39.
[0062] Specifically, the antibody or its antigen-binding fragment may include a light chain variable region comprising the amino acid sequence of SEQ ID NO: 29 and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30. Furthermore, the antibody or its antigen-binding fragment may include a light chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 39.
[0063] Another aspect of the present invention provides a polynucleotide encoding the above-mentioned antibody or its antigen-binding fragment.
[0064] The polynucleotides encoding the antibodies of this invention can be easily isolated and sequenced using conventional procedures. As an example, oligonucleotide primers designed to specifically amplify the corresponding heavy and light chain coding regions from phage template DNA can be used. After isolation, the polynucleotides can be inserted into an expression vector, which is then introduced into a suitable host cell to produce the desired monoclonal antibody from the transfected host cell (i.e., the transfectant).
[0065] Furthermore, another aspect of the present invention provides an expression vector comprising the aforementioned polynucleotides.
[0066] The expression vector described above can be an adenovirus vector, a retrovirus vector, a lentivirus vector, or an adeno-associated virus vector. In one embodiment of the present invention, the expression vector can be a retrovirus vector. The expression vector can be constructed by those skilled in the art to enable the expression and secretion of the anti-CD3 monovalent antibody according to the present invention. The expression vector may also include a signal sequence or a leader sequence. In one embodiment of the present invention, the leader sequence may include, but is not limited to, the sequences METDTLLLWVLLLWVPGSTGDV or MERHWIFLLLLSVTAGVHS. Additionally, the expression vector may also include a restriction enzyme cleavage site sequence. Specifically, the restriction enzyme cleavage site sequence may include, but is not limited to, sequences AQAA, GQAGQ, or KL.
[0067] Furthermore, the present invention provides a cell comprising the above-mentioned polynucleotides or an expression vector comprising the above-mentioned polynucleotides.
[0068] The cells described above may be virally transduced cells, wherein the virus comprises a polynucleotide capable of expressing an antibody or binding fragment thereof that specifically binds to CD3 according to the present invention. The transduced cells may secrete an antibody or binding fragment thereof that specifically binds to the cell's CD3.
[0069] The aforementioned virus may include a nucleic acid molecule encoding an antibody or its binding fragment that specifically binds to CD3 according to the present invention in its genome. Therefore, the aforementioned virus-transduced cells may express anti-CD3 antibodies or fragments thereof on their surface. The aforementioned virus may be an adenovirus, retrovirus, lentivirus, or adeno-associated virus. In one embodiment of the present invention, the aforementioned virus may be a retrovirus. The aforementioned virus can be obtained by co-transfecting the aforementioned expression vector with an expression vector comprising a nucleic acid molecule encoding a viral envelope protein into cells. In this case, transfection can be performed using conventional methods. During transfection, the available envelope proteins can be VSV-G, ecotropic envelope, Mokola, Rabies, MLV-Ampho, MLV-10A1, LCMV-WE, LCMV-Arm53b envelope, feline endogenous gamma retrovirus RD114 envelope and its variants, gibbon ape leukemia virus (GALV) envelope and its variants, MLV 4070A envelope, or gp120 / gp41 (Mol. Ther. Methods Clin. Dev., 2016(3):16017; J. Virol. Methods, 2004:122-131; Molecular Therapy-Methods & Clinical Development 2016(3):16017).
[0070] Invention Effects The monovalent anti-CD3 antibody or its antigen-binding fragment according to one aspect of the invention can selectively eliminate activated T cells with relatively little effect on unactivated T cells, and is therefore useful as a T cell scavenger or T cell immunosuppressant, for example, for the prevention or treatment of T cell-mediated autoimmune diseases, graft-versus-host disease, or organ transplant rejection. Furthermore, it can completely eliminate residual donor CD3-positive T cells that may be problematic in allogeneic CAR-T cell therapy, a promising anti-cancer T cell therapy, and is therefore effective in preventing or alleviating the side effects of graft-versus-host disease (GVHD) caused by the administration of allogeneic CAR-T cells. Attached Figure Description
[0071] Figure 1This is a chart showing the effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on cell death in activated T cells.
[0072] Figure 2 This is a graph showing the apoptosis-inducing effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on activated T cells.
[0073] Figure 3 This is a chart showing the effects of anti-CD3 UCHT1IgG, scFv antibody, and anti-CD3 1-4-2 and 1-4-7 scFv antibody on cell death in activated T cells.
[0074] Figure 4 This is a graph showing the effects of anti-CD3 OKT3 IgG, Fab, and scFv antibodies on cell death in unactivated T cells.
[0075] Figure 5 These are images obtained by analyzing the apoptosis-inducing mechanism of anti-CD3 scFv using Western blotting.
[0076] Figure 6 Images show the apoptosis-inducing mechanism of anti-CD3 scFv analyzed by signal inhibitors and flow cytometry (Veh: drug carrier; CsA: cyclosporin A; Dasa: dasatinib).
[0077] Figure 7 This is a graph showing the analysis of residual TCR-positive cells after TCRs were cleared via CRISPR / Cas9 in the preparation of allogeneic CAR-T cells.
[0078] Figure 8 This is a graph analyzing residual TCR-positive cells after TCRs were cleared using CRISPR / Cas9 and magnetically activated cell sorting (MACS) to prepare allogeneic CAR-T cells.
[0079] Figure 9 This is a graph showing the analysis of residual TCR-positive cells after TCR was cleared using CRISPR / Cas9 and anti-CD3 OKT3 scFv in preparation of allogeneic CAR-T cells.
[0080] Figure 10 This is a graph analyzing allogeneic CAR-T cells prepared via CRISPR / Cas9 and anti-CD3 OKT3 scFv (Ab: CD3 OKT3 scFv).
[0081] Figure 11 This chart analyzes the tumor-killing ability and cytokine secretion ability of allogeneic CAR-T cells prepared by CRISPR / Cas9 and anti-CD3 OKT3 scFv (Del Ab T cells: TCR-cleared + anti-CD3 OKT3 scFv T cells, Conv CAR-T: conventional CAR-T, Del Ab CAR-T: TCR-cleared CAR-T + anti-CD3 OKT3 scFv).
[0082] Figure 12 Images showing the anticancer effects of TCR-cleared CAR-T cells and / or anti-CD3 OKT3 scFv (Conv CAR-T: Conventional CAR-T, Del CAR-T: TCR-cleared CAR-T, Del Ab CAR-T: TCR-cleared CAR-T + anti-CD3 OKT3 scFv).
[0083] Figure 13 This is a graph showing the preventive or ameliorative effects of TCR-cleared CAR-T cells and / or anti-CD3 OKT3 scFv on graft-versus-host disease side effects and mouse survival rates (Conv CAR-T: conventional CAR-T, Del CAR-T: TCR-cleared CAR-T, Del Ab CAR-T: TCR-cleared CAR-T + anti-CD3 OKT3 scFv).
[0084] Figure 14 This is a graph showing the reduction in the total number of T cells after treatment with anti-CD3 OKT3 scFv.
[0085] Figure 15 This is a graph showing the changes in the number of CD4 and CD8 T embryonic fibroblast populations after treatment with anti-CD3 OKT3 scFv using flow cytometry (EF / EM: effector T cell / effector memory T cell, N / SCM: naive / stem cell memory T cell, CM: central memory T cell).
[0086] Figure 16This is a chart analyzing the changes in the distribution of CD4 and CD8 T embryonic fibroblast populations after treatment with anti-CD3 OKT3 scFv (EF / EM: effector T cell / effector memory T cell, N / SCM: naive / stem cell memory T cell, CM: central memory T cell).
[0087] Figure 17 and Figure 18 It shows the process of introducing the substance into the body ( in vivo Results of human T-cell death after administration of monovalent anti-CD3 antibody (UCHT1-scFv).
[0088] Figure 19 The results show the assessment of weight loss, clinical symptoms of graft-versus-host disease, and mortality after administration of a monovalent anti-CD3 antibody (UCHT1-scFv) in an immunodeficient mouse model following xenograft-versus-host disease induced by human T cells.
[0089] Figure 20 The results show the observation of whether transplant rejection, which is caused by human T cells sloughing off skin tissue, occurred in an immunodeficient mouse model after administration of a monovalent anti-CD3 antibody (UCHT1-scFv). Detailed Implementation
[0090] The following describes preferred embodiments to aid in understanding the present invention. However, these embodiments are provided merely for the purpose of understanding the invention, and the scope of the invention is not limited to these embodiments. Various modifications can be made to these embodiments, and therefore they are not limited to the embodiments disclosed below, but can be implemented in various forms.
[0091] Example 1: Preparation of activated T cells T cells receive activation and inactivation signals via the T cell receptor (TCR)-CD3 complex on their cell surface. The TCR consists of α and β chains, while the CD3 complex consists of γ, Δ, ε, and ζ chains. Antibodies targeting the CD3 ε subunit are the most well-known. When anti-CD3 ε antibodies (hereinafter referred to as anti-CD3 antibodies) are applied to T cells in a solid-phase coating manner (e.g., antibodies coated on cell culture plates, also known as plate-bound antibodies), multiple antibodies simultaneously cross-link the TCR-CD3 complex, thereby transducing the TCR signal into the cell. The TCR signal contains both activation and inactivation signals. When an antibody targeting CD28, the activation receptor on the T cell surface, is applied to simultaneously provide CD28 signaling, the activation signal dominates, thereby activating the T cell. Therefore, in experimental tubes, normal human peripheral blood T cells are stimulated with anti-CD3 and anti-CD28 antibodies attached to a plate to construct activated T cells.
[0092] Specifically, density gradient centrifugation, a cell separation method based on intercellular density differences, was used to isolate a T-cell-rich monocyte population (peripheral blood mononuclear cells, PBMCs) from peripheral blood mononuclear cells of normal individuals. The isolated PBMCs were cultured with plate-attached anti-CD3 antibody (10 μg / ml, clone OKT3), anti-CD28 antibody (2 μg / ml, clone CD28.2), and recombinant hIL-2 (200 U / ml, Proleukin) for 5 days to activate them. During this period, only T cells survived and proliferated; after 5 days, most of the surviving cells were activated T cells. The cells were then washed and further cultured for 3 days in medium containing hIL-2 (200 U / ml), subsequently used to activate T cells.
[0093] Experimental Example 1: Selective scavenging ability of monovalent anti-CD3 antibodies against activated T cells 1.1 Selective scavenging ability of OKT3 against activated T cells The OKT3 IgG antibody against human CD3 was purchased from a commercially available antibody. To test the T-cell clearance ability of the monovalent soluble anti-CD3 antibody, the OKT3 clone, a known conventional anti-human CD3 antibody, was isolated and purified from human HEK293F cells into Fab and scFv forms as monovalent antibodies.
[0094] Specifically, the anti-human CD3 OKT3 Fab antibody was constructed as follows: the VH-CH1 and VL-CL domains of each clone were cloned into the expression vector (pCEP4), and the two plasmids were transfected into HEK293F cells. The secreted antibody was then affinity purified using kappa-select resin. Specifically, the anti-human CD3 OKT3 scFv antibody was constructed as follows: the scFv portion of each clone was cloned into pCEP4 in a state linked to Ck (kappa light chain constant domain) (scFv-Ck). This plasmid was then transfected into HEK293F cells, and the secreted scFv-Ck antibody was affinity purified using kappa-select resin. Tables 1 and 2 below show the sequences of OKT3 scFv, OKT3 Fab, and the sequences used for their separation and purification.
[0095] Table 1
[0096] Table 2
[0097] Using purified antibodies in various forms, at the same molar concentration (12.5 pmol antibody / 5 × 10⁻⁶), 5 Human T cells activated for 8 days were treated with T cells / mL. After 24 hours, the survival of T cells and the presence of apoptosis were analyzed by flow cytometry.
[0098] Specifically, activated T cells were treated with various forms of OKT3 antibodies (Fab and scFv), and after 24 hours of culture, T cell viability was analyzed by 7AAD staining and flow cytometry. 7AAD is a fluorescent DNA-binding compound. When cells are alive, it cannot penetrate into the cell and therefore cannot bind to DNA. However, when cells die and the cell membrane is disrupted, it flows into the cell and binds to DNA, causing the cell to fluoresce. Therefore, 7AAD-negative cells are classified as live cells, while 7AAD-negative cells are classified as dead or dying cells.
[0099] like Figure 1As shown, the soluble OKT3 antibody in its intact IgG form did not affect T cell survival, but the monovalent antibody forms OKT3-Fab and OKT3-scFv significantly reduced T cell survival (7AAD negative cell ratio).
[0100] 1.2 The death mechanism of activated T cells - apoptosis To confirm whether the activated T cell death induced by the monovalent antibody forms OKT3-Fab and OKT3-scFv was caused by apoptosis, annexin V and 7AAD staining, markers of apoptotic cell death, were performed. The results are shown below. Figure 1 In early apoptotic cells, the cell membrane is stained by annexin V, but the process has not yet progressed to the point of membrane destruction, so 7AAD cannot be stained, resulting in an annexin V (+) 7AAD (-) morphology. However, in late apoptotic cells, 7AAD is stained along with the cell membrane, resulting in an annexin V (+) 7AAD (+) morphology.
[0101] Furthermore, to further verify whether the apoptosis of activated T cells was induced by a monovalent antibody against OKT3, the activation of caspase 3, an enzyme mediating apoptosis, was confirmed by flow cytometry, and the results are presented below. Figure 2 middle.
[0102] like Figure 1 As shown, after applying various forms of OKT3 antibody to activated T cells, the results analyzed at different time points revealed that in the OKT3-Fab and OKT3-scFv antibody treatment groups, the initial apoptosis rate increased sharply from the third hour onwards, and after 6 hours, late apoptotic cells began to appear, subsequently increasing sharply. However, in the OKT3 antibody treatment group with intact IgG morphology, the apoptotic cell rate remained unchanged.
[0103] like Figure 2 As shown, in the OKT3-Fab and OKT3-scFv antibody treatment groups, activated caspase 3 was detected starting 3 hours after treatment, indicating that active apoptosis occurred in these cells. However, activated caspase 3 was not detected in the OKT3 treatment group with intact IgG morphology.
[0104] The above results confirm that OKT3 in Fab or scFv form, which differs from the intact IgG form, induces cell death through the apoptosis pathway of activated T cells.
[0105] 1.3 The selective scavenging ability of anti-CD3 as another monovalent antibody against activated T cells The study investigated whether the T cell apoptosis-inducing ability of the soluble monovalent OKT3 antibody could be reproduced in other monovalent anti-CD3 antibodies. For UCHT1, another anti-CD3 antibody, a commercially available IgG antibody was constructed into an scFv form using the same method as described in 1.1 above, and experiments were conducted to confirm whether it induced the death of activated T cells. The sequence of the UCHT1 scFv and the sequence used for its isolation and purification are shown in Table 3 below.
[0106] Table 3
[0107] In addition, to confirm the universality of anti-CD3 antibodies in scFv form in inducing cell death through apoptosis, novel anti-CD3 ε antibodies were screened. Specifically, human CD3 γ / ε and Δ / ε extracellular heterodimeric proteins were mixed with adjuvant and immunized four times at two-week intervals, with 10 chickens per immunization. The spleen, bone marrow, and Hastings glands of the chickens were recovered, and total RNA was isolated and cDNA was synthesized. PCR amplification of the variable region light and heavy chain genes was performed, and the results were cloned into pComb3XSS, a phage display vector, to construct a chicken immune antibody library. Subsequently, bio-panning was performed to screen for antibody clones that specifically bind to human CD3 protein. After purifying the positive antibody clones in scFv form, two antibodies (clones 1-4-2 and 1-4-7) that bound to CD3(+) Jurka T cells were finally screened. Similarly, the same method as described in 1.1 above was used to analyze whether they induced activated T cell death. The results are shown below. Figure 3 In addition, Tables 4 and 5 below show the sequences of scFv 1-4-2 and 1-4-7, respectively, and the sequences used for their isolation and purification.
[0108] Table 4
[0109] Table 5
[0110] like Figure 3As shown, the intact IgG form of UCHT1 antibody did not affect the survival rate of activated T cells, but the scFv form of UCHT1 antibody significantly reduced T cell survival. Furthermore, the application of scFv of two screening anti-CD3 antibody clones (1-4-2 and 1-4-7) to activated T cells also confirmed a significant decrease in T cell survival.
[0111] 1.4 Selective clearance ability of anti-CD3 against unactivated T cells To confirm whether the aforementioned monovalent anti-CD3 antibody also exhibited apoptosis-inducing ability in unactivated T cells, scFv OKT3 antibody was applied to peripheral blood T cells from normal individuals for 24 hours. T cell death was then confirmed using the same method as in Experiment 1.3 above. The results are shown below. Figure 4 middle.
[0112] like Figure 4 As shown, in unactivated T cells, no cell death accompanied by apoptosis was observed with intact IgG, Fab, scFv, or OKT3 antibodies.
[0113] The above results confirm that anti-CD3 antibodies selectively eliminate activated T cells in Fab or scFv forms of anti-CD3 antibodies that are not in the complete IgG morphology. It was also confirmed that all four different monovalent anti-CD3 antibodies induced apoptosis in activated T cells.
[0114] Experimental Example 2: Analysis of the Apoptosis Mechanism of Monovalent Anti-CD3 Antibody To confirm whether T cell apoptosis induced by monovalent anti-CD3 antibodies is caused by the TCR / CD3 signaling system of these antibodies, the TCR / CD3 signaling pathway was analyzed.
[0115] It is known that T-cell TCR / CD3 signaling, following the activation of upstream signaling molecules such as ZAP70-LAT-PLCγ1, also activates three downstream signaling pathways: the calcium-NFAT pathway, the PKCθ-NFκB pathway, and the Erk-AP1 pathway. Specifically, activation of the calcium-NFAT pathway can be confirmed using Western blotting by detecting the rapid migration of NFAT molecules (NFAT is activated by dephosphorylation, and dephosphorylated NFAT is detected as a small band in SDS-PAGE). Activation of the PKCθ-NFκB pathway is confirmed by detecting the degradation of IkB, an NFκB inhibitor. Activation of the Erk-AP1 pathway is confirmed by detecting phosphorylated Erk (p-Erk).
[0116] To this end, activated T cells were treated with various forms of OKT3 antibodies (OKT3-IgG, OKT-Fab, OKT3-scFv) or with PMA / ionomycin (positive control group), which activated all three downstream signaling pathways mentioned above. Western blotting was then used to confirm whether the NFATC2, IKB, P-ERK, and total ERK pathways were activated. The results are presented below. Figure 5 middle.
[0117] Furthermore, to verify whether activation of the TCR / CD3 signaling pathway and its downstream NFAT pathway induced OKT3 antibody-induced apoptosis, the death of T cells after administration of signal transduction inhibitors affecting the activation of upstream molecules in the TCR / CD3 signaling pathway was confirmed. Specifically, activated T cells were treated with 10 μM cyclosporin A (a calcineurin inhibitor, CsA) dissolved in 0.01% DMSO and 100 nM dasatinib (an Lck inhibitor) dissolved in 0.01% DMSO, while the negative control group (Vehicle) was treated with only 0.01% DMSO. The results are presented in... Figure 6 middle.
[0118] like Figure 5 As shown, compared with the positive control group that induced activation of all three pathways, no significant activation was observed in any of the three pathways with OKT3-IgG, but NFAT activation was observed in cells treated with Fab and scFv. On the other hand, no activation of the NFkB and Erk-AP pathways was observed. Therefore, the activation of the NFAT pathway in TCR / CD3 signaling by monovalent OKT3 antibody was confirmed.
[0119] like Figure 6 As shown, dasatinib (Dasa) significantly inhibited OKT3-scFv-induced apoptosis, and cyclosporine A (CsA) had a partial inhibitory effect on apoptosis. In other words, it was confirmed that OKT3-scFv induces apoptosis through TCR / CD3 signaling, and in particular, the NFAT pathway is involved.
[0120] Experimental Example 3: The ability of anti-CD3 scFv to clear residual TCR-positive CAR-T cells in homologous CAR-T cell therapy. 3.1 Removing TCR impurities using CRISPR / Cas9 technology and / or magnetically activated cell sorting (MACS) Most anti-tumor CAR-T cell therapies still follow the form of autologous CAR T cell therapy, which involves collecting autologous T cells from the patient's peripheral blood, introducing the CAR gene, and then reinfusing them into the patient. However, with autologous CAR-T cells, not only is the process of collecting T cells from the patient and preparing CAR-T cells time-consuming, but there is also a risk of CAR-T cell preparation failure due to the patient's poor T cell condition. Therefore, allogeneic CAR-T cell therapy is being explored. This involves pre-preparing CAR-T cells from peripheral blood T cells collected from healthy individuals (allogeneic T cells) and freezing them for immediate delivery to the patient when needed. However, allogeneic CAR-T cell therapy carries the risk that the provided allogeneic CAR-T cells may attack the patient's normal tissues, potentially inducing graft-versus-host disease (GVHD) and causing severe inflammation. Therefore, attempts have been made to use CRISPR / Cas9 gene editing technology to prepare CAR-T cells with the TCR / CD3 complex removed from T cells that can induce graft-versus-host disease (GVHD) in order to prevent GVHD side effects. However, the removal of the TCR / CD3 complex using CRISPR / Cas9 technology leaves a portion of TCR-positive CAR-T cells remaining.
[0121] TCR and CD3 are always expressed together on the cell surface in a complex form; therefore, if either TCR or CD3 is not expressed, the other will also not be expressed. In other words, residual TCR-positive cells can be eliminated using anti-CD3 antibodies. Therefore, in the process of eliminating the TCR / CD3 complex using CRISPR / Cas9 for allogeneic CAR-T cell therapy, the monovalent anti-CD3 antibody of this invention was attempted to eliminate residual TCR-positive cells.
[0122] Specifically, such as Figure 7As shown, after activating T cells on day 0 of the experiment, a TCR-targeting gRNA / Cas9 protein complex (Ribonulceoprotein, RNP) was constructed using the reported human TCR α chain-specific guide RNA (gRNA) sequence (GAGAATCAAAATCGGTGAAT) (Mol Ther. 2016 Mar; 24(3): 570-81). This RNP was then transfected into T cells activated for two days via electroporation. These T cells were then cultured for several days in medium containing hIL-2 (200 U / ml), and the expression of TCR and CD3 ε chains on the cell surface was confirmed by flow cytometry. On days 5, 8, 11, and 14 of the experiment, residual TCR-positive T cells were confirmed by flow cytometry, and the results are shown below. Figure 7 middle.
[0123] Furthermore, to remove residual TCR-positive cells, the existing method of magnetically activated cell sorting (MACS) was used for further purification, and residual TCR-positive cells were confirmed using the same method. Specifically, after removing the TCRs from T cells activated for two days using CRISPR / Cas9 technology, six days later, the T cells were treated with anti-CD3 antibody labeled with magnetic microbeads. The T cells were then passed through a magnetic column (LD column), trapping CD3-positive cells (i.e., TCR-positive cells) within the column. TCR-negative cells effluxed from the column were collected and cultured for several days in medium containing hIL-2 (200 U / ml). Flow cytometry was used to confirm residual TCR-positive T cells, and the results are presented below. Figure 8 middle.
[0124] like Figure 7 As shown, approximately 7% of TCR-positive T cells remained on day 5 of the culture period, and this residual TCR positivity rate remained at a certain level during two weeks of in vitro culture.
[0125] like Figure 8 As shown, even using the existing magnetically activated cellsorting (MACS) method, approximately 2% of TCR-positive T cells remained.
[0126] The above results confirm through experiments that it is difficult to completely eliminate TCR-positive T cells using CRISPR / Cas9 technology using existing magnetically activated cell sorting (MACS) methods.
[0127] 3.2 The ability of anti-CD3 scFv to clear residual TCR-positive T cells It was confirmed whether TCR-positive T cells could be eliminated by applying OKT3-scFv antibody to the cell culture medium after using CRISPR / Cas9 technology.
[0128] First, such as Figure 9 As shown, T cells that had undergone T cell activation and the introduction of the anti-TCR gRNA / Cas9 complex and were cultured to day 7 were treated with OKT3-ScFv antibody. After further culturing for 3 days, the presence of residual TCR-positive T cells was confirmed. The results are presented in... Figure 9 middle.
[0129] like Figure 9 As shown, most TCR-positive T cells were cleared, which is more effective than existing magnetically activated cell sorting (MACS) in clearing residual TCR-positive T cells.
[0130] Subsequently, the ability to eliminate TCR-positive T cells was confirmed by treating the most widely used anti-CD19 CAR-T cells with the anti-CD3 scFv of the present invention.
[0131] Specifically, the anti-CD19 CAR cDNA is a morphology containing anti-CD19 scFv, CD8 hinge region and transmembrane domain, 41BB intracellular domain, and CD3ζ intracellular domain, and is synthesized by commissioned DNA technology based on a published existing sequence (US Patent Publication US2013 / 0287748A1). After cloning the constructed anti-CD19 CAR cDNA into a lentiviral vector, it was transfected into the 293T cell line (ATCC) with three packaging DNAs (pMD.2G, pMDLg / pRRE, and pRSV-rev) using Lipofectamin 3000 (Invitrogen). The culture supernatant containing lentivirus secreted for 24–48 hours was collected and filtered (using a 0.45 μm filter membrane) to remove residual cellular particles. The supernatant was then concentrated 100-fold using an ultracentrifuge and used as the lentiviral concentrate for constructing CAR-T cells.
[0132] After activating peripheral blood mononuclear T cells for two days, they were co-cultured with concentrated lentivirus for two days. The CAR gene was then transduced into the T cells to construct anti-CD19 CAR-T cells. The cells were then washed to remove residual virus from the culture medium. Culture medium containing hIL-2 (200 U / ml) was added twice, at 3-day intervals, to induce CAR-T cell proliferation. Seven days after the start of T cell culture, OKT3-scFv antibody (12.5 pmol / 1 × 10⁻⁶) was introduced. 5 Cells were added to cell culture medium and cultured for another three days. On day ten from the start of culture, residual TCR-positive T cells were confirmed by flow cytometry. The results are presented as follows: Figure 10 middle.
[0133] like Figure 10 As shown, CAR-T cells with TCR depletion and those prepared by introducing the anti-CD19 CAR gene, after seven days of culture, showed that more than 10% of TCR-positive T cells were present. After three more days of culture in the presence of OKT3-ScFv, it was confirmed that most of the residual TCR-positive CAR-T cells had been depleted.
[0134] Additionally, to confirm whether existing conventional anti-CD19 CAR-T cells can maintain their tumor-killing capabilities and other functions when treated with the anti-CD3 scFv of the present invention, they were co-cultured with CD19-positive Raji cell lines, which are targets of CAR-T cells, thereby confirming their cytokine secretion and tumor-killing capabilities.
[0135] Specifically, Raji-Luc cells (3 × 10⁻⁶) overexpressing luciferase in CD19-positive Raji cells were used. 4 After culturing with CAR T or T cells for 18 hours, luciferin (6 mg / ml) was added to the culture medium. The luminescence intensity of the surviving Raji-Luc cells was measured using a luminometer to derive the cell viability and calculate the cell killing ability based on this. Figure 11 The specific mathematical formula is as follows.
[0136]
Mathematical Formula 1
Mathematical Formula 2
[0137] like Figure 11 As shown, the tumor-killing ability and cytokine secretion ability of CAR-T cells were maintained at a similar level to those of CAR-T cells without antibody treatment.
[0138] The above results confirm that treating residual TCR-positive CAR-T cells generated during the TCR clearance process of allogeneic CAR-T cells with monovalent anti-CD3 antibodies can more effectively clear residual TCR-positive CAR-T cells, thereby potentially alleviating or improving side effects such as graft-versus-host disease.
[0139] 3.3 The preventive effect of graft-versus-host disease produced by clearing residual TCR-positive CAR-T cells with anti-CD3 scFv ( In vivo ) Executed inside the body ( in vivoThis study aimed to confirm whether treatment with the monovalent anti-CD3 antibody (OKT3scFv) of this invention could prevent graft-versus-host disease (GVHD) induced by residual TCR-positive CAR-T cells generated during the construction of allogeneic CAR-T cells. GVHD induced by allogeneic CAR-T cells is difficult to achieve directly in mice. However, by administering human CAR-T cells to immunodeficient mice, the TCRs of human CAR-T cells are induced to recognize MHC molecules in normal mouse cells and attack mouse tissues. This mimics allogeneic GVHD induced by the donor's allogeneic CAR-T cells attacking the recipient's MHC. This is termed xenogeneic GVHD. In other words, when human CAR-T cells expressing TCRs are administered to immunodeficient mice inoculated with human tumors, tumor clearance by CAR-T cells can be observed in mice within the first month. However, thereafter, xenogeneic GVHD side effects caused by human CAR-T cells attacking normal mouse tissues can be observed.
[0140] Specifically, after whole-body irradiation of immunodeficient NSG mice with 2.5 Gy, they were intravenously injected with 5 × 10⁶ CD19-positive Raji-Luc cell lines. 5 Cells. Three days after Raji cell injection, the cells were administered intravenously (5 × 10⁶ cells per mouse). 6 Anti-CD19 CAR-T cells constructed from human T cells, anti-CD19 CAR-T cells with depleted TCR, or anti-CD19 CAR-T cells treated with OKT3-scFv antibody to eliminate residual TCR-positive cells were used. After tumor cell injection, tumor bioluminescence was measured using an in-vivo imaging system (IVIS) at one-week intervals. Each mouse was intraperitoneally injected with 2 mg of fluorescein dissolved in 100 μL of physiological saline. Ten minutes later, in vivo tumor images were obtained via IVIS and displayed. Figure 12 middle.
[0141] like Figure 12As shown, bioluminescence imaging was used to measure tumor proliferation in mice hourly. The results confirmed that all individuals in the tumor-only group died within 2-3 weeks. On the other hand, almost no tumor proliferation was observed in the three CAR-T cell groups, and all individuals survived until 3 weeks, demonstrating excellent therapeutic effects, thus confirming that the anti-tumor efficacy of CAR-T cells was well maintained. However, 10 weeks after tumor administration, mice in the three CAR-T cell administration groups with existing anti-CD19 CAR-T cells and those with TCR-cleared but still TCR-positive cells died due to graft-versus-host disease. Only the mice group treated with OKT3-scFv antibody to clear the residual TCR-positive cells survived without graft-versus-host disease. Figure 13 ).
[0142] Additionally, the incidence of graft-versus-host disease in mice was compared among groups that received anti-CD19 CAR-T cells constructed from human T cells, anti-CD19 CAR-T cells whose TCRs had been cleared but had residual TCR-positive cells, or anti-CD19 CAR-T cells whose residual TCR-positive cells had been cleared by OKT3-scFv antibody treatment.
[0143] The severity of graft-versus-host disease (GVHD) was measured using body weight and GVHD score. Body weight and GVHD score were measured twice weekly. The GVHD score was assessed based on five clinical symptoms (skin, hair condition, posture, mobility, and inflammatory eye disease), scored from 0 to 3, to derive a total score for each indicator. All indicators were measured from tumor administration up to 80 days post-treatment, and the results are presented as follows: Figure 13 middle.
[0144] like Figure 13As shown, in the conventional CAR-T cell administration group (Conv CAR-T) without TCR clearance, mice exhibited weight loss and clinical symptoms of graft-versus-host disease (GVV) starting two weeks after tumor administration; all individuals died from GVV after three weeks. In the CAR-T cell administration group (Del CAR-T) with TCR clearance but residual TCR-positive cells, the mice showed reduced weight loss and severity of GVV compared to Conv CAR-T, but still died from GVV at eight to nine weeks. This indicates that residual TCR-positive CAR-T cells induced severe GVV side effects. On the other hand, in the CAR-T cell administration group (Del Ab CAR-T) treated with anti-CD3 scFv antibodies to completely clear residual TCR-positive cells, mice did not exhibit weight loss or GVV symptoms; all individuals survived long-term, demonstrating anti-tumor efficacy without side effects.
[0145] The above results confirm that treatment with monovalent anti-CD3 antibodies during the preparation of allogeneic CAR-T cells can effectively and perfectly eliminate residual TCR-positive cells, thereby significantly reducing the risk of graft-versus-host disease caused by allogeneic CAR-T cells.
[0146] Experiment Example 4: The selective scavenging effect of anti-CD3 antibody on activated T cell populations in peripheral blood The above experimental examples confirm that the monovalent anti-CD3 antibody of the present invention can eliminate residual TCR-positive cells during the preparation of allogeneic CAR-T cells, thereby preventing or treating the side effects of graft-versus-host disease.
[0147] Furthermore, the monovalent anti-CD3 antibody of the present invention, when directly administered to patients suffering from inflammatory diseases caused by activated T cells, can directly eliminate activated T cell populations in the patient's body, thus possessing the potential to be used as a therapeutic agent. Examples of such diseases include immune diseases, graft-versus-host disease, or organ transplant rejection. In other words, when the monovalent anti-CD3 antibody is administered to patients exhibiting autoimmune diseases, graft-versus-host disease, or organ transplant rejection, if it can selectively eliminate inflammatory-mediating activated T cells, it can preserve naive T cells or memory T cells while minimizing the risk of infection and suppressing the inflammatory response caused by T cells, thus also possessing the potential to be used as an immunosuppressant.
[0148] In this regard, the present invention aims to confirm whether treatment with the anti-CD3 scFv antibody (OKT3-ScFv) of the present invention can selectively eliminate activated T cell populations in human blood cells.
[0149] Specifically, using CD45RA and CCR7 expression as markers, peripheral blood mononuclear cell (PBMC) T cell populations collected from normal individuals were classified into different embryonic fibroblast populations based on their activation history. The CD45RA(+)CCR7(+) group consisted mostly of naive T cells that had never been activated, mixed with a portion of quiescent stem cell memory T cells (N / SCM); the CD45RA(-)CCR7(+) group consisted of activated but currently quiescent central memory T cells (CM). Both of these cell populations were currently quiescent and inactivated. On the other hand, the CCR7(-) cell population consisted of activated effector T cells or rapidly activated effector memory T cells (EF / EM). Therefore, the EF / EM cell population contained a large number of currently activated T cells.
[0150] To this end, peripheral blood mononuclear cells from normal individuals were cultured with OKT3-scFv antibody for 3 days. Flow cytometry was then used to analyze the T-cell and embryonic fibroblast subpopulation within the peripheral blood mononuclear cells, thereby analyzing changes in the ratio of inactivated to activated T-cell populations and the decrease in cell number. More specifically, a Thermo Scientific cell counting bead was added during flow cytometry analysis to measure the number of cells flowing through the flow cytometer per unit volume, thus calculating the number of T cells and each embryonic fibroblast population. After staining with anti-CD3-PE, anti-CD4-APC-Cy7, anti-CD8-PE-Cy7, anti-CD45RA-FITC, anti-CCR7-APC, and 7-AAD, gating was performed on 7-AAD-negative and CD3-positive cell populations, and the proportion of T cells within each embryonic fibroblast population in CD4-positive and CD8-positive cells was analyzed. The results are presented as follows. Figures 14 to 16 middle.
[0151] like Figures 14 to 16 As shown, after 3 days of treatment with OKT3-scFv antibody, the overall T cell count decreased by approximately 30%. Figure 14 Among them, compared with the N / SCM group and the CM group (inactivated T cells), the ratio of EF / EM group (activated T cells) showed a partial decrease in both CD4 and CD8 T cells. Figure 15 and Figure 16Furthermore, the absolute cell counts of each embryonic fibroblast subpopulation were calculated. In CD4 T cells, antibody treatment resulted in a slight decrease in cell count in both the N / SCM and CM (inactivated T cells) groups, while the decrease was more pronounced in the EF / EM (activated T cells) group. In CD8 T cells, antibody treatment did not result in any change in cell count in either the N / SCM or CM (inactivated T cells) groups, but a significant decrease in cell count was observed in the EF / EM (activated T cells) group. Moreover, when calculating the percentage decrease in cell count compared to the untreated group, a significantly higher relative decrease in cell count was confirmed in both the EF / EM (activated T cells) group and the untreated group in both CD4 and CD8 T cells. Figure 16 ).
[0152] The above results confirm that monovalent anti-CD3 antibodies can selectively eliminate activated cell populations in peripheral blood T cells, thus enabling their effective application as a multifunctional selective T cell scavenger and T cell immunosuppressant.
[0153] Experimental Example 5: Clearance of Activated T Cells in Vivo by Anti-CD3 Antibody To confirm direct in vivo ( in vivo To investigate whether the elimination effect of activated T cells could be observed when the aforementioned monovalent anti-CD3 antibody was administered, in vitro activated human T cells were administered to immunodeficient mice. Then, at two-day intervals, the monovalent anti-CD3 antibody (UCHT1-scFv) was administered intravenously several times, and the death of the human T cells was monitored. At this time, by using human T cells artificially expressing luciferase, the bioluminescence of the human T cells in vivo could be tracked using an in-vivo imaging system (IVIS).
[0154] Specifically, to construct luciferase-expressing human T cells, a portion of the highly sensitive luciferase (eff-Luc) cDNA obtained from pDONR222-eGFP (Addgene plasmid #364493) was cloned into the modified pCDH-EF1 vector (Addgene Plasmid #72266) for co-expression with the GFP cDNA. Using Lipofectamin 3000 (Invitrogen), the cloned lentiviral plasmid was co-transfected with three packaging DNAs (pMD.2G, pMDLg / pRRE, pRSV-rev) into the 293T cell line (ATCC). The culture supernatant containing lentivirus secreted for 24 and 48 hours was collected and filtered (using a 0.45 μm filter membrane) to remove residual cellular particles. The supernatant was then concentrated 100-fold using an ultracentrifuge and used as the lentiviral concentrate for transduction.
[0155] Leukocytes obtained from healthy individuals via leukapheresis were added to 24-well plates coated with anti-CD3 antibody (OKT3, 10 μg / ml, BioXcell) along with anti-CD28 antibody (CD28.2, 2 μg / ml). The plates were then cultured for 48 hours to activate T cells. Subsequently, a concentrated lentiviral solution expressing luciferase was added to the T cell culture medium, and the cells were cultured together. Two days after lentiviral transduction, the cells were washed to remove residual virus from the culture medium. Culture medium containing human IL-2 (200 U / ml) was added every three days (3 days + 3 days) for a ten-day experimental protocol.
[0156] The advantage of T cells expressing luciferase is that their presence and proliferation level can be confirmed in vivo via IVIS. Therefore, 5 × 10⁵ human T cells expressing luciferase were intravenously injected into immunodeficient NSG mice. 6Cells. Following injection of human T cells, the distribution of luciferase-expressing T cells was confirmed in vivo using an in vivo imaging system at weekly intervals. Fourteen days after T cell injection (the time point at which T cells could be observed in all mice via IVIS), monovalent anti-CD3 antibody (UCHT1-scFv, low dose: 20ug / mouse, high dose: 100ug / mouse) diluted in 200ul PBS was administered intravenously five times every two days. From the start of monovalent anti-CD3 antibody administration, the distribution of T cells in mice was confirmed using IVIS every two days. Each mouse was intraperitoneally injected with 2mg of luciferin dissolved in 100ul saline. Tumor cell size was measured by IVIS 10 minutes after intraperitoneal injection.
[0157] The experimental results are shown in Figure 17 and Figure 18 This study confirmed that T cells were significantly eliminated in the monovalent anti-CD3 antibody administration group. The more monovalent anti-CD3 antibody administered, the faster and more significant the reduction in T cells, showing a dose-dependent effect.
[0158] Experimental Example 6: The inhibitory effect of anti-CD3 antibodies on T cell-mediated diseases in vivo. When human T cells expressing luciferase were injected into the aforementioned immunodeficient mice, the human T cells attacked the normal tissues of the mice, thereby inducing xenogeneic GVHD and leading to inflammation. Therefore, this study investigated whether administering a monovalent anti-CD3 antibody could suppress xenogeneic GVHD by depleting human T cells.
[0159] The severity of graft-versus-host disease (GVHD) in mice was measured using two methods: body weight and GVHD score. Body weight and GVHD score were measured twice weekly. The GVHD score was assessed based on five disease scales (skin and fur condition, posture, activity level, and inflammatory eye disease), scored from 0 to 3, to derive a total score for each indicator.
[0160] Figure 19 This paper presents the results of assessments regarding weight loss, clinical symptoms of graft-versus-host disease (GVHD), and mortality after administration of a monovalent anti-CD3 antibody (UCHT1-scFv) in an immunodeficient mouse model following xenograft-versus-host disease induced by human T cells. Based on... Figure 19It has been confirmed that treatment with monovalent anti-CD3 antibodies significantly reduced weight loss, clinical symptoms, and mortality caused by graft-versus-host disease (GVHD). Therefore, monovalent anti-CD3 antibodies can significantly inhibit T-cell-induced inflammatory diseases, and thus have great potential as a therapeutic agent for autoimmune diseases with similar T-cell-mediated inflammatory conditions. Furthermore, it holds promise for treating allogeneic GVHD, a disease similar to the aforementioned model, which is induced by donor T cells after allogeneic hematopoietic stem cell transplantation for the treatment of hematologic malignancies.
[0161] To confirm whether monovalent anti-CD3 antibodies can be used as inhibitory therapeutic agents for organ rejection induced by recipient T cells after organ transplantation, the following experiment was conducted: After administering activated human T cells to an allogeneic mouse skin transplantation model to induce an immune rejection response, the survival of the transplanted skin was suppressed, and transplant rejection was tested. The allogeneic mouse skin transplantation model was obtained by transplanting skin from an allogeneic strain of C57BL6 mice into immunodeficient NSG mice.
[0162] Specifically, tail skin (1×1×0.5cm) from female C57BL / 6 mice was used. 3 The skin was transplanted into the tail region of female immunodeficient NSG mice. Tail skin for transplantation was stored in PBS solution for up to 30 minutes before use. During the procedure, NSG mice were anesthetized with avertin (400ul 8-10mg / PBS, intraperitoneal injection). Three donor skin grafts were transplanted into the tail of each NSG mouse. The transplanted skin was fixed in place with glass tubes and adhesive bandages for three days to protect the grafted skin. Graft survival was visually assessed daily. Graft rejection was defined as necrosis of 75% of the transplanted skin surface. Fourteen days after tail skin transplantation, 2 × 10⁶ activated human T cells were injected intravenously. 6Cells. Starting from the day of T cell administration, monovalent anti-CD3 antibody (UCHT1-scFv, 100ug / animal, intraperitoneal injection) diluted in 200ul PBS was injected four times every two days. After a six-day rest period, a second injection was administered using the same method as the first, for a total of eight injections of monovalent anti-CD3 antibody. Transplant survival was measured using the following formula: [Number of transplanted skin remaining as of the observation date] / [Number of transplanted skin remaining on the day of T-cell injection (day 14 post-skin transplantation)] * 100 Figure 20 This shows the results of observing whether a transplant rejection reaction induced by human T cells, resulting in skin tissue shedding, occurred in an immunodeficient mouse model after administration of a monovalent anti-CD3 antibody (UCHT1-scFv). Figure 20 As shown, in the group receiving only human T cells, a transplant rejection reaction with significant sloughing of the transplanted skin tissue was observed. However, in the group receiving monovalent anti-CD3 antibodies, a significant improvement in the survival rate of the transplanted skin was confirmed. Therefore, monovalent anti-CD3 antibodies would be very useful as inhibitors of immune rejection during organ transplantation.
[0163] The above description of the present invention is merely illustrative, and those skilled in the art will understand that it can be readily modified into other specific forms without altering the technical concept or essential features of the invention. Therefore, it should be understood that the above embodiments are exemplary in all respects and not restrictive.
Claims
1. A pharmaceutical composition for the prevention or treatment of T-cell-mediated autoimmune diseases, graft-versus-host disease, or organ transplant rejection, wherein, The pharmaceutical composition comprises a monovalent antibody or an antigen-binding fragment thereof, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
2. The pharmaceutical composition according to claim 1, wherein, The antigen-binding fragments mentioned above are Fab, Fab', Fv, scFv, or single-domain antibodies.
3. The pharmaceutical composition according to claim 1, wherein, The antibodies that specifically bind to CD3 mentioned above are selected from any of the following groups: OKT3, UCHT1, teslizumab, oxizumab, vexizumab, and francirumab; The antibody includes a light chain variable region and a heavy chain variable region, wherein the light chain variable region includes LCDR1 (SEQ ID NO: 23), LCDR2 (SEQ ID NO: 24), and LCDR3 (SEQ ID NO: 25), and the heavy chain variable region includes HCDR1 (SEQ ID NO: 26), HCDR2 (SEQ ID NO: 27), and HCDR3 (SEQ ID NO: 28); and The antibody includes a light chain variable region and a heavy chain variable region, wherein the light chain variable region includes LCDR1 of SEQ ID NO: 32, LCDR2 of SEQ ID NO: 33, and LCDR3 of SEQ ID NO: 34, and the heavy chain variable region includes HCDR1 of SEQ ID NO: 35, HCDR2 of SEQ ID NO: 36, and HCDR3 of SEQ ID NO:
37.
4. The pharmaceutical composition according to claim 1, wherein, The antibodies that specifically bind to CD3 mentioned above are selected from teratolimumab, tebufenozide, belintolimumab, caputoxumab, TNB-486, AMG562, dutuximab, AMG910, pertuximab, HPN424, AMG160, JNJ-63898081, CC-1, AMG509, HPN536, onatuzumab, icoretuzumab, glimetuzumab, mextuzumab, JNJ-75348780, vemutuzumab, AMG330, REGN4018, AMG199, MGD007, and EGFR. BAT, AMG596, M701, Sorituximab, MT110, AMG110, AMG211, MEDI-565, Cybituximab, Tavitazumab, Taquinatamab, RG6194, GBR1302, M802, Lumotuzumab, GEN1044, GEN1047, PF-07062119, AMG757, BI764532, HPN328, Hu3F8-BsAb, GEM3PSCA, IMC-C103C, IMC-F106C, JNJ-70218902, AMG424, Enatuzumab, ABBV-383, AMG420, CC-93269, Rivoxelumab, Anoxetumab, Cyvotazumab, and CD3 binding antibodies for AMG427. The aforementioned heavy chain variable region and light chain variable region can target CD3.
5. The pharmaceutical composition according to claim 1, wherein, The aforementioned monovalent antibodies or their antigen-binding fragments induce the death of activated T cells and / or inhibit alloreactive immune responses.
6. The pharmaceutical composition according to claim 1, wherein, The aforementioned autoimmune diseases are selected from the group including rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus, type 1 diabetes, Crohn's disease, scleroderma, Sjögren's syndrome, psoriasis, inflammatory bowel disease, ulcerative colitis, ankylosing spondylitis, interstitial lung disease, uveitis, optic neuritis, peripheral neuropathy, sarcoidosis, antiphospholipid syndrome, inflammatory myopathy, Behçet's disease, alopecia totalis / alopecia universalis, pemphigus vulgaris, myasthenia gravis, Graves' disease, Hashimoto's thyroiditis, Guillain-Barré syndrome, celiac disease, and pernicious anemia.
7. The pharmaceutical composition according to claim 1, wherein, It is used in combination with immunosuppressants.
8. A pharmaceutical composition for inhibiting T-cell immunity or eliminating activated T cells, wherein, The pharmaceutical composition comprises a monovalent antibody or an antigen-binding fragment thereof, wherein the monovalent antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3.
9. A method for suppressing T-cell immunity, wherein, include: The steps of administering a monovalent antibody or its antigen-binding fragment comprising the heavy chain variable region and the light chain variable region of an antibody that specifically binds to CD3.
10. A method for eliminating T-cell receptor-positive chimeric antigen receptor T cells, wherein, The above methods include: (a) Steps to downregulate T cell receptor expression in T cells; (b) The steps of introducing chimeric antigen receptors into T cells; and (c) The step of treating the cells obtained in steps (a) and (b) above with a monovalent antibody or an antigen-binding fragment thereof, wherein the monovalent antibody or an antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region of an antibody that specifically binds to CD3, and steps (a) and (b) above are performed sequentially.
11. The method according to claim 10, wherein, Downregulating TCR expression can be achieved through gene editing techniques, siRNA, shRNA, or miRNA.
12. The method according to claim 11, wherein, Gene editing technologies are performed using CRISPR / Cas9, TALEN, zinc finger nucleases, base editing, or lead editing.
13. An antibody or an antigen-binding fragment thereof, wherein, include: Including the light chain variable regions of LCDR1 (SEQ ID NO: 23), LCDR2 (SEQ ID NO: 24), and LCDR3 (SEQ ID NO: 25), and the heavy chain variable regions of HCDR1 (SEQ ID NO: 26), HCDR2 (SEQ ID NO: 27), and HCDR3 (SEQ ID NO: 28); or The light chain variable regions include LCDR1 (SEQ ID NO: 32), LCDR2 (SEQ ID NO: 33), and LCDR3 (SEQ ID NO: 34), and the heavy chain variable regions include HCDR1 (SEQ ID NO: 35), HCDR2 (SEQ ID NO: 36), and HCDR3 (SEQ ID NO: 37).
14. The antibody or antigen-binding fragment thereof according to claim 13, wherein, include: The light chain variable region including the amino acid sequence of SEQ ID NO: 29 or SEQ ID NO: 38 and / or the heavy chain variable region including the amino acid sequence of SEQ ID NO: 30 or SEQ ID NO:
39.
15. A polynucleotide encoding the antibody or an antigen-binding fragment thereof according to claim 13.
16. An expression vector comprising the polynucleotide according to claim 15.
17. A cell comprising the polynucleotide of claim 15 or an expression vector comprising thereto.
Citation Information
Patent Citations
Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
US20130287748A1
Process for the purification of recombinant polypeptides
WO1988007085A1
Leader sequences for the production of recombinant proteins
WO1988007086A1
Targeted multifunctional proteins
WO1988009344A1