Bacillus paralicheniformis ca10001, and application and product thereof

Abstract

The application belongs to the technical field of microorganisms, and particularly relates to a parali-bacillus licheniformis CA10001, application and product thereof. The parali-bacillus licheniformis CA10001 has been preserved in the China General Microbiological Culture Collection Center on February 22, 2024, and the preservation number is CGMCC No.29876. The strain has strong bacteriostatic capacity on clostridium perfringens, is heat-resistant, acid-resistant and bile salt-resistant, and can be used for improving feed quality and improving animal growth performance.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to Bacillus paralichrysiformis CA10001 and its applications and products. Background Technology

[0002] Bacillus paralicheniformis ( Bacillus paralicheniformis It is widely distributed in nature and was initially classified as belonging to Bacillus licheniformis (Bacillus licheniformis). Bacillus licheniformis In 2015, it was reclassified as a new species by Dunlap et al. based on phylogenetic analysis of its genome, and in 2016, it was officially named a valid species by the International Journal of Systematic and Evolutionary Microbiology (IJSEM). The type strain of *Bacillus paralicheniformis*, KJ-16, with accession number KACC18426=NRRL B-65293, was isolated from fermented soybean products in South Korea.

[0003] *Bacillus paralichrysogenus* can grow at 15-60℃ and pH 6-11, and can tolerate up to 10% (w / v) sodium chloride. Its cells are rod-shaped, and it is a Gram-positive bacterium that forms spores. *Bacillus paralichrysogenus* secretes various digestive enzymes, including proteases, α-amylases, pectins, glucans, cellulases, hemicellulases, and lipases. These enzymes aid in feed breakdown, promote nutrient absorption in animals, and improve feed utilization. It also secretes keratinase, which degrades keratinous raw materials such as feathers. *Bacillus paralichrysogenus* also metabolizes to produce bacteriocins, short-chain fatty acids such as acetic acid, propionic acid, butyric acid, valeric acid, and hexanoic acid, amino acids, and vitamins, which are beneficial for maintaining animal intestinal health.

[0004] Studies have shown that *Bacillus paralichrysum* SN-6, isolated from the rumen of buffalo, strongly inhibits the growth of *Escherichia coli* K99 and *Staphylococcus aureus* ATCC25923, while exhibiting strong tolerance to artificial gastric juice, intestinal juice, and high temperatures. Adding *Bacillus paralichrysum* significantly increases the abundance of beneficial bacteria such as *Bifidobacterium* and *Fibrinolytic Bacteria* in the intestines of Simmental cattle, and inhibits the proliferation of potentially pathogenic bacteria. By regulating key metabolic pathways such as tryptophan, retinol, and pyrimidine, it enhances intestinal immunity and energy metabolism, resulting in a significant growth-promoting effect. In vitro simulations of intestinal epithelial cells under hydrogen peroxide and deoxynivalenol attack conditions showed that adding *Bacillus paralichrysum* reduced the damage to intestinal epithelial cells caused by hydrogen peroxide and deoxynivalenol, maintaining the integrity of the intestinal epithelial cells. In vitro fermentation experiments have demonstrated that adding *Bacillus paralichrysum* can improve the in vitro fermentation function of the rumen in dairy cows.

[0005] Bacillus paralichrysogenum can promote nutrient absorption and maintain intestinal health by secreting metabolites such as digestive enzymes, bacteriocins, organic acids, and vitamins, showing significant potential in improving animal growth performance and health. In recent years, with the increasing demand for safe livestock food, the government has continuously encouraged the development and application of antibiotic alternatives in the livestock industry. Green, environmentally friendly, safe, and efficient microbial feed additives can improve the health of livestock and poultry farming, promote high-quality development of the livestock industry, and safeguard the safety of livestock production and animal-derived food.

[0006] Relevant patent documents retrieved:

[0007] This document, published in China (CN102876614A) on January 16, 2013, discloses a strain of *Bacillus licheniformis* C30-2, with accession number CGMCC No. 5350 at the China General Microbiological Culture Collection Center. Experiments have shown that *Bacillus licheniformis* C30-2 exhibits strong resistance to adverse conditions and contaminating bacteria. The resulting *Bacillus licheniformis* preparation can be used as an additive in animal feed, replacing antibiotics in existing animal diets, regulating the intestinal microecological balance, thereby enhancing non-specific immune function to prevent disease. It also provides nutritional factors, promotes nutrient digestion and absorption, reduces diarrhea, promotes animal growth, and improves feed conversion ratio.

[0008] Relevant non-patent literature retrieved:

[0009] Journal or book title: *Front Vet Sci*, document title: Bacillus paralicheniformis The paper, "LN33 fermented feed improves growth performance in Cherry Valley ducks by enhancing immune function and intestinal barrier integrity," Volume 12:1619287, published on July 23, 2025, explores how Bacillus paralicheniformis LN33 fermented feed enhances growth performance and overall health in Cherry Valley ducks by increasing antioxidant defense, regulating immune response, and reshaping the gut microbiota. Summary of the Invention

[0010] The purpose of this invention is to provide:

[0011] A strain of Bacillus paralichrysogenus CA10001, its applications and products, and related technologies, to address the technical problems of existing technologies lacking feed-grade Bacillus paralichrysogenus with strong antibacterial ability against Clostridium perfringens, heat resistance, acid resistance, bile salt resistance, and safety for livestock and poultry, or combinations thereof.

[0012] Terminology Explanation:

[0013] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this subject matter pertains. Unless otherwise stated, all patents, patent inventions, and disclosures cited throughout this document are incorporated herein by reference in their entirety. Where multiple definitions exist for terms herein, the definitions provided in this chapter shall prevail.

[0014] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0015] The definition of standard chemical terminology can be found in the reference "Microbiology", edited by Shen Ping and Chen Xiangdong, Higher Education Press.

[0016] Unless otherwise specified, conventional methods within the scope of the art, such as culture medium preparation, strain culture, bacterial dilution, and colony counting, shall be used.

[0017] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0018] The term "culture" as used herein refers to the product obtained by artificially culturing a microbial strain, including various substances produced during the strain's metabolism and the bacterial cells themselves. In this invention, it specifically refers to the culture medium, whole bacteria, and / or fermentation broth obtained by culturing or fermenting Bacillus paralichrysum CA10001.

[0019] The term "microbial agent" as used herein refers to a product prepared with a specific microbial strain or its culture as the core functional component, supplemented with suitable excipients, which can be directly applied to production or further processing. In this invention, the microbial agent forms include powders or liquid preparations.

[0020] The term "feed additive" as used herein refers to substances added to livestock and poultry feed to improve feed quality, enhance animal growth performance, or maintain animal health. In this invention, it specifically refers to feed additives with a culture or agent of Bacillus paralichrysogenum CA10001 as the active ingredient.

[0021] The term "antimicrobial product" as used herein refers to a product that has the activity of inhibiting the growth of specific microorganisms. In this invention, it specifically refers to a product that uses a culture or agent of Bacillus paralichrysogenus CA10001 as the active ingredient and has an inhibitory effect on pathogenic bacteria such as Clostridium perfringens.

[0022] The term heat resistance used in this article refers to the ability of microorganisms to resist heat stress, maintain survival and functional activity within a certain temperature range. In this invention, the heat resistance is evaluated by placing the bacterial solution in a water bath at 70°C, 80°C, and 90°C for 10 minutes and then measuring the number of viable bacteria. The higher the survival rate, the stronger the heat resistance.

[0023] The term acid resistance used in this article refers to the ability of microorganisms to resist acid stress, maintain survival and functional activity in acidic environments (such as animal gastric juice, which has a low pH). In this invention, the acid resistance is evaluated by inoculating the strain into artificial gastric juice (prepared according to the Chinese Pharmacopoeia), incubating at 37°C, and then measuring the number of viable bacteria. The higher the survival rate, the stronger the acid resistance.

[0024] The term bile salt tolerance used in this article refers to the ability of microorganisms to resist bile salt stress and maintain survival and functional activity in a bile salt-containing environment (such as the animal intestine). In this invention, the tolerance is evaluated by inoculating the strains into artificial intestinal fluid containing different concentrations (0.1%, 0.3%, 0.5%) of bile salts, culturing at 37°C, and then measuring the number of viable bacteria. The higher the survival rate, the stronger the bile salt tolerance.

[0025] In a first aspect, the present invention provides a strain of Bacillus paralichrysum CA10001, the preservation number of which is CGMCC No.29876.

[0026] The 16S rDNA sequence of Bacillus paralichrysogenum CA10001 is shown in SEQ ID NO.5.

[0027] The *Bacillus paralichrysogenum* CA10001 was cultured on TCA medium. The colonies were light yellow, irregular in shape, moist, opaque, and had irregular edges.

[0028] Among them, the *Bacillus paralichrysogenum* CA10001 was Gram-positive, and the bacterial cells were rod-shaped, 0.4-0.6 μm × 1.9-6.1 μm, arranged singly or in pairs under microscopic examination.

[0029] Secondly, the present invention provides a culture of Bacillus paralichrysogenum CA10001.

[0030] The culture includes a culture medium, whole bacteria and / or fermentation broth of Bacillus paralichrysiformis CA10001.

[0031] Thirdly, the present invention provides a microbial agent comprising Bacillus paralichrysum CA10001 or a culture of Bacillus paralichrysum CA10001.

[0032] The microbial agent also includes auxiliary materials.

[0033] The excipients include, but are not limited to, any one or more of the following: diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH adjusters, antioxidants, and buffers.

[0034] The bacterial agent is a powder or liquid preparation.

[0035] Fourthly, the present invention provides the application of the above-mentioned Bacillus paralichrysiformis CA10001 or its culture or the above-mentioned bacterial agent in the preparation of feed additives or antibacterial products.

[0036] Fifthly, the present invention provides a feed additive comprising the above-mentioned Bacillus paralichrysiformis CA10001 or its culture or the above-mentioned microbial agent.

[0037] In a sixth aspect, the present invention provides an antibacterial product comprising the above-mentioned Bacillus paralichrysiformis CA10001 or its culture or the above-mentioned bacterial agent.

[0038] The present invention has at least the following beneficial effects:

[0039] (1) The *Bacillus paralichrysogenus* in this invention has the ability to produce proteases and has a strong inhibitory effect on *Clostridium perfringens*. It has excellent stress resistance; after treatment in a 90°C water bath for 10 minutes, the survival rate is still 85%; after incubation in artificial gastric fluid at 37°C for 2 hours, the survival rate can reach 83%; and when the bile salt concentration is 0.5%, the survival rate of *Bacillus paralichrysogenus* CA10001 is still above 50%. It has high safety; *Bacillus paralichrysogenus* CA10001 is sensitive to vancomycin, gentamicin, kanamycin, streptomycin, clindamycin, tetracycline, and chloramphenicol, and has no drug resistance. The results of cytotoxicity and pathogenicity tests show that *Bacillus paralichrysogenus* CA10001 is not cytotoxic and has no pathogenicity in animals.

[0040] (2) The minimum inhibitory concentration of the Bacillus paralichrysogenum preparation sample provided by the present invention against Clostridium perfringens is 98 ppm.

[0041] (3) Adding Bacillus paralicheniformis CA10001 to the basic diet can inhibit harmful bacteria such as Clostridium perfringens and Escherichia coli in the intestines of broilers, promote the proliferation of beneficial bacteria such as Lactobacillus, and significantly improve the growth performance of broilers.

[0042] Preservation instructions:

[0043] Preserved strain: Bacillus paralicheniformis ( Bacillus paralicheniformis CA10001;

[0044] Classification and nomenclature: Bacillus paralicheniformis Bacillus paralicheniformis ;

[0045] Accession number: CGMCC No. 29876;

[0046] Preservation date: February 22, 2024;

[0047] Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections;

[0048] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0049] Figure 1 This section describes the colony morphology and microscopic morphology.

[0050] Figure 2 Phylogenetic tree of the 16S rDNA sequence of Bacillus paralichrysiformis CA10001.

[0051] Figure 3 For Bacillus paralichrysiformis CA10001 gyr Phylogenetic tree of B gene sequence.

[0052] Figure 4 The image shows the antibacterial effect of the supernatant of the activated bacterial solution on Clostridium perfringens. Detailed Implementation

[0053] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.

[0054] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.

[0055] Example 1: Isolation, identification, and preservation of Bacillus paralichrysiformis CA10001

[0056] 1. Isolation of strains

[0057] Take 10.0g of intestinal contents sample and place it in a 500mL Erlenmeyer flask containing 90.0mL of physiological saline. Shake at 220rpm for 30 minutes to mix thoroughly, and prepare 10... -1 The diluent was then serially diluted 10-fold. Three suitable dilution gradients were selected, and each was incubated at 65°C for 10 minutes. 1.0 mL of each gradient was then spread onto the protease selection medium and incubated at 37°C for 24-48 hours. After colonies grew, colonies with enzyme-producing zones were picked, isolated, purified, numbered, and stored.

[0058] The protease-producing strains obtained from the initial screening were inoculated into LB liquid medium and cultured at 37℃ and 200 rpm with shaking for 24 h. The culture was then centrifuged at 3500 rpm for 10 min and stored at 4℃ for later use. The inhibitory activity against Clostridium perfringens was determined using the Oxford cup method, and strains with strong inhibitory activity were screened.

[0059] Through screening, a strain CA10001 was obtained that produces protease and has a strong inhibitory effect on Clostridium perfringens (inhibition zone diameter greater than 25 mm).

[0060] 2. Identification and preservation of strains

[0061] (1) Colony morphology characteristics

[0062] CA10001 was streaked onto TCA medium and incubated at 37°C for 18 hours. Colony morphology and microscopic examination after Gram staining were then observed. Figure 1 As shown, the colonies are light yellow, irregular in shape, moist, opaque, and have irregular edges. They are Gram-positive and, under a microscope, appear as rod-shaped cells measuring 0.4-0.6 μm × 1.9-6.1 μm, arranged singly or in pairs.

[0063] (2) Physiological and biochemical characteristics

[0064] The results of the CA10001 carbohydrate fermentation acid production experiment are shown in Table 1.

[0065] Table 1 Physiological and biochemical characteristics of CA10001

[0066]

[0067] (3) Molecular identification and phylogenetic analysis

[0068] 16S rDNA and gyrB Gene sequence analysis and extraction of total bacterial DNA were performed using a bacterial genomic DNA extraction kit. The primers for 16S rRNA gene amplification were 27F (SEQ ID NO.1): AGAGTTTGATCCTGGCTCAG, and 1492R (SEQ ID NO.2): GGTTACCTTGTTACGACTT. gyrB The gene amplification primers are: gyrB F (SEQ ID NO.3): 5'-GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYG A -3'; gyrB R (SEQ ID NO.4): 5'-AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT -3'. Reaction system (20 μL): 1 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer, 0.2 μL Easy Taq, 2 μL dNTPs, 2 μL 10×Easy Taq Buffer, 14 μL ddH2O. All components were added on ice, mixed, and centrifuged. The PCR reaction program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, 32 cycles, and a final extension at 72℃ for 10 min. PCR products were detected by 1% agarose gel electrophoresis and then sent to Beijing Sangon Biotech Co., Ltd. for sequencing. The obtained gene sequences were compared for BLAST homology in the GenBank database. A phylogenetic tree was constructed using MEGA software with neighbor-to-neighbor linkage, as shown below. Figure 2 and Figure 3 As shown.

[0069] 16S rDNA sequence (SEQ ID NO.5), 1383 bp in total:

[0070]

[0071] gyrB Gene sequence (SEQ ID NO.6), 1027 bp in total:

[0072]

[0073] Based on the comprehensive morphological characteristics, physiological and biochemical features, DNA sequence analysis, and phylogenetic tree results, strain CA10001 was identified as *Bacillus paralicheniformis*. Bacillus paralicheniformis ).

[0074] Example 2: Evaluation of the stress resistance of Bacillus paralichrysiformis CA10001

[0075] 1. Heat resistance

[0076] Bacillus paralichrysogenum CA10001 bacterial suspensions were placed in water baths at 70℃, 80℃, and 90℃ for 10 min, respectively, and the viable count was determined by pouring method.

[0077] The survival rate can reach 100% after treatment in a 70℃ water bath for 10 minutes, 97% after treatment in an 80℃ water bath for 10 minutes, and 85% after treatment in a 90℃ water bath for 10 minutes.

[0078] 2. Bile salt tolerance

[0079] The artificial intestinal fluid was prepared according to the Chinese Pharmacopoeia. 6.8 g of potassium dihydrogen phosphate was dissolved in 500 mL of water, and the pH was adjusted to 6.8 with 0.1 mol / L sodium hydroxide solution. Separately, 10.0 g of pancreatic enzyme was dissolved in an appropriate amount of water. The two solutions were mixed and diluted with water to 1000 mL. Then, ox bile salts were added to the artificial intestinal fluid to prepare artificial intestinal fluids containing 0.1%, 0.3%, and 0.5% bile salts, respectively.

[0080] 1.0 mL of *Bacillus paralichrysogenus* CA10001 culture medium was added to 9 mL of artificial intestinal fluid with different bile salt concentrations. After static incubation at 37°C for 6 h, viable cell counts were performed using the pour method. As shown in Table 2, the viable cell count of *Bacillus paralichrysogenus* CA10001 decreased with increasing bile salt concentration. When the bile salt concentration was 0.5%, the survival rate of *Bacillus paralichrysogenus* CA10001 remained above 50%, indicating its strong bile salt tolerance.

[0081] Table 2. Survival rate of Bacillus paralichrysogenum CA10001 at different bile salt concentrations.

[0082]

[0083] 3. Tolerance to artificial gastric juice

[0084] Artificial gastric fluid is prepared according to the Chinese Pharmacopoeia. Take 16.4 mL of dilute hydrochloric acid, add about 800 mL of water and 10.0 g of pepsin, shake well, and then dilute with water to 1000 mL.

[0085] Take the late-stage culture medium of Bacillus paralichrysogenum CA10001, centrifuge at 4℃ and 1000 rpm for 1 min, discard the supernatant, and then... 7 CFU / mL was inoculated into artificial gastric fluid, shaken to mix, incubated in a 37°C water bath for 1 hour, and then samples were taken to determine the viable count using the pour method.

[0086] The survival rate of Bacillus paralichrysogenum CA10001 after incubation in artificial gastric juice at 37°C for 2 hours reached 83%, indicating that it has good tolerance to gastric acid.

[0087] Example 3 Safety evaluation of Bacillus paralichrysiformis CA10001

[0088] 1. Drug sensitivity

[0089] The MIC (minimum inhibitory concentration) values ​​of *Bacillus paralichrysogenus* CA10001 against different antibiotics were quantitatively determined using the broth serial dilution method. As shown in Table 3, *Bacillus paralichrysogenus* CA10001 was sensitive to vancomycin, gentamicin, kanamycin, streptomycin, clindamycin, tetracycline, and chloramphenicol, and showed no resistance.

[0090] Table 3 shows the MIC (minimum inhibitory concentration) and drug sensitivity of different antimicrobial drugs.

[0091]

[0092] 2. Cytotoxicity

[0093] Cytotoxicity assays were performed using a fluorescence spectrophotometer to measure propidium iodide staining in Vero cell suspensions.

[0094] (1) Experimental procedure

[0095] a. Inoculate Bacillus paralichrysogenum and Bacillus cereus strains into brain heart and heart infusion broth (BHI) medium, and incubate at 30°C for 6 h until the cell concentration reaches 102. 8 Centrifuge at 15000 r / min at room temperature for 5 min with CFU / mL or higher, and collect the supernatant as the test sample.

[0096] b. Use 2-day cultured monolayer fusion Vero cells. Adjust the cell concentration to a final level of 10 μg / mL using 2 mL of EC buffer containing propidium iodide (5 μg / mL) (containing 135 mmol / L sodium chloride, 15 mmol / L HEPES, 1 mmol / L magnesium chloride, 1 mmol / L calcium chloride, and 10 mmol / L glucose, adjusted to pH 7.0–7.1 with Tris). 6 The suspension of cells / mL was placed in a 1 cm quartz cuvette and stored at 37°C.

[0097] c. Add 100 μL of the test sample to the cell suspension described above, and continuously mix the cells using a magnetic stirrer and stir bar. Perform continuous fluorescence detection every 30 seconds under excitation / emission wavelengths of 575 / 615 nm and a 5 nm slit. If the detection result exceeds the fluorescence / absorbance of the positive control (usually cells treated with a washing agent) by more than 20%, the strain is considered to be cytotoxic.

[0098] (2) Results

[0099] The fluorescence value of Bacillus paralichrysogenum CA10001 was 0.6±0.06, while the fluorescence value of the positive control Bacillus cereus CICC21261 was 12.66±1.71. The fluorescence value ratio of the two samples was 4.84±0.82%, indicating that Bacillus paralichrysogenum CA10001 is not cytotoxic.

[0100] 3. Animal pathogenicity

[0101] (1) Experimental procedure

[0102] a. Inoculate the activated strain "Bacillus paralichrysogenum CA10001" onto LB agar plates and incubate aerobically at 37°C for 24 hours. Scrape colonies from the agar plates and suspend them in sterile physiological saline to prepare a solution with a concentration of 6.2 × 10⁻⁶. 7 A bacterial suspension of CFU / mL was administered via intraperitoneal injection to mice.

[0103] b. Take the liquid culture, centrifuge to collect the bacterial cells, and use the supernatant after centrifugation to prepare a solution with a concentration of 3.6 × 10⁻⁶. 8 A bacterial suspension of CFU / mL was prepared using a 5-fold concentrated supernatant as a matrix to achieve a concentration of 1.8 × 10⁻⁶ CFU / mL. 9 A 5-fold concentrated bacterial suspension at CFU / mL was administered orally to mice.

[0104] c. Intraperitoneal injection: Forty healthy adult SPF-grade ICR mice weighing between 18.0g and 22.0g (half male and half female) were randomly divided into four groups: a sterile saline control group for male mice, a bacterial suspension group for male mice, a sterile saline control group for female mice, and a bacterial suspension group for female mice, with 10 mice in each group. Each mouse was injected with 0.2 mL of sterile saline, while the bacterial suspension group received a concentration of 6.2 × 10⁻⁶ mL. 7 CFU / mL bacterial suspension. Observe once daily for 21 consecutive days after intraperitoneal injection.

[0105] d. Oral gavage: Eighty healthy adult SPF-grade ICR mice weighing between 18.0g and 22.0g (half male and half female) were randomly divided into eight groups: male mice (culture medium control group), male mice (bacterial suspension group), male mice (5x concentrated culture medium control group), male mice (5x concentrated bacterial suspension group), female mice (culture medium control group), female mice (bacterial suspension group), female mice (5x concentrated culture medium control group), and female mice (5x concentrated bacterial suspension group), with ten mice in each group. All groups were administered the bacterial suspension to mice via gavage at a concentration of 20.0 mL / kg body weight. The culture medium control group used liquid culture medium, and the 5x concentrated culture medium control group used 5x concentrated liquid culture medium. The bacterial suspension group used a concentration of 3.6 × 10⁻⁶. 8 The bacterial suspension was CFU / mL, and the concentration used in the 5-fold concentrated bacterial suspension group was 1.8 × 10⁻⁶. 9 A 5-fold concentrated bacterial suspension at CFU / mL was administered. Mice were fasted overnight (16 h) before the first gavage, and fed 3-4 h after gavage. The gavage was repeated for 3 consecutive days, and the mice were observed for 21 consecutive days starting from the first day of gavage.

[0106] (2) Indicator detection

[0107] Following intraperitoneal injection and oral gavage, observe and record any abnormalities in the mice's skin and fur, eyes and mucous membranes, respiration, limb movement, and behavior. Pay particular attention to the presence of tremors, convulsions, diarrhea, lethargy, salivation, and coma. Weigh and record the weight of all mice before and after the experiment. For mice that die during the experiment, record the time of death and weigh them.

[0108] (3) Results

[0109] As shown in Table 4, there were no significant differences in the initial and final body weights of male and female mice between the culture group and the control group (P > 0.05), indicating that intraperitoneal injection of Bacillus paralichrysum CA10001 culture had no effect on the body weight of mice.

[0110] Table 4. Effects of intraperitoneal injection of Bacillus paralichrysogenum CA10001 culture on mouse body weight.

[0111]

[0112] As shown in Table 5, intraperitoneal injection of Bacillus paralichrysiforme CA10001 culture had no adverse effects on the general health of mice, and no toxic reactions or deaths were observed in the test mice.

[0113] Table 5. Acute toxicity of intraperitoneal injection of Bacillus paralichrysogenus CA10001 culture in mice.

[0114]

[0115] As shown in Table 6, there were no significant differences in the initial and final body weights of male and female mice between the culture group and the control group (P > 0.05), indicating that oral gavage of Bacillus paralichrysogenum CA10001 culture had no effect on the body weight of mice.

[0116] Table 6. Effects of oral administration of Bacillus paralichinii CA10001 culture on mouse body weight.

[0117]

[0118] As shown in Table 7, oral gavage of Bacillus paralichrysogenum CA10001 culture had no adverse effects on the general health of mice, and no toxic reactions or deaths were observed in the test mice.

[0119] Table 7. Acute toxicity of Bacillus paralichinii CA10001 culture administered orally to mice.

[0120]

[0121] Example 4: Preparation of Bacillus paralichrysiforme preparation

[0122] 1. The production method of Bacillus paralichrysogenum is as follows:

[0123] (1) Inoculate the CA10001 strain of Bacillus paralichrysum on LB agar plates and incubate at 37°C for 18 hours.

[0124] (2) Inoculate a single colony of Bacillus paralichrysogenum CA10001 into LB liquid medium, filling a 500mL Erlenmeyer flask with 100mL of liquid, and incubate at 37℃ and 200rpm for 16 hours.

[0125] (3) The activated solution of Bacillus paralichrysum CA10001 was inoculated into a seed tank at a weight ratio of 3%, with a liquid volume of 150L in a 500L seed tank. The culture was carried out at 37℃ and 220rpm for 16 hours. The fermentation medium consisted of 1.0wt.% peptone, 1.0wt.% soybean meal, 3.0wt.% glucose, 2.0wt.% corn flour, 0.01wt.% magnesium sulfate and 0.005wt.% manganese sulfate, with a pH of 7.0.

[0126] (4) Inoculate the seed tank culture medium into the fermenter at a weight ratio of 3%, the tank pressure is 0.03 MPa, the stirring speed is 220 rpm, the aeration ratio is 0.5:0.1 by volume, the fermentation time is 24 hours, and the fermentation medium is the same as in step (3).

[0127] (5) The Bacillus paralichrysum fermentation broth was spray-dried in a drying tower, and diluted with maltodextrin to obtain a Bacillus paralichrysum preparation with a viable cell content of 1.0 × 10⁻⁶.10 -1.0×10 11 CFU / g.

[0128] Example 5: Antibacterial properties of Bacillus paralichrysiforme preparations against Clostridium perfringens

[0129] 1. The inhibitory effect of Bacillus paralichrysogenus on Clostridium perfringens was evaluated using the Oxford cup agar diffusion method.

[0130] Experimental steps:

[0131] (1) Preparation of supernatant of bacterial strain activation solution

[0132] Single colonies of Bacillus paralichrysogenum CA10001 and CICC10102 were inoculated into 100 mL of TSB-YE medium and cultured at 37 °C with shaking at 200 rpm for 20 h. After centrifugation at 3500 rpm for 10 min, the cultures were ready for use.

[0133] (2) Preparation of Clostridium perfringens indicator bacterial suspension

[0134] Clostridium perfringens ATCC13124 was inoculated into TSC liquid medium and anaerobic cultured at 37°C for 16 hours for later use.

[0135] (3) Preparation of indicator bacteria plates

[0136] Using sterile forceps, place Oxford cups symmetrically at the bottom of the plate. Mix the Clostridium perfringens activation solution with the melted and cooled TSC solid medium at a ratio of 1:100. After cooling and solidification, remove the Oxford cups with sterile forceps.

[0137] (4) Sample loading

[0138] Transfer 100 μL of the activation solution supernatant into each well of the indicator bacterial plate, taking care to avoid spillage or splashing.

[0139] Enramycin was used as a positive control, and sterile water was used as a negative control.

[0140] Experimental results:

[0141] like Figure 4 As shown, Bacillus paralichrysum CA10001 showed better antibacterial effect against Clostridium perfringens (ATCC13124) than 10 mg / L enramycin and Bacillus paralichrysum CICC10102, with inhibition diameters of 26.57 mm, 23.25 mm and 21.53 mm, respectively.

[0142] 2. The minimum inhibitory concentration (MIC) of the Bacillus paralichrysogenus preparation prepared in Example 4 against Clostridium perfringens strain ATCC13124 was evaluated using the "broth two-fold serial dilution method".

[0143] Experimental steps:

[0144] (1) Diluent for Bacillus paralichrysum preparation: Accurately weigh 1.000 g of Bacillus paralichrysum preparation sample, add 9 mL of sterile PBS buffer, vortex for 3 min to mix thoroughly. Then transfer the sample solution to a centrifuge tube, centrifuge at 3500 rpm for 10 min, filter through a 0.22 μm filter membrane for later use, and dilute 2-fold.

[0145] (2) Enramycin dilution: Dissolve enramycin in dilute hydrochloric acid solution to prepare 1000 ppm solution and then dilute it twice.

[0146] (3) Clostridium perfringens suspension: Freshly cultured Clostridium perfringens strains were inoculated into brain heart broth (BHI) liquid medium and anaerobic cultured at 37°C for 16 h. Then, a 0.5 McFarland unit standard bacterial suspension was prepared by diluting with BHI.

[0147] (4) Inoculation: Take 1.0 mL of Bacillus paralichrysogenum preparation dilution and enramycin dilution respectively, and simultaneously inoculate 1.0 mL of Clostridium perfringens suspension. The concentration after inoculation is 5.0 × 10⁻⁶. 5 CFU / mL.

[0148] (5) The blank control was replaced with sterile water instead of the sample diluent.

[0149] (6) After inoculation, the mixed solution was incubated in a 37°C incubator for 16 hours.

[0150] (7) The minimum inhibitory concentration is the lowest concentration that inhibits the visible growth of bacteria.

[0151] Experimental results:

[0152] The minimum inhibitory concentration (MIC) of the Bacillus paralichrysogenum preparation against Clostridium perfringens (ATCC13124) was 98 ppm, and the minimum inhibitory concentration (MIC) of enramycin against Clostridium perfringens (ATCC13124) was 0.625 ppm.

[0153] Example 6: Effects of Bacillus paralichrysiformis CA10001 on growth performance and gut microbiota in broiler chickens challenged with Clostridium perfringens

[0154] 1. Experimental Design

[0155] This experiment used 480 one-day-old Kobo broiler chicks, randomly divided into 4 treatment groups, with 6 replicates per treatment group and 20 chicks per replicate. These included a blank control group (basal diet), a challenge group (basal diet plus oral administration of 1.0 × 10⁻⁶ Clostridium perfringens activated bacterial solution for 3 consecutive days after 3 weeks), and a challenge group (basal diet plus oral administration of 1.0 × 10⁻⁶ Clostridium perfringens activated bacterial solution for 3 consecutive days after 3 weeks).8 CFU / d), Bacillus paralichrysum group (basal diet + 1.0×10 CFU / kg feed). 10 CFU (Cytobacter paralichrysogenum) preparation + 1.0 × 10⁻⁶ clastic bacterial suspension orally for 3 consecutive days after 3 weeks. 8 CFU / d), Enramycin group (basal diet + 10 mg enramycin per kg of feed + 1.0 × 10⁻⁶ Clostridium perfringens activated bacterial solution orally for 3 consecutive days after 3 weeks), 8 CFU / d).

[0156] 2. Trial Management

[0157] The trial period lasted 42 days. The chickens were raised in three-tiered cages with 24-hour lighting, nipple drinkers, and free access to the experimental diet. They were vaccinated against Marek's disease and Newcastle disease at 1 day old and against infectious bursal disease in drinking water at 21 days old. The chicken house was kept in accordance with the usual hygiene management.

[0158] 3. Detection indicators

[0159] At the start of the experiment, the weight of each replicate chicken at 1 day old was accurately weighed; feed consumption was recorded on a replicate basis; on day 42 of the experiment, the body weight of the experimental chickens was weighed on a replicate basis, and body weight gain and feed conversion ratio were calculated. One week after the end of the challenge experiment, 6 broilers were randomly selected from each group, and cecal and contents samples were collected and stored in a sterile refrigerator. The contents of lactic acid bacteria, Clostridium perfringens, and coliform bacteria in the cecal contents were determined.

[0160] 4. Test Results

[0161] (1) Effects of Bacillus paralichrysiformis CA10001 on the growth performance of broilers challenged with Clostridium perfringens

[0162] As shown in Table 8, compared with the challenge group, the feed conversion ratio of all other groups was significantly lower (P<0.05), while the body weight gain of the *Bacillus paralichrysogenus* group and the enramycin group was significantly increased (P<0.05). Compared with the control group and the challenge group, the feed intake of the *Bacillus paralichrysogenus* group and the enramycin group showed an increasing trend (P>0.05). The results of this experiment indicate that *Bacillus paralichrysogenus* CA10001 can improve the growth performance of broilers challenged with *Clostridium perfringens*.

[0163] Table 8. Effects of Bacillus paralichrysitigarb. CA10001 on growth performance of broilers challenged with Clostridium perfringens.

[0164]

[0165] Note: Different lowercase letters in the same row's shoulder label indicate significant differences (P < 0.05), while no letter or the same letter indicates no significant differences (P > 0.05).

[0166] (2) Effects of Bacillus paralichrysiformis CA10001 on the intestinal flora of broiler chickens challenged with Clostridium perfringens

[0167] As shown in Table 9, the content of lactobacilli in the cecal contents of the *Bacillus paralichrysogenus* group was significantly higher than that of other groups (P<0.05), while the content of *Clostridium perfringens* and *Escherichia coli* in the *Bacillus paralichrysogenus* group, enramycin group, and control group was significantly lower than that in the challenge group (P<0.05). Therefore, *Bacillus paralichrysogenus* CA10001 can inhibit the proliferation of intestinal pathogens such as *Clostridium perfringens* and *Escherichia coli* in broilers, thus maintaining intestinal health in animals.

[0168] Table 9. Effects of Bacillus paralichrysogenum CA10001 on the gut microbiota of broiler chickens challenged with Clostridium perfringens.

[0169]

[0170] Note: Different lowercase letters in the same row's shoulder label indicate significant differences (P < 0.05), while no letter or the same letter indicates no significant differences (P > 0.05).

[0171] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to the embodiments, those skilled in the art should understand that modifications or equivalent substitutions to the technical solutions of the present invention do not depart from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A type of Bacillus paralichrysiformis that can inhibit Clostridium perfringens (Clostridium perfringens) Bacillus paralicheniformis CA10001, characterized in that, The accession number is CGMCC No. 29876.

2. A culture, characterized in that, The culture is obtained by culturing or fermenting Bacillus paralichrysum CA10001 as described in claim 1.

3. The culture according to claim 2, characterized in that, This includes culture medium, whole cells and / or fermentation broth of Bacillus paralicheniformis CA10001.

4. A microbial agent, characterized in that, It contains Bacillus paralicheniformis CA10001 as described in claim 1 or a culture as described in any one of claims 2-3.

5. The microbial agent according to claim 4, characterized in that, It also includes auxiliary materials.

6. The microbial agent according to claim 5, characterized in that, The excipients are selected from any one or more of the following: excipients, disintegrants, cosolvents, solubilizers, osmotic pressure regulators, surfactants, colorants, pH adjusters, and antioxidants.

7. The microbial agent according to claim 4, characterized in that, The bacterial agent is a powder or liquid preparation.

8. The use of Bacillus paralichrysogenum CA10001 as described in claim 1, or the culture as described in any one of claims 2-3, or the bacterial agent as described in any one of claims 4-7, in the preparation of feed additives or products that inhibit Clostridium perfringens.

9. A feed additive, characterized in that, Includes Bacillus paralicheniformis CA10001 as described in claim 1, or the culture as described in any one of claims 2-3, or the bacterial agent as described in any one of claims 4-7.

10. An antibacterial product, characterized in that, Includes Bacillus paralicheniformis CA10001 as described in claim 1, or the culture as described in any one of claims 2-3, or the bacterial agent as described in any one of claims 4-7.

Images