Multiplexed SSR primers for parentage identification of megaleseus acipenseroides and their application

Abstract

The application discloses a kind of Megalobrama amblycephala parentage identification SSR multiplex PCR primer and application, the primer includes 7 pairs of specific primers, respectively primer pair MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506 and MamGLR2507, the base sequence of 7 pairs of specific primers is sequentially shown as SEQ ID NO.1~14;Also disclosed is the SSR multiplex fluorescence PCR method for Megalobrama amblycephala parentage identification using the above primer, and the application of the above primer or method in Megalobrama amblycephala parentage identification.The microsatellite site amplified by the primer of the application is 3-6 base repeats, accurate in typing, and high in amplification site polymorphism;The method of the application is accurate in identification and low in price.

Description

Technical Field

[0001] This invention belongs to the field of microsatellite marker technology, specifically relating to an SSR multiplex PCR primer for parentage identification of blunt snout bream and its application. Background Technology

[0002] The bluntnose bream (Megalobrama amblycephala) is a species of fish belonging to the genus Megalobrama in the family Cyprinidae of the order Cypriniformes. It is commonly known as the Wuchang fish.

[0003] Molecular markers are important tools in research and applications such as population dynamics monitoring, germplasm resource identification, pedigree identification, and evaluation of the effectiveness of stock enhancement and release programs. Microsatellite DNA, also known as simple sequence repeats (SSRs), refers to a class of repetitive sequences with repeating units of 2-6 bases, whose flanking sequences are relatively conserved. Microsatellite sequences, as molecular markers, have advantages such as simple methods, high information content per unit point, reliable results, mature technology, and low cost. Combining them with multiplex PCR and universal fluorescently labeled primers can further simplify the operation and reduce costs.

[0004] Microsatellite multiplex PCR is a relatively common technique, but it has many problems, such as insufficient loci and inaccurate genotyping. An article published in the *Acta Hydrobiologica Sinica* in 2024, titled "Establishment of a Parentage Identification Method for Blunt-snout Breeding Families" (Wang Huihu, Ren Chao, Zheng Guodong, Zou Shuming, *Acta Hydrobiologica Sinica*, Vol. 48, No. 8, pp. 1379-1381, August 2024), included eight loci and used polyacrylamide gel electrophoresis and silver staining for genotyping. Five of these loci had two-base repeating motifs. This method has two drawbacks: 1. The detection efficiency of polyacrylamide gel electrophoresis and silver staining is extremely low; 2. The two-base repeating microsatellite loci exhibit a multi-peak phenomenon in the detection spectrum due to numerous errors during PCR amplification, severely affecting the accuracy of genotyping. Summary of the Invention

[0005] The purpose of this invention is to provide an SSR multiplex PCR primer and kit for parentage identification of blunt snout bream. The primer amplifies microsatellite sites with 3-6 base repeats, which is accurate in typing and has high polymorphism of amplified sites.

[0006] The present invention also aims to provide an SSR multiplex fluorescent PCR method for parentage identification of blunt snout bream, which includes a set of 7 microsatellite loci, and is accurate and inexpensive.

[0007] The final object of the present invention is to provide the application of the above-described fluorescently labeled primers, kits containing said primers, or methods in paternity testing of blunt snout bream.

[0008] The first objective of this invention is achieved through the following technical solution: SSR multiplex PCR primers for parentage identification of blunt snout bream, wherein the primers include 7 pairs of specific primers, namely primer pairs MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506 and MamGLR2507, and the base sequences of the 7 pairs of specific primers are shown in SEQ ID NO.1~14 respectively.

[0009] In some preferred embodiments of the present invention, the primer pairs MamGLB2501, MamGLB2502, and MamGLB2503 are labeled with the FAM fluorescent group, the primer pairs MamGLG2504 and MamGLG2505 are fluorescently labeled with the HEX fluorescent group, and the primer pairs MamGLR2506 and MamGLR2507 are fluorescently labeled with the ROX fluorescent group. However, this is not a limitation of the present invention. The fluorescent labels can be selected according to specific circumstances. In addition, theoretically, these fluorescent labels can also be interchanged.

[0010] The present invention also provides a paternity testing kit for blunt snout bream, comprising the aforementioned SSR multiplex PCR primers for paternity testing of blunt snout bream, namely the aforementioned 7 pairs of specific primers.

[0011] Furthermore, the paternity testing kit for blunt snout bream provided by the present invention includes the aforementioned 7 pairs of specific primers, wherein primer pairs MamGLB2501, MamGLB2502, and MamGLB2503 are labeled with the FAM fluorescent group, primer pairs MamGLG2504 and MamGLG2505 are fluorescently labeled with the HEX fluorescent group, and primer pairs MamGLR2506 and MamGLR2507 are fluorescently labeled with the ROX fluorescent group.

[0012] The second objective of this invention is achieved through the following technical solution: a method for SSR multiplex fluorescent PCR for parentage identification of blunt snout bream, comprising the following steps:

[0013] (1) Extraction of DNA from blunt snout bream: Genomic DNA was extracted from parental and offspring samples of blunt snout bream;

[0014] (2) Multiplex fluorescent PCR amplification: The genomic DNA in step (1) was amplified by multiplex fluorescent PCR using the above multiplex PCR primers or kits to obtain the amplification products;

[0015] (3) Parentage testing: Genotyping of the amplified products, analysis of the parent genotype and offspring genotype using the genotyping results, and determination of the parents of the offspring individuals.

[0016] In the above-mentioned SSR multiplex fluorescent PCR method for parentage testing of blunt snout bream:

[0017] Preferably, the reaction system for multiplex fluorescent PCR amplification in step (2) is: 25 μL 2×Taq PCR Master Mix, 2 μL genomic DNA, 0.4 μL each of 10 μM forward primers, 0.4 μL each of 10 μM reverse primers, 1.5 μL bovine serum albumin (BSA), and the remainder is made up to a total system of 50 μL using ultrapure water.

[0018] Preferably, the reaction program for multiplex fluorescent PCR amplification in step (2) is as follows: pre-denaturation at 95℃ for 5 min; 27 cycles of 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s; 8 cycles of 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and finally extension at 72℃ for 30 min, followed by storage at 4℃.

[0019] In step (2) of this invention, seven pairs of specific primers are labeled with three fluorescent groups and amplified in the same tube to obtain an amplified product containing seven microsatellites.

[0020] Preferably, in step (4), the amplification products are genotyped on a gene analyzer (e.g., ABI3730XL) to read the individual genotype.

[0021] The method of SSR multiplex fluorescent PCR for parentage identification of blunt snout bream in this invention is summarized as follows: First, a set of microsatellite amplification primer combinations, containing a total of 7 pairs of specific primers, are screened and fluorescently labeled; then, each pair of fluorescently labeled specific primers is added to a reaction tube, and multiple target fragments are amplified by PCR. Then, multiple amplification products of different primers are separated by capillary electrophoresis. Finally, the separated bands are statistically analyzed, and parentage identification is performed according to Mendel's laws.

[0022] The last objective of the present invention is achieved by the following technical solution: the application of the above-described SSR multiplex PCR primers, kits, or methods in parentage testing of blunt snout bream.

[0023] The SSR multiplex PCR primers and multiplex fluorescent PCR method for parentage identification of blunt snout bream of the present invention, by selecting reliable and effective microsatellite primer combinations, utilizes multiplex PCR and capillary electrophoresis techniques to genotype blunt snout bream populations. In addition to being used for parentage identification, it can also be further used for population genetics research, germplasm resource identification, pedigree identification, and evaluation of the effects of stock enhancement and release.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] (1) The SSR multiplex PCR primers for parentage identification of blunt snout bream provided by the present invention have high polymorphism of amplification sites;

[0026] (2) The SSR multiplex PCR primers for parentage identification of blunt snout bream provided by the present invention amplify microsatellite sites with 3-6 base repeats, and the typing is accurate;

[0027] (3) The method for SSR multiplex fluorescent PCR of blunt snout bream provided by the present invention includes a set of 7 microsatellite loci. The method is accurate and inexpensive.

[0028] (4) In addition to being used for parentage identification, the primers or methods of this invention can also be promoted and applied in population genetics research, germplasm resource identification, population pedigree identification and evaluation of the effects of stock enhancement and release of blunt snout bream. Attached Figure Description

[0029] Figure 1 The image shows an agarose gel electrophoresis diagram of the PCR amplification products of the seven sites of the blunt snout bream in Example 2. From left to right, the sites are: MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506, MamGLR2507 and Marker.

[0030] Figure 2 The images show the genotype diagrams for MamP1, MamP2, and MamP3 samples genotyped using microsatellite loci MamGLB2501, MamGLB2502, and MamGLB2503 in Example 2. Image a shows the genotype diagram for MamP1 sample genotyped using the same microsatellite loci. Image b shows the genotype diagram for MamP2 sample genotyped using the same microsatellite loci. Image c shows the genotype diagram for MamP3 sample genotyped using the same microsatellite loci.

[0031] Figure 3The images show the genotype diagrams of MamP1, MamP2, and MamP3 samples genotyped using microsatellite loci MamGLG2504 and MamGLG2505 in Example 2. Image a shows the genotype diagram of MamP1 sample genotyped using microsatellite loci MamGLG2504 and MamGLG2505; image b shows the genotype diagram of MamP2 sample genotyped using microsatellite loci MamGLG2504 and MamGLG2505; and image c shows the genotype diagram of MamP3 sample genotyped using microsatellite loci MamGLG2504 and MamGLG2505.

[0032] Figure 4 The images show the genotype diagrams of MamP1, MamP2, and MamP3 samples genotyped using microsatellite loci MamGLR2506 and MamGLR2507 in Example 2. Image a shows the genotype diagram of MamP1 sample genotyped using microsatellite loci MamGLR2506 and MamGLR2507; image b shows the genotype diagram of MamP2 sample genotyped using microsatellite loci MamGLR2506 and MamGLR2507; and image c shows the genotype diagram of MamP3 sample genotyped using microsatellite loci MamGLR2506 and MamGLR2507. Detailed Implementation

[0033] The specific implementation methods of the present invention will be further illustrated below with examples.

[0034] Example 1

[0035] The SSR multiplex PCR primers for parentage identification of blunt snout bream provided in this embodiment include 7 pairs of specific primers, namely primer pairs MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506 and MamGLR2507. The base sequences of the 7 pairs of specific primers are shown in SEQ ID NO.1~14 respectively.

[0036] Primer pairs MamGLB2501, MamGLB2502, and MamGLB2503 were labeled with the FAM fluorescent group, primer pairs MamGLG2504 and MamGLG2505 were labeled with the HEX fluorescent group, and primer pairs MamGLR2506 and MamGLR2507 were labeled with the ROX fluorescent group.

[0037] In addition, fluorescent markers can be selected according to specific circumstances, and theoretically, these fluorescent markers can also be interchanged.

[0038] The seven pairs of specific primers or the seven pairs of fluorescently labeled specific primers can also be combined with other reagents conventional in the field to prepare a bream parentage test kit.

[0039] The primer was designed as follows:

[0040] Based on the reference genome sequence of *Brucea bream* (NCBI: GCF_018812025.1), the distribution and taxonomic characteristics of microsatellites were statistically analyzed, using population resequencing data (SRA: SRR28605933, SRR28605927, SRR28605926, SRR28605864, SRR28605863, SRR28605862, SRR28605795, SRR28605794, SRR28605793, SRR28605994, SRR28605993, SRR28605992, SRR28605961, SRR28605960, SRR2860). Using SRR28605777, SRR28605776, SRR28605775, SRR28605892, SRR28605883, SRR28605881, SRR28606019, SRR28605843, and SRR28605796 as targets, microsatellites on the genome were genotyped, and microsatellite loci with high polymorphism and motif lengths of 3-6 bases were screened. Primers were designed using Primer3, and after evaluating the amplification specificity of the primers and the compatibility between primer combinations, a set of multiplex SSR-PCR combinations was screened, containing 7 microsatellite loci (the sequences of the fragments containing the 7 microsatellite loci are shown in SEQ ID NO. 15~21) and 7 pairs of specific primers (the sequences are shown in SEQ ID NO. 1~14), as shown in Table 1 below:

[0041] Table 1. SSR fluorescently labeled primers and amplification products for parentage testing of blunt snout bream.

[0042]

[0043] The sequence fragment containing site MamGLB2501 is as follows:

[0044] GGAACCCATGTTGGATACTGTTCTTCTTTCTTCTCATGGCATAGATTTTATTTGATCTAATCAACATTTTTAACATTATTTTACTGTAAGATGTTCAGTGCAGGATTGGCCAAAATTTTGAAATTAAGTATTAAATTGAAATACTGAATTGGACCAATGGGAAGAGGAATTCACTGAATAGTAATCCAGTCTCTCTCTCTCTCTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAATCTTTTTTTAAATACATATTGCAGTTTTTCTCAGTTGTTTTGGCACATTTCTCATATCATCC (SEQ ID NO.15);

[0045] The fragment of the sequence where locus MamGLB2502 is located is as follows:

[0046] TATGAGTTCATGGGTGGGAAGTCACGGGTTTGACTGCTGTTCCAGTGCACTTTCACAGGTAGAAGGTTGGAAAAACATGGGTTACGGGCTGCCTGGAACGCGGCATTACACTCTTTACACTTACAATAGCTTTTAAAATCTAAATCTATGTTGTTTTGTGTCTGAAATGCAATCAATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCATAATGACTGGAAGAGGCCGTAGATCTTAATGATTGTACAGAATAATACTTGGTATCGTAAAGGCCCAAAAAAGATCTCCTGTTTGGATGTCTGATGTCTAAAGAAACACGTGTAAATCTTCTTTGAATCGATGTGTGTTGTGA (SEQ ID NO.16);

[0047] The fragment of the sequence where locus MamGLB2503 is located is as follows:

[0048] CACTCCATCTCAATCAGACAGCCACACAACACAAACAGAAACTGAATGTGGCCCCTCATGCCACTGCCGAACAACTAAAAAACAGTACATAAAAATCTGCATAAAATTAATAGCAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAATGTGATTGTCTTCAGTCTTCTCTATGAATGCTTTCAGTTAAATGTCAATAGACACGATTATATGCATGCTTACAGTTGGAAAAATGTAAACTTTATTTCGGAATACTCAGAAATGAGCATACATACAGTGTTGTGAACTTTTGTTAACTCAGCAACAATGCAAGTATGTAAAGTCCATTTAAAAAGTTATGCAGTTATGTAACTGAATTTTAAGCACTAAATTAATTAATGAAGTCATTTTAAGCACTGAATTTGCCTAACGTGCAGAAACAACCAGAACCACGTCT (SEQ ID NO.17);

[0049] The fragment of the sequence where locus MamGLB2504 is located is as follows:

[0050] ATCACCACAGAGAACAGCTTGAGACATAAAAGTCCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCATCTAAATTCAGATTGTTCAGACATTCTCAATTCATTTCTGGATCTATCTACAACCTATAACGAAACATCAAGAACTTTTTGATTCAACTCAGGAACCTTTACAGCC (SEQ ID NO.18);

[0051] The fragment of the sequence where locus MamGLB2505 is located is as follows:

[0052] GTGAGAACTTTAAGGTGGGTGGAGCAAGGATTTTGTAAGCTTCATATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCATTACAAGAGCGTTACTAACTTTAGTAGCAGACTCTGGTAATTTG AGGCCTCAATGCTGCTCTACCCCAGCACCAGCCTACTCAGGTAAATCGAACAATGGCTTTGTTTCTTTTTCTCTGCTTTCTTCTGGGCCTGAAAACAGATGAAGGGACAATCTGAACTTTAGAAGAAAAAATGAAGACCCAAATTGAGGCTA (SEQ ID NO.19);

[0053] The sequence fragment containing site MamGLB2506 is as follows:

[0054] GATGTCTTCAGCTAGTCCGCTTGAGATCCTGAGATCCTTTCCATCTAAACTGGTTATATCTCTTAAGCCTAGTAGCCTAGTGAATGTATTGAGAAGTTGAGAAGTAAAATCATCTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCTCTTATTTTATTACATTGTTAATAACCATATTCATCCGCACAGT (SEQ ID NO. 20);

[0055] The sequence fragment containing site MamGLB2507 is as follows:

[0056] TCCTGGTTACCGAATCCTTCTAAAGCATCAGTAGACTATAGCAATGTAGTCTGATTAATTTCATCATGGCAGCGTTGTTTTGTAAATACATGGGCACGTTGAGGCAATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCATAAAAAATCTGCTAAATGTACTGTAAATAAATAACCATAAATTTTATGTAAAAATACACTAATAACCAAAGTTTATCATAACAAGCCTGTTCATAAACATAGCC (SEQ ID NO.21).

[0057] Example 2

[0058] The SSR multiplex fluorescent PCR method for parentage testing of blunt snout bream provided in this embodiment includes the following steps:

[0059] (1) Extraction of DNA from blunt snout bream: Genomic DNA was extracted from parental and offspring samples of blunt snout bream;

[0060] Total genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit. For specific steps, please refer to the kit instructions. After DNA extraction, the concentration was detected using a UV spectrophotometer.

[0061] (2) Multiplex fluorescent PCR amplification: The genomic DNA in step (1) was amplified by multiplex fluorescent PCR using the SSR multiplex PCR primers or kits in Example 1 to obtain the amplification products;

[0062] The multiplex fluorescent PCR amplification reaction system consisted of: 25 μL 2×Taq PCR Master Mix, 2 μL genomic DNA, 0.4 μL each of 10 μM forward primers, 0.4 μL each of 10 μM reverse primers, 1.5 μL bovine serum albumin (BSA), and the remainder was made up to a total volume of 50 μL using ultrapure water.

[0063] The multiplex fluorescent PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ for 30 s, 60℃ for 90 s, 72℃ for 30 s, 27 cycles; 95℃ for 30 s, 58℃ for 90 s, 72℃ for 30 s, 8 cycles; and finally extension at 72℃ for 30 min, followed by storage at 4℃.

[0064] (3) Parentage testing: Genotyping of the amplified products, analysis of the parent genotype and offspring genotype using the genotyping results, and determination of the parents of the offspring individuals.

[0065] Multiplex PCR products were genotyped on an automated sequencer (ABI 3730XL) to read individual genotypes.

[0066] Example 3

[0067] The following specific examples illustrate the application of the above-mentioned SSR fluorescently labeled primers or methods in paternity testing of blunt snout bream.

[0068] (1) Extracting DNA from blunt snout bream

[0069] Fin rays from eight parental individuals (MamP1~MamP8) and 30 offspring individuals (Mam01~Mam30) of blunt snout bream were cut and immediately preserved in 95% ethanol. The parental individuals were designated as MamP1-MamP8, and the offspring individuals were designated as Mam01-Mam30. Total genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit. For specific steps, please refer to the kit instructions. After DNA extraction, the concentration was detected using a UV spectrophotometer.

[0070] (2) Multiplex fluorescent PCR amplification: Same as in Example 2;

[0071] After PCR, 5 µL was electrophoresed on an agarose gel to detect diffuse bands of the expected size, and the rest were sent to a commercial company for genotyping using an ABI 3730XL.

[0072] The electrophoresis diagram of the amplified bands at each site was verified using agarose gel electrophoresis, as shown below. Figure 1 As shown, from Figure 1 The results show that the bands amplified by the seven primer pairs are clear and bright, indicating primer specificity. It's worth noting that there is a band around 800 bp at site MamGLB2502 (second lane from the left) and a band around 400 bp at site MamGLG2505 (fifth lane from the left). These two bands are easily distinguishable from the target site on the gene analyzer, meaning they are not within the target site's amplification range. Sites MamGLB2501, MamGLB2502, and MamGLB2503 are all labeled with FAM fluorescence, with amplified fragments ranging from 273 to 482. Sites MamGLG2504 and MamGLG2505 are both labeled with HEX fluorescence, with amplified fragments ranging from 168 to 337. The non-specifically amplified bands are all outside the target range. This can be seen in the genotyping graph, where the peaks are clean and orderly, without any extraneous peaks.

[0073] Genotyping diagrams of MamP1, MamP2, and MamP3 samples were generated using microsatellite loci (MamGLB2501, MamGLB2502, MamGLB2503, MamGLB2504, MamGLB2505, MamGLB2506, MamGLB2507) amplified by SSR multiplex PCR primers (primer pairs MamGLB2501, MamGLB2502, MamGLB2503, MamGLB2504, MamGLB2505, MamGLB2506, MamGLB2507) for parentage identification of blunt snout bream. Figures 2-4 As shown;

[0074] from Figures 2-4 The peak shape of the amplification site can be determined to be stable, accurate, and easy to interpret.

[0075] (3) The genotype of each locus was read using the software GeneMarker V2.2.2.0. Table 2 shows the genotype data of the parents and offspring of the blunt snout bream, and Table 3 shows the genetic parameters of the parent population.

[0076] Table 2. Alleles of parents and offspring

[0077]

[0078] Using the PAPA 2.0 software, paternity testing was conducted, and the parents of all offspring Mam01-Mam30 were MamP1 and MamP2.

[0079] Table 3. Genetic parameters of the parental populations at 7 microsatellite loci in the blunt snout bream population.

[0080]

[0081] Note: Locus: locus, Na: number of alleles, Ne: effective number of alleles, I: Shannon information index, Ho: observed heterozygosity; He: expected heterozygosity; F: fixation index.

[0082] Tables 2 and 3 show that seven loci exhibit high polymorphism and stable peak shapes, which can be used for batch detection of populations and can be applied to parentage identification and pedigree construction in breeding.

[0083] The above results demonstrate that the microsatellite 7-fold fluorescence PCR method of the present invention is stable and accurate in the genotyping of blunt snout bream populations, meeting the requirements for germplasm identification, family management, and evaluation of the effects of propagation and release of blunt snout bream.

[0084] The above description is only a non-limiting embodiment of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention and without creative effort, and these all fall within the protection scope of the present invention.

Claims

1. A multiplex PCR primer for parentage identification of Megalobrama amblycephala, characterized in that, The primers include 7 pairs of specific primers, namely primer pairs MamGLB2501, MamGLB2502, MamGLB2503, MamGLG2504, MamGLG2505, MamGLR2506 and MamGLR2507, wherein each pair of primers includes one forward primer and one reverse primer, and the base sequences of the 7 pairs of specific primers are shown in SEQ ID NO. 1-14, respectively.

2. The SSR multiplex PCR primer for parentage identification of Megalobrama amblycephala according to claim 1, characterized in that, The primer pairs MamGLB2501, MamGLB2502 and MamGLB2503 are labeled with FAM fluorescent groups, the primer pairs MamGLG2504 and MamGLG2505 are labeled with HEX fluorescent groups, and the primer pairs MamGLR2506 and MamGLR2507 are labeled with ROX fluorescent groups.

3. A kit for parentage identification of Acipenser baerii, characterized in that, The SSR multiplex PCR primers for parentage identification of Megalobrama amblycephala according to claim 1.

4. The kit for parentage testing of Megalobrama amblycephala according to claim 3, characterized in that, The primer pairs MamGLB2501, MamGLB2502 and MamGLB2503 are labeled with FAM fluorescent groups, the primer pairs MamGLG2504 and MamGLG2505 are labeled with HEX fluorescent groups, and the primer pairs MamGLR2506 and MamGLR2507 are labeled with ROX fluorescent groups.

5. A method for parentage identification of Megalobrama amblycephala by SSR multiplex fluorescence PCR, characterized in that, The method comprises the following steps: (1) extracting DNA of Megalobrama amblycephala: collecting parent samples and offspring samples of Megalobrama amblycephala, and extracting genomic DNA; (2) multiplex fluorescent PCR amplification: performing multiplex fluorescent PCR amplification on the genomic DNA in step (1) by using the multiplex PCR primers in claim 2 or the kit in claim 4 to obtain an amplification product; (3) parentage identification: performing genotyping on the amplification product, and analyzing the parent genotypes and offspring genotypes by using the genotyping results to determine the parents of the offspring individual.

6. The SSR multiplex fluorescence PCR method for identifying the parentage of Megalobrama amblycephala according to claim 5, characterized in that, The reaction system of the multiplex fluorescent PCR amplification in step (2) is as follows: 25 μL of 2 × Taq PCR Master Mix, 2 μL of genomic DNA, 0.4 μL of each forward primer with a concentration of 10 μM, 0.4 μL of each reverse primer with a concentration of 10 μM, 1.5 μL of bovine serum albumin (BSA), and the rest is supplemented with ultrapure water to a total system of 50 μL.

7. The method according to claim 5, wherein the method is a multiplex fluorescent PCR method for parentage identification of the giant gourami (A. laticeps) using SSR markers. The reaction program of the multiplex fluorescent PCR amplification in step (2) is as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ for 30 s, 60 ℃ for 90 s, 72 ℃ for 30 s, 27 cycles; 95 ℃ for 30 s, 58 ℃ for 90 s, 72 ℃ for 30 s, 8 cycles; finally, 72 ℃ extension for 30 min, and 4 ℃ storage.

8. The method according to claim 5, wherein the method is a multiplexed fluorescent PCR method for parentage identification of the Amur catfish (H. molitrix) using SSR markers. In step (3), the amplification product is subjected to genotyping on a gene analyzer, and the individual genotype is read.

9. The use of the SSR multiplex PCR primers according to claim 1 or 2, or the kit according to claim 3 or 4 in parentage identification of Megalobrama amblycephala.

10. The use of the method according to any one of claims 5-8 in parentage identification of Megalobrama amblycephala.

Images