CTL epitope polypeptide of bovine herpes virus and application of CTL epitope polypeptide

By screening and validating the binding of BoHV-1 specific CTL epitope peptides to bovine MHC-I molecules, CD8+ T cells were activated, solving the immunogenicity and safety issues of existing vaccines and achieving effective immune control of bovine infectious rhinotracheitis.

CN121554545APending Publication Date: 2026-02-24CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511674650.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

The existing bovine herpesvirus type 1 vaccine has limited immunogenicity and protective efficacy, and poses safety risks, making it difficult to effectively control bovine infectious rhinotracheitis.

Method used

By using weak acid elution peptide technology combined with mass spectrometry analysis, CTL epitope peptides that bind to bovine MHC-I molecules (BoLA-I) were screened from BoHV-1-infected MDBK cells. In vitro refolding verification confirmed that the peptides stably bind to BoLA-I molecules and activate CD8+ T cells to generate an immune response.

Benefits of technology

The selected BoHV-1 specific CTL epitope peptide can stably bind to BoLA-I molecules, activate CD8+ T cells, and significantly enhance the immune response. It has high specificity and safety, and can be used to prepare vaccines to significantly improve the immunoprotection effect against IBR.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses a CTL epitope polypeptide of bovine herpesvirus and application thereof, and belongs to the technical field of polypeptide vaccine preparation. The CTL epitope polypeptide of the bovine herpesvirus disclosed by the invention is a polypeptide with an amino acid sequence of SEQ ID No. 1 or SEQ ID No. 2. The BoHV-1 specific CTL epitope polypeptide can be stably combined with BoLA-I molecules, has the potential of activating CD8 + T cells to generate immune response and inducing an organism to generate specific CTL reaction, can be used as a vaccine component to be applied to preventive immunity of BoHV-1, can be used for preparing BoHV-1 specific antigen epitope vaccines or polypeptide vaccines, and can be applied to preparation of the BoHV-1 specific antigen epitope vaccines or polypeptide vaccines. The monoclonal antibody has the advantages of high specificity, good safety, strong immunogenicity and the like, and has remarkable application potential and popularization value in immune prevention and control of infectious bovine rhinotracheitis (IBR).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of polypeptide vaccine preparation technology, specifically relating to CTL epitope polypeptides of bovine herpesvirus and their applications. Background Technology

[0002] Infectious bovine rhinotracheitis (IBR) is a highly contagious viral disease caused by bovine alphaherpesvirus-1 (BoHV-1). It primarily affects the respiratory and reproductive systems of cattle, manifesting as fever, cough, rhinitis, conjunctivitis, and abortion. It severely impacts the health and reproductive performance of cattle herds, causing significant economic losses to the livestock industry. BoHV-1 is a double-stranded DNA virus belonging to the alphaherpesvirus subfamily of the herpesviridae family. Its genome has a complex structure, exhibiting both conservation and variability. Based on molecular characteristics and serological responses, BoHV-1 is often classified into subtypes such as BoHV-1.1, BoHV-1.2a, and BoHV-1.2b. BoHV-1.1 mainly causes respiratory infections, while BoHV-1.2 is more likely to cause damage to the reproductive system. The virus can remain dormant in the ganglia after infecting a host, and then reactivate when the host's immunity declines, leading to the re-spread of the virus and disease recurrence, which increases the difficulty of prevention and control.

[0003] Currently, the primary means of controlling IBR is vaccination, including inactivated vaccines and live attenuated vaccines. While inactivated vaccines have a relatively high safety profile, their immunogenicity and protective efficacy are limited due to impaired antigen integrity. Live attenuated vaccines, although capable of evoking a strong immune response, pose potential safety risks. In recent years, novel vaccine strategies such as subunit vaccines, peptide vaccines, and DNA vaccines have emerged, with vaccines inducing cytotoxic T lymphocyte (CTL) responses becoming a research focus. Major histocompatibility complex class I (MHC-I) molecules play a crucial role in this process, presenting intracellular antigenic peptides to the cell surface for CD8 expression. + T cells recognize and initiate a CTL response to kill virus-infected cells. In this process, the virus-derived peptides presented by MHC-I are CTL epitope peptides, which are a prerequisite for the initiation of cellular immune responses. Therefore, this process forms the basis for research on cellular antiviral immune responses and provides conditions for the development of novel peptide epitope vaccines.

[0004] BoHV-1 encodes numerous proteins, but its potential epitopes have not been systematically elucidated, limiting the development of epitope vaccines. Recent studies have shown that BoHV-1 envelope glycoproteins, especially glycoprotein B (gB), are key antigens inducing strong immune responses, making them important targets for vaccine design and antigenic peptide screening. Precise screening of antigenic epitopes and recognition of CTL epitope peptides can effectively improve vaccine specificity and immunogenicity, providing theoretical and experimental basis for the development of novel peptide vaccines. Therefore, identifying BoHV-1-specific CTL epitopes and developing epitope vaccines based on these epitopes can not only enhance cellular immune responses and improve vaccine protection but also mitigate the safety risks of traditional vaccines, opening new avenues for the effective prevention and control of IBR. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide bovine herpesvirus type 1 CTL epitope polypeptide.

[0006] The bovine herpesvirus type 1 CTL epitope polypeptide provided by this invention is as follows: A1), A2), or A3). A1) The amino acid sequence of the polypeptide is SEQ ID No. 1 or SEQ ID No. 2; A2) A polypeptide having more than 80% identity with and the same function as A1) by substitution and / or deletion and / or addition of one or two amino acid residues of the sequence of SEQ ID No. 1 or SEQ ID No. 2; A3) is a fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).

[0007] In the polypeptides described in A2) above, having more than 80% identity means having 80%, 85%, 90%, or 95% or more identity. Identity refers to the identity of the amino acid sequence. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0008] The polypeptides in A2 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0009] The tag described in A3) can be a polypeptide or protein fused with the target polypeptide using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target polypeptide. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0010] The present invention also provides biomaterials related to the said polypeptide, said biomaterials being any one of B1) to B4) below: B1) A nucleic acid molecule encoding the polypeptide; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0011] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0012] Those skilled in the art can readily mutate the nucleotide sequence encoding the polypeptide of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the polypeptide isolated in the present invention, as long as they encode the polypeptide and have the function of the polypeptide, are derived from and equivalent to the nucleotide sequence of the present invention.

[0013] B2) The expression cassette (peptide gene expression cassette) containing a nucleic acid molecule encoding the polypeptide refers to DNA capable of expressing the polypeptide in a host cell. This DNA may include not only a promoter to initiate transcription of the polypeptide gene but also a terminator to terminate transcription of the polypeptide gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0014] Recombinant vectors containing the polypeptide gene expression cassette can be constructed using existing expression vectors.

[0015] The vector may be a plasmid, granule, bacteriophage, or viral vector.

[0016] The microorganisms may be yeast, bacteria, algae, or fungi.

[0017] The present invention also provides a product containing (or having its active ingredient as) the polypeptide or the biomaterial.

[0018] Specifically, the product in question is a vaccine or a drug.

[0019] The use of the polypeptide or the biomaterial in the preparation of products for the treatment and / or prevention of bovine herpesvirus type 1 infection is also within the scope of protection of this invention.

[0020] Specifically, the product in question is a vaccine or a drug.

[0021] The application of the polypeptide or the biomaterial in enhancing the production of CD8+ T cells in the body, or in the preparation of CD8+ T cells, or in the evaluation of CTL reactions or the preparation of products for the evaluation of CTL reactions, is also within the scope of protection of this invention.

[0022] The application of the polypeptide or the biological material in the preparation of bovine herpesvirus type 1 antibody or antiserum is also within the scope of protection of this invention.

[0023] The application of the polypeptide or the biological material in the preparation of reagents or kits for detecting bovine herpesvirus type 1 is also within the scope of protection of this invention.

[0024] The complex formed by the polypeptide and the BoLA-I molecule is also within the scope of protection of this invention.

[0025] This invention utilizes weak acid eluent (MAE) technology combined with mass spectrometry to screen naturally presented peptides from BoHV-1-infected MDBK cells. Furthermore, it employs a bovine MHC-I class molecule (BoLA-I) binding motif database for preliminary screening of potential CTL epitope peptides. In vitro refolding experiments preliminarily validated that these potential epitope peptides can stably bind to BoLA-I molecules and activate CD8+. + The potential of T cells to generate an immune response and induce specific CTL reactions in the body is represented by BoHV-1-specific CTL epitope peptides. The BoHV-1-specific CTL epitope peptides of this invention can be used as vaccine components for prophylactic immunization against BoHV-1. The peptides of this invention can be used to prepare BoHV-1-specific antigenic epitope vaccines or peptide vaccines, exhibiting advantages such as high specificity, good safety, and strong immunogenicity. They have significant application potential and promotional value in the immunization and control of bovine infectious rhinotracheitis (IBR).

[0026] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0027] Figure 1 BoHV-1 CTL epitope peptide 1's ability to kill specific T cells.

[0028] Figure 2 BoHV-1 CTL epitope peptide 2's ability to kill specific T cells. Detailed Implementation

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0030] In the quantitative experiments described below, at least three replicates were performed. The data in the following examples were processed using the statistical software GraphPad Prism, and the experimental results are expressed as mean ± standard deviation.

[0031] Example 1: Screening and identification of bovine herpesvirus type 1 CTL epitope polypeptides 1. Identification of peptide-binding motifs and peptide length preferences of bovine MHC-I (BoLA-I) alleles using PRLD-MS. 1.1 Expression and purification of BoLA-I inclusion bodies pET-28a-BoLA-2*048:01: The coding gene for the extracellular region of the heavy chain α1-α3 of BoLA-2*048:01 was inserted between the multiple cloning sites of pET-28a(+) to obtain a recombinant plasmid that can express the extracellular region of the BoLA-I heavy chain α1-α3.

[0032] pET-28a-BoLA-2*099:01: The coding gene for the extracellular region of the heavy chain α1-α3 of BoLA-2*099:01 was inserted between the multiple cloning sites of pET-28a(+) to obtain a recombinant plasmid that can express the extracellular region of the BoLA-I heavy chain α1-α3.

[0033] pET-21a-BoLA-I: The bovine β2 microglobulin CDS region (encoding the extracellular region of the BoLA-I light chain) is inserted between the multiple cloning sites of pET-21a(+). This recombinant plasmid can express the extracellular region of the BoLA-I light chain (i.e., BoLA-I light chain protein, which can also be referred to as β2m protein).

[0034] The gene sequences encoding the extracellular regions of the heavy chain α1–α3 of BoLA-2*048:01 are as follows: atgGGTTCTCACAGCCTGCGTTACTTCTACACCGCAGTGAGCCGTCCAGGTCTGGGTGAACCGCGTTTCATCTCCGTTGGTTACGTTGACGACACTCAGTTCGTGCGTTTCGACTCTGATTCCGCAAATCCGCGTGAAGAACCACGTGCACCGTGGATGGAACAAGAAGGTCCGGAATACTGGGACGAACAGACTCGTATCGTTAAAGATACCGCACAGAGCTTCCGTGTAGGTCTGAACACTCTGCGTGGCTACTATAACCAGTCCGAAGCGGGTTCTCATACCTTGCAGCTGATGTACGGTTGCGATGTAGGTCCAGATGGTCGCTTTCTGCGTGGTTTCATGCAAGACGCTTACGATGGTCGTGATTACATCGCTCTGAACGAAGACCTGCGTTCTTGGACCGCTGCTGACACTGCTGCTCAGATCACCAAACGTAAACGTGAAGCTGCTGGTGCTGCTGAACGTCAGCGTAACTACCTGGAAGGTCGTTGTGTTGAAGGTCTGCGTCGTTACCTGGAAAACGGTAAAGACGCTCTTCTGCGTGCAGATCCACCGAAAGCTCACGTGACTCACCATCCAATCTCTGAACGTGAAGTTACTCTGCGCTGTTGGGCTCTGGGTTTCTACCCGGAAGAAATCTCTCTGACCTGGCAGCGTGAAGGTGAAGATCAGACTCAAGACATGGAACTGGTTGAAACTCGTCCGTCTGGTGACGGCACCTTCCAGAAATGGGCTGCTCTGGTTGTACCGTCCGGTGAAGAACAGCGTTACACCTGCCGTGTTCAGCACGAAGGTCTGCAAGAACCGCTGACTCTGCGTTGGGAACCACCGCAGACCAGCTTCTAA。

[0035] The coding gene sequence of the extracellular regions α1-α3 of the heavy chain of BoLA-2*099:01 is as follows: atgGGCTCTCACAGCCTTCGTTACTTCTACACCGGCGTTTCTCGTCCAGGTCTGGGTGAACCACGTTTCATCGCGGTTGGTTACGTTGACGACACTCAGTTCGTTCGTTTCGACTCTGATGCTCCAGATCCGCGTACCGAACCACGTGTTCGTTGGGTTGAACAAGAAGGTCCGGAATACTGGGACCGTGAAACCCGTAACCTGAAAGACGCAGCTCAGACCTTCCGTGTTAACCTGAACACCGCACTGGGTTACTACAACCAGTCTGAAGCAGGTTCTCACACCATCCAGGCTATGTACGGTTGCGATGTTGGTCCAGACGGTCGTCTGCTGGGTGGTTTCATGCAAGACGCTTACGACGGTCGTGACTACATCGCTCTGAACGAAGACCTGCGTAGCTGGACCGCAGCTGATACCGCAGCGCAGATCACCAAACGTAAATGGGAAGCGGAAGGTTACGCGGAAGTTCAGCGTAACTACCTGGAAGGTGAATGCGTTGAATGGCTTCGTCGTTACCTGGAAACTGGTAAAGACACCTTGCTGCGTGCTGATCCACCGAAAGCGCACGTTACTCACCATCCGATCTCTGAACGCGAAGTTACTCTGCGTTGCTGGGCACTGGGTTTCTATCCAGAAGAAATCAGCCTGACCTGGCAGCGTGAAGGTGAAGATCAGACTCAGGACATGGAACTGGTTGAAACTCGTCCATCCGGTGATGGTACTTTCCAGAAATGGGCGGCACTGGTTGTTCCGTCTGGTGAAGAACAGCGTTACATGTGCCGTGTACAGCACGAAGGTCCGCAAGAACCGCTGACTTTGCGTTGGGAACCACCGCAGACCAGCTTCTAA。

[0036] The sequence of the CDS region of bovine β2-microglobulin (i.e., the extracellular region of the BoLA-I light chain) is as follows: atgATCCAGCGTCCGCCGAAGATCCAGGTGTACTCTCGTCATCCGCCAGAAGATGGTAAACCGAACTACCTGAACTGCTACGTTTACGGTTTCCATCCGCCACAGATCGAAATCGACCTGCTGAAGAACGGTGAGAAGATCAAATCCGAA CAGTCTGACCTGTCTTTCCTAAAGATTGGTCTTTCTACCTGCTGTCTCACGCAGAGTTCACTCCGAACTCTAAAGACCAGTACTCTTGCCGTGTTAAACACGTTACTCTGGAACAGCCACGTATCGTGAAATGGGACCGTGACCTGTAA.

[0037] The heavy chain expression recombinant plasmids pET-28a-BoLA-2*048:01, pET-28a-BoLA-2*099:01, and pET-21a-BoLA-I were introduced into E. coli, respectively. After expression verification, the plasmids were mass-produced and induced to express in large quantities by adding IPTG. The collected bacterial cells were disrupted by low-temperature sonication, centrifuged at 12,000 rpm for 10 min, washed with 20 mL washing buffer (0.5% Triton-100, 50 mM Tris pH 8.0, 300 mM NaCl, 10 mM EDTA, 10 mM DTT), and centrifuged at 12,000 rpm for 10 min. This process was repeated once. Wash with 20 mL resuspension buffer (50 mM Tris pH 8.0, 100 mM NaCl, 10 mM EDTA, 10 mM DTT), and take 20 μL for SDS-PAGE identification. Centrifuge at 12000 rpm for 10 min, weigh, and dissolve the precipitate in guanidine hydrochloride denaturing solution (6 M guanidine hydrochloride, 10% glycerol, 50 mM Tris pH 8.0, 100 mM NaCl, 10 mM EDTA, 10 mM DTT) at a concentration of 30 mg / mL.

[0038] 1.2 Identification of BoLA-I peptide binding motifs and peptide length preferences BoLA-I light chain protein and randomly synthesized peptides (8-11 amino acids in length, excluding cysteine) were sequentially diluted and refolded with BoLA-I heavy chain protein in equimolar amounts. The peptide-MHC-I complex was then purified by molecular sieve and ion exchange. The peptide was eluted with pure acetic acid at 65°C for 30 min using 0.02 N mass spectrometry. The eluent was desalted using an OASIS HLB 1CC 30MG 100BX desalting column, filtered through a 0.5 mL 3 kD ultrafiltration tube, and the filtrate was evaporated to dryness using a vacuum concentrator. The sample was reconstituted in 15 μL volume for LC-MS and DeNovo analysis. Peptides with ALC ≥ 30% and lengths of 8 to 11 amino acids were selected. The length distribution of peptides binding to BoLA-2*048:01 and BoLA-2*099:01 was analyzed, and peptide binding maps were constructed using Seq2Logo-2.0 to obtain the peptide binding motif and length preference of BoLA-I. The results showed that the length preference of BoLA-2*048:01 binding peptides was 9 amino acids long, followed by peptides with a length of 10 amino acids, then peptides with a length of 11 amino acids, and finally peptides with a length of 8 amino acids. The peptide binding motif was XH / N / G-XXXXXX-W / Y / F (nonapeptide form). The length preference of BoLA-2*099:01 binding peptides was 8 or 9 amino acids long, followed by peptides with a length of 10 amino acids, then peptides with a length of 11 amino acids. The peptide binding motif was XXXXXXXX-W / Y / T (nonapeptide form).

[0039] 2. Isolation of MHC-I immune peptides 2.1 Determine the viral infection titer and infection time MDBK (NBL-1) cells were infected with BoHV-1 (BK1295 strain) at MOIs of 0.1, 0.01, 0.005, and 0.001 (Liu Mengyao, Wang Zhanhui, Wu Hao, et al. Establishment of a quadruple real-time quantitative RT-PCR detection method for bovine astrovirus, bovine viral diarrhea virus type 1, bovine coronavirus, and bovine rotavirus [J]. Chinese Journal of Animal Husbandry and Veterinary Medicine, 2021, 52(07):1942-1952.). Cytopathic effects at each infection titer were observed and recorded every 4 h. The infection time at which cytopathic effects were about to occur was used as the treatment time for MHC-I immunopeptide isolation. At 48 h after infection with 0.001 MOI BoHV-1, the virus completed its replication cycle and cytopathic effects were about to appear; samples were collected at this time.

[0040] 2.2 MAE method for eluting peptides (1) Preparation of MAE buffer: Mix 131 mM citric acid, 66 mM Na2HPO4, 150 mM NaCl, 1 μM Maprotinin and 25 mM iodoacetamide, add about 4 mL of liquid chromatography-mass spectrometry (LC-MS) and dissolve in water, and adjust the pH of the solution to 3.0 with NaOH; (2) Culture MDBK (NBL-1) cells (5×10⁻⁶) 8 Cells were infected with BoHV-1 virus solution at 0.001 MOI for 48 h, washed with PBS, and the cell pellet was collected by scraping. (3) Add 4 mL of MAE buffer to the cell pellet of each experimental group, and repeatedly pipette to ensure that the cells and buffer are fully mixed and in contact, and process for 1 min. Collect all liquid, centrifuge at 300 × g for 5 min, 350 × g for 10 min, 3400 × g for 15 min, and 20000 × g for 1 h. Replace the collection tube with a new one after each centrifugation, collect the supernatant and continue centrifugation, and retain the supernatant from the last centrifugation.

[0041] 2.3 Sample pretreatment for LC-MS identification Desalting was performed using an OASIS HLB 1 CC 30 MG 100 BX column. The desalted sample was added to a 0.5 mL 3 kD ultrafiltration tube and centrifuged at 4 °C and 13500 rpm until less than 100 μL of the supernatant remained. The filtrate in the collection tube was collected to obtain the peptide filtrate, which was stored at -80 °C.

[0042] 2.4 LC-MS Identification and Database Search Analysis (1) The sample was transferred to a vacuum concentrator for concentration. The cold trap temperature was set to -50℃, the sample chamber temperature to 45℃, and the rotation speed to 1400 rpm. Vacuum centrifugation was performed until the filtrate was completely evaporated. The sample was then reconstituted in 15 μL for LC-MS identification. (2) Database Search and Parameter Settings: The protein database used for the search includes the BoHV-1, Bos taurus, and Equus caballus protein sequences from the UniProt database. Peaks software was used for the database search, and the specific parameter settings are as follows:

[0043] (3) The results of the cell-washed peptide search are shown in Table 1. The search results were sorted out, and peptides with a length of 8-11 amino acids were screened and their frequency of occurrence was counted.

[0044] Table 1 Search Results

[0045] In Table 1, the numbers represent the number of single peptides matched during the LC-MS database search, and the numbers in parentheses represent the total number of matches; control group: cells not infected with BoHV-1 virus served as the control.

[0046] 3. Screening for bovine MHC-I-restricted BoHV-1 CTL epitope peptides Based on the peptide binding motif and peptide length preference of BoLA-I molecules, three BoHV-1 peptides that conform to the peptide binding motif in the MHC-I immunopeptide group separation results were initially screened as candidate CTL epitopes, as shown in Table 2. The following peptides were synthesized by the Fmoc method and purified by HPLC, requiring a peptide purity of over 98%.

[0047] Table 2 Candidate BoHV-1CTL epitope peptides

[0048] 4. In vitro binding assay to verify the binding of BoHV-1 CTL epitope peptide to bovine MHC-I. 4.1 In vitro binding verification Prepare a 250 mL refolding solution containing 50 mM Tris pH 8.0, 200 mM L-arginine, 1 mM EDTA, 0.3827 g of reduced glutathione, and 0.0766 g of glutathione. In 250 mL of refolding solution, 1.5 mL of β2m inclusion body solution (i.e., the extracellular region of BoLA-I light chain obtained in step 1) was added dropwise to the refolding solution. After refolding for 12 h, 1 mg of BoHV-1 CTL epitope peptide dissolved in DMSO was added. After thorough mixing, 4.5 mL of BoLA-I α chain inclusion body solution (i.e., the extracellular region of BoLA-I heavy chain α1 to α3 obtained in step 1) was added dropwise for refolding. The molar ratio of heavy chain, light chain and BoHV-1 CTL epitope peptide was 1:1:5. After refolding for 24 h, the solution was concentrated to below 20 mL. The solution was replaced with molecular sieve (20 mM Tris-HCl pH 8.0, 50 mM NaCl) and highly concentrated to below 10 mL. The pBoLA-I complex was initially purified by molecular sieve gel column chromatography (HiLoad® 16 / 600 Superdex® 200pg), and samples were taken for SDS-PAGE purity identification. The target protein peak generally appeared between 80-100 mL. The results showed that BoHV-1 CTL epitope peptide 1 and epitope peptide 2 strongly bound to the corresponding BoLA-I molecules, while epitope peptide 3 did not bind to BoLA-2*099:01.

[0049] For complexes with good molecular sieve gel chromatography results, further purification was performed using ion exchange chromatography (Resource Q, GE), and samples were taken for SDS-PAGE purity identification to detect the stability of the binding between BoHV-1 CTL epitope peptide 1 and BoLA-I molecules. The results showed that BoHV-1 CTL epitope peptide 1 and epitope peptide 2 could stably bind to BoLA-I molecules containing corresponding anchoring residues to form pBoLA-I complexes. In vitro refolding experiments preliminarily confirmed that BoHV-1 CTL epitope peptide 1 and epitope peptide 2 are positive CTL epitopes.

[0050] 4.2 Obtaining pBoLA-I crystals of BoHV-1 CTL epitope polypeptide 1 by the sitting drop method The selected BoLA-I proteins, capable of withstanding anion exchange, were combined with BoHV-1 CTL epitope peptides to further expand the system for in vitro refolding and purification to obtain more pBoLA-I complexes. In each 500 mL refolding system, 3 mL of light chain (i.e., the extracellular region of the BoLA-I light chain obtained in step 1), 9 mL of heavy chain (i.e., the extracellular region of the BoLA-I heavy chain α1–α3 obtained in step 1), and 2 mg of the corresponding epitope peptide were added. The refolded protein solutions were then diluted to two concentrations: 2 mg / mL and 4 mg / mL. Ten different crystal screening kits (Index1-48, Index49-96, Crystal Screen, Crystal Screen 2, PEG / lon, and PEG / lon 2) were used to perform protein crystallization experiments using the sitting drop method to observe whether these pBoLA-I complexes could form stable crystals.

[0051] The results showed that the BoLA-I and BoHV-1 epitope peptide combinations, which are resistant to anion exchange, could generally grow needle-like pBoLA-I complex crystals. Specifically, the BoHV-1 CTL epitope peptide 1 and the BoLA-2*048:01 complex grew as single, regular polyhedral crystals in different pooling solutions; or in a radial pattern, consisting of multiple transparent, sheet-like structures growing outwards from the center, with clear outlines and a degree of stacking. This further demonstrates the stability of the corresponding epitope peptides binding to BoLA-I, confirming them as positive CTL epitopes.

[0052] 5. Detect the killing ability of BoHV-1 CTL epitope peptide-specific T cells. Using bovine strain 25 expressing BoLA-2*048:01 (obtained by detecting BoLA-2*048:01 expression), peripheral blood was collected from bovine strains BK1295 after challenge with BoHV-1. Peripheral blood cells (PBMCs) were isolated and resuspended in 1640 medium containing 10% FBS to 10 mL. BoHV-1 CTL epitope peptide 1 was added to a final concentration of 2 μM, and cells were stimulated for 24 h. Cells were then collected by centrifugation, and a second round of stimulation was performed under the same conditions to obtain BoHV-1 CTL epitope peptide 1-specific T cells. The cells were then resuspended in 1640 medium, counted, and used as effector cells for further cytotoxicity experiments.

[0053] To evaluate the ability of MDBK target cells to present BoHV-1 CTL epitope peptide 1, RNA was extracted from these cells and subjected to genomic DNA removal and reverse transcription. Third-generation sequencing confirmed the expression of BoLA-2*048:01 mRNA. As shown in step 4 of Example 1, BoLA-2*048:01 can bind to BoHV-1 CTL epitope peptide 1, indicating that MDBK possesses the ability to present this peptide.

[0054] BoHV-1 CTL epitope peptide 1 at a final concentration of 2 μM was added to a pre-cultured MDBK target cell system and stimulated for 12 h before being used as target cells for the next step of cytotoxicity experiments.

[0055] Cytotoxicity assay: The above effector cells were added to the target cells according to different effector-to-target ratios and co-cultured at 37℃ and 5% CO2 for 12 h. The absorbance was measured, cytotoxicity was calculated, and a killing curve was plotted with the effector-to-target ratio (E:T) as the x-axis and the percentage of cytotoxicity as the y-axis.

[0056] Sample group absorbance = A 450 (Experimental Group) - A 450 (Negative control group); Spontaneous release absorbance = A 450 (Spontaneous Release Group) - A 450 (Negative control group); Maximum release absorbance = A 450 (Maximum Release Group) - A 450 (Negative control group); .

[0057] The test included: negative control (culture medium only); spontaneous release group (target cells + culture medium); and maximum release group (target cells + LDH release reagent + culture medium). The LDH release reagent is from the lactate dehydrogenase (LDH) cytotoxicity assay kit (Beyotime Biotechnology).

[0058] The results are as follows Figure 1 As shown, BoHV-1 CTL epitope peptide 1-specific T cells exhibit significant killing ability, capable of killing target cells presenting BoHV-1 CTL epitope peptide 1, and this killing effect increases with increasing effector-to-target ratio. Target cells of BoHV-1 CTL epitope peptide 1 can be used to eliminate BoHV-1 infected cells.

[0059] The specific T-cell killing ability of BoHV-1 CTL epitope peptide 2 was detected using the same method, and the results are as follows: Figure 2 As shown, BoHV-1 CTL epitope peptide 2-specific T cells can also kill target cells presenting BoHV-1 CTL epitope peptide 2, and the killing ability increases with the increase of the effector-to-target ratio, which can be used to kill cells infected with BoHV-1.

[0060] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Polypeptide, as shown in A1), A2), or A3): A1) The amino acid sequence of the polypeptide is SEQ ID No. 1 or SEQ ID No. 2; A2) A polypeptide having more than 80% identity with and the same function as A1) by substitution and / or deletion and / or addition of one or two amino acid residues of the sequence of SEQ ID No. 1 or SEQ ID No. 2; A3) is a fusion peptide obtained by linking a tag to the N-terminus and / or C-terminus of A1) or A2).

2. The biomaterial related to the polypeptide of claim 1 is any one of B1) to B4) below: B1) A nucleic acid molecule encoding the polypeptide of claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

3. A product comprising the polypeptide of claim 1 or the biomaterial of claim 2.

4. The product according to claim 3, characterized in that: The product in question is a vaccine or a drug.

5. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of products for the treatment and / or prevention of bovine herpesvirus type 1 infection.

6. The application according to claim 3, characterized in that: The product in question is a vaccine or a drug.

7. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in enhancing the production of CD8+ T cells in the body, or in the preparation of CD8+ T cells, or in the evaluation of CTL reactions or the preparation of products for the evaluation of CTL reactions.

8. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of bovine herpesvirus type 1 antibody or antiserum.

9. The use of the polypeptide of claim 1 or the biomaterial of claim 2 in the preparation of reagents or kits for detecting bovine herpesvirus type 1.

10. A complex formed by the polypeptide of claim 1 and the BoLA-I molecule.