Transcription factor TgHSFA2e1 of torreya grandis as well as coding gene and application of transcription factor TgHSFA2e1

Abstract

The invention discloses a transcription factor TgHSFA2e1 of torreya grandis as well as a coding gene and application of the transcription factor TgHSFA2e1. The amino acid sequence of the transcription factor TgHSFA2e1 is shown as SEQ ID NO.2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.1. The invention further discloses a preparation method of the transcription factor TgHSFA2e1. By cloning the TgHSFA2e1 gene, a heterologous (tobacco) and homologous (torreya grandis) overexpression material of the TgHSFA2e1 is constructed, and the TgHSFA2e1 gene has a relatively great application prospect in the aspect of improving the content of the catechin in the torreya grandis; when the coding gene is over-expressed, the content of catechin is increased.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a transcription factor TgHSFA2e1 of Torreya grandis, its encoding gene, and its applications, particularly its application in high-temperature resistance. Background Technology

[0002] Torreya grandis ( Torreya grandis As a distinctive functional food resource, Torreya grandis not only boasts a long history of cultivation and processing but is also a renowned forestry product of Zhejiang Province. It has been included in the first batch of lists of substances that can be used both as food and medicine, possessing rich nutritional value and medicinal efficacy. The growth, development, and ripening process of Torreya grandis fruits are highly sensitive to environmental conditions. Its ripening period is concentrated from July to September, coinciding with the peak of summer heat. When the ambient temperature exceeds 35℃, the growth of Torreya grandis fruits is significantly inhibited. Extreme high temperatures can easily lead to hindered fruit development, reduced quality, and even a decrease in fruit set rate, seriously affecting the yield and commercial value of Torreya grandis. Furthermore, high-temperature stress can interfere with the normal physiological metabolism of Torreya grandis trees, weakening the tree vigor and reducing its resistance and sustainable production capacity. Therefore, selecting and promoting high-temperature resistant varieties is the most environmentally friendly, economical, and sustainable long-term strategy to fundamentally address the harm caused by high temperatures.

[0003] Catechins, belonging to the flavanol class, such as catechins and gallocatechins, possess unique antioxidant and anti-inflammatory health benefits. Their antioxidant activity plays a crucial role in plant responses to environmental stress, closely related to the stress resistance of Torreya grandis, thus attracting widespread attention from researchers. Especially under high-temperature conditions, plants accumulate large amounts of reactive oxygen species (ROS), and the potent antioxidant catechins can respond to such abiotic stresses by scavenging ROS, reducing oxidative damage, and helping to maintain cellular homeostasis, thereby enhancing plant stress resistance. Currently, the biosynthetic pathway of catechins is relatively well understood, with leucoanthocyanidin reductase (LAR) serving as the key rate-limiting enzyme, responsible for catalyzing the conversion of colorless anthocyanins into trans-flavonoid-3-ol compounds, such as catechins and gallocatechins.

[0004] When Torreya grandis is subjected to high-temperature stress, heat shock factors (HSFs), as key transcriptional regulators of high-temperature stress, play a crucial role in specifically recognizing and binding to heat shock elements (HSEs), thereby activating the expression of downstream genes. Currently, functional studies of the HSF family have expanded to include various important crops such as rice (a model crop of the Poaceae family), cucumber (a vegetable of the Cucurbitaceae family), soybean (an oilseed crop of the Leguminosae family), maize (a staple food of the Poaceae family), and apple (a fruit tree of the Rosaceae family). However, the effects of heat shock factors on the synthesis and accumulation of catechin compounds in the gymnosperm Torreya grandis have not yet been reported. Summary of the Invention

[0005] In view of this, the present invention provides a transcription factor TgHSFA2e1 of Torreya grandis, its encoding gene, and its application.

[0006] The amino acid sequence of the transcription factor TgHSFA2e1 of Torreya grandis described in this invention is shown in SEQ ID NO.2.

[0007] The present invention also provides a gene encoding the transcription factor TgHSFA2e1 of Torreya grandis, the gene having the nucleotide sequence shown in SEQ ID NO.1.

[0008] This invention also provides a recombinant expression vector containing the encoding gene for the transcription factor TgHSFA2e1 of Torreya grandis. This recombinant expression vector is a gene overexpression vector. TgHSFA2e1-GFP .

[0009] The present invention also provides a recombinant bacterium, which is obtained by transforming the above-mentioned recombinant expression vector into a host cell. The host cell is Agrobacterium.

[0010] The present invention also provides the application of the gene encoding the transcription factor TgHSFA2e1 of Torreya grandis in regulating the synthesis of Torreya grandis catechins.

[0011] Beneficial effects: The transcription factor TgHSFA2e1 of this invention is a catechin synthesis gene. TgLAR Key upstream transcription factors TgHSFA2e1 Genes can positively regulate the synthesis of catechins, increasing catechin content and affecting the accumulation of catechins in Torreya grandis under high temperatures. Catechins, by scavenging ROS and reducing oxidative damage, help maintain cellular homeostasis, thereby indirectly improving the heat resistance of Torreya grandis. Furthermore, increased catechin content helps enhance the nutritional value of Torreya grandis. This invention, through... TgHSFA2e1 Gene cloning and construction TgHSFA2e1 The overexpression materials of heterologous (tobacco) and homologous (torreya) were analyzed, and their catechin content was detected. It was found that they have great application prospects in increasing the catechin content of torreya. This invention helps to enrich the metabolic regulatory network of catechins in torreya. Attached Figure Description

[0012] Figure 1 This is a subcellular localization map of transcription factor TgHSFA2e1; Figure 2 It is a transient overexpression in tobacco leaves TgHSFA2e1 qRT-PCR and catechin content change analysis of materials; where A represents the expression of catechins in tobacco. TgHSFA2e1 Materials TgHSFA2e1-OE China Testing TgHSFA2e1 Gene expression level map; B is the gene expression level in tobacco overexpression. TgHSFA2e1Materials TgHSFA2e1-OE The graph shows the content of gallocatechin detected in the sample; C is the overexpression in tobacco. TgHSFA2e1 Materials TgHSFA2e1-OE A graph showing the content of catechins detected in the sample; Figure 3 It is the overexpression of Torreya grandis fruit TgHSFA2e1 The graph shows the analysis of qRT-PCR and changes in catechin content; where A represents the overexpression of Torreya grandis. TgHSFA2e1 Materials TgHSFA2e1-OE China Testing TgHSFA2e1 Gene expression level diagram; B is the overexpression of Torreya grandis. TgHSFA2e1 Materials TgHSFA2e1-OE The graph shows the content of gallocatechin detected in the sample; C is the result of overexpression in Torreya grandis. TgHSFA2e1 Materials TgHSFA2e1-OE The graph shows the content of catechins detected in the sample. Detailed Implementation

[0013] The technical solution of the present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited to the embodiments described.

[0014] Experimental methods not specifically described in the following examples are generally performed under standard conditions, such as those described in Molecular Cloning: A Laboratory Manual (4th Edition), or as recommended in the reagent instructions.

[0015] Example 1: Cloning Torreya grandis TgHSFA2e1 Full-length gene sequence: Primers for whole-genome amplification were designed using the NCBI primer design tool, with Torreya grandis (Gnaphalium affine) as the base. Torreya grandis The CDS sequence of the sample was used as a reference. cDNA from *Torreya grandis* planted in the Senbo Garden Germplasm Resource Nursery in Anji County, Zhejiang Province, China, was used as a template (cDNA extraction was performed according to the polysaccharide and polyphenol plant total RNA extraction kit and reverse transcription kit from Aikerui Biotechnology Co., Ltd.). Specific primers were designed, and PrimerSTAR high-fidelity enzyme PCR was used for amplification. TgHSFA2e1 Fragment. PCR amplification reaction system: 25µL of 2×Hieff Canace® AdvanceFast PCR Master Mix (With Dye), 20µL of DEPC H2O, 1µL of cDNA, and 2µL each of forward and reverse primers, totaling 50µL. The PCR reaction program was: 98℃ pre-denaturation for 30 seconds, 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 5 seconds, 32 cycles, and a final extension at 72℃ for 2 minutes. The obtained PCR products were identified by 1% agarose gel electrophoresis, and the amplified bands were then purified using an EasyStar gel extraction kit and sent to Youkang Company for sequencing confirmation.

[0016] Upstream primer, TgHSFA2e1-GFP-F: TCGGTACCCGGGGATCCggatccATGGAAAGAAACGGGGCAAAGCCAT; Downstream primer, TgHSFA2e1-GFP-R: TGCTCACCATGTCGAC gtcgac CTTGGAATCTGGCGATCTGGCAATGT.

[0017] The obtained genes TgHSFA2e1 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the transcription factor TgHSFA2e1 encoded by this gene is shown in SEQ ID NO.2.

[0018] Example 2 TgHSFA2e1 Construction of gene overexpression vectors TgHSFA2e1 Construction of overexpression vectors: Using pCambia1300-GFP as the final vector, a recombinant overexpression promoter with CaMV35S was constructed. 35Spro::TgHSFA2e1 Vector. The vector obtained from the amplification in Example 1. TgHSFA2e1 The fragment and vector pCambia1300-GFP were digested with SmaI and BamHI (37℃, 1 hour), and then the fragment was ligated into the digested pCambia1300-GFP by reacting with T4 DNA Ligase (Takara, Japan) at 16℃ for 14 hours to obtain the recombinant expression vector. TgHSFA2e1-GFP Also known as recombinant plasmid TgHSFA2e1-GFP .

[0019] Example 3 Subcellular localization assay of transcription factor TgHSFA2e1 After thawing Agrobacterium GV3101 (pSoup-p19) stored at -80℃ on ice, 10 µL of the above recombinant plasmid was added. TgHSFA2e1-GFP Gently mix. The culture is then subjected to the following steps: stand on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate in a 37°C water bath for 5 min, stand on ice for 5 min, add 700 µL of LB medium, and incubate at 28°C with shaking for 2 hours. After centrifuging the bacterial suspension at 6000 rpm for 1 min, discard 700 µL of the supernatant, resuspend the bacteria in the remaining medium, and spread 20 µL evenly on LB agar plates resistant to kanamycin and rifampicin. After absorption, incubate upside down at 28°C for 2 days. Positive strains are preserved in glycerol and stored at -80°C.

[0020] Positive strains were inoculated into LB medium containing kanamycin and rifampin resistance, cultured overnight at 28°C, and then scaled up to 50 mL. After collecting the bacterial suspension, centrifuged at 5000 rpm for 10 min, washed twice with 25 mL ddH2O, and finally resuspended in the suspension. The OD600 was adjusted to 1.0. Transcription factor resuspension and nuclear marker resuspension were mixed at a 1:1 volume ratio and incubated in the dark for 3 hours. Well-grown, uniformly sized one-month-old *Nicotiana benthamiana* were selected and injected into the underside of leaves. Infected tobacco was cultured in a climate chamber. After 48 hours, leaf tissue near the injection wells was collected, and the expression and localization of GFP (green fluorescent protein) and nuclear localization signal (NLS) red fluorescent protein were observed using a laser confocal microscope. The results are as follows: Figure 1 As shown.

[0021] Preparation of resuspension: 50 mL sterile water, 500 µL 1 M 2-N-morpholine ethanesulfonic acid (MES), 200 µL 2.5 M magnesium chloride (MgCl2) and 100 µL 100 mM acetylsuccinyl copper (AS).

[0022] according to Figure 1 It can be seen that subcellular localization shows TgHSFA2e1-GFP The green fluorescence is localized in the cell nucleus, which coincides with the red fluorescence emitted by the nuclear localization signal (NLS), indicating that the transcription factor TgHSFA2e1 is localized in the cell nucleus.

[0023] Example 4: Transient overexpression of tobacco heterologous and torreya homologous expression Containing recombinant plasmids TgHSFA2e1-GFP Agrobacterium GV3101 bacterial culture was inoculated into LB liquid medium containing 500 µL of kanamycin and rifampicin resistance and cultured overnight at 28°C with shaking. The overnight culture was collected, centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The culture was resuspended in 25 mL of dd H2O, centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. This process was repeated twice. The bacterial cells were resuspended in resuspension buffer (10 mM MES, 10 mM MgCl2, 200 μM AS), and the bacterial concentration was adjusted to OD600 = 0.6-0.8. The culture was then incubated in the dark at 28°C for 2 h.

[0024] One-month-old tobacco plants of uniform size were selected. The fourth and fifth true leaves of each plant were selected. The left side of each leaf was injected with bacterial suspension containing the empty vector GFP. This leaf material on that side served as the empty vector control and was designated as EV. The right side was injected with bacterial suspension containing the recombinant plasmid. TgHSFA2e1-GFP The bacterial solution, the tobacco leaf material on this side is denoted as TgHSFA2e1-OE After 48 hours of infection, tobacco leaves were collected, avoiding the veins, ground in liquid nitrogen, and stored at -80°C.

[0025] In May and June, before the Torreya grandis fruits have rapidly expanded, select Torreya grandis trees with good fruit set and similar growth. Choose fruits with similar growth conditions, fruit size, and maturity. Inoculate the trees with bacterial suspension containing the empty vector GFP and bacterial suspension containing recombinant plasmids. TgHSFA2e1-GFP Agrobacterium GV3101 bacterial suspension was injected into Torreya nuts to infect them. The infected fruit materials were recorded as EV (empty control). TgHSFA2e1-OE To reduce individual differences, fruits are harvested 7-10 days after infection, kernels are extracted, ground in liquid nitrogen, and stored at -80℃.

[0026] Example 5: Extraction and qRT-PCR analysis of catechins Accurately weigh 1.000 g of tobacco leaf powder and Torreya grandis seed powder taken from -80℃ into a 50 mL centrifuge tube. Add 50 mL of 50% methanol (V:V), and extract ultrasonically at 50℃, 40 kHz / 250 W for 60 min. Centrifuge the extract at 12000 r / min for 10 min, collect the supernatant, and repeat the extraction twice more on the residue. Combine the extracts. Concentrate the supernatant under reduced pressure to a paste. Dissolve the paste with 5 mL of 50% methanol using ultrasonication, centrifuge for 5 min, collect the supernatant, and make up to 5 mL. Filter through a 0.22 μm hydrophilic membrane and store at low temperature in the dark for later use. The contents of catechin and gallatechin were analyzed by chromatographic analysis using a Waters 2695 high performance liquid chromatography (HPLC) column (4.6 × 250 mm, 5 µm). The mobile phase A was 0.1% formic acid (V:V), and the mobile phase B was chromatographic methanol. The injection volume was 10 μL, the flow rate was 0.5 mL / min, the column temperature was 30 °C, and the detection wavelength was 280 nm.

[0027] Real-time quantitative PCR primers were designed using the Genscript Real-time PCR (TaqMan) Primer and Probes Design Tool (https: / / www.genscript.com / tools / real-time-pcr-taqman-primer-design-tool) online tool. cDNA and DEPC water were diluted at a ratio of 1:5 (V:V), and qRT-PCR was performed using TOROGreen® qPCR Master Mix (QST-100, Bio-Rad, Toroivd). The total reaction volume was 20 µL, containing 10 µL of SYBR Green qPCR Master Mix, 0.8 µL each of forward and reverse primers, 2 µL of cDNA, and 6.4 µL of DEPC water. The amplification program was performed on a CFX96 Real-Time PCR Manager (BioRad, USA) system: 95 °C pre-denaturation for 60 s; followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s; and a final extension at 72 °C for 5 min. Expression levels were corrected using the Torreya grandis internal reference gene (TgActin). The gene expression level after 1 hour of treatment at 25°C was set as 1, and a 2... -ΔΔCt The method calculates the relative expression levels of genes. The results are as follows: Figure 2 , Figure 3 As shown. The primer sequence is: Forward primer Q-TgHSFA2e1-Tg3g02883-F: GATTTCGCTGTCTCGTGGAG Reverse primer Q-TgHSFA2e1-Tg3g02883-R: AAAGCTTTCGTGTGCGAACT according to Figure 2 A, qRT-PCR results showed transient overexpression in tobacco leaves. TgHSFA2e1 After gene expression, its tobacco overexpression material TgHSFA2e1-OE middle TgHSFA2e1 The relative expression level reached 8.27 times that of the empty control, and the difference was significant. Figure 2 B and Figure 2 C indicates that tobacco overexpression materials TgHSFA2e1-OE The content of gallic catechin was significantly increased, reaching 1.28 times that of the empty control; at the same time, the content of catechin was also significantly increased, reaching approximately 1.64 times that of the empty control.

[0028] according to Figure 3 A indicates that overexpression of [a specific substance] is observed in Torreya grandis fruit. TgHSFA2e1 Following gene expression, qRT-PCR detection showed that the overexpression material of Torreya grandis... TgHSFA2e1-OE middle TgHSFA2e1 The relative expression level was approximately 130.15 times that of the empty vector control, a highly significant difference. Furthermore, according to... Figure 3 B and Figure 3 C indicates that the overexpression material of Torreya grandis... TgHSFA2e1-OE The content of gallic catechin was significantly increased, reaching 2.69 times that of the empty control; at the same time, the content of catechin was also significantly increased, about 1.41 times that of the empty control.

[0029] Unless otherwise specified, all technologies mentioned above refer to existing technologies.

[0030] As described above, although the invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the invention itself. Various changes in form and detail may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. A transcription factor TgHSFA2e1 from Torreya grandis, characterized in that, The amino acid sequence of the transcription factor TgHSFA2e1 is shown in SEQ ID NO.

2.

2. A gene encoding the transcription factor TgHSFA2e1 of Torreya grandis as described in claim 1, characterized in that, The encoding gene is a nucleotide sequence as shown in SEQ ID NO.

1.

3. A recombinant expression vector, characterized in that, It includes the gene encoding the transcription factor TgHSFA2e1 of Torreya grandis as described in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector is a gene overexpression vector. TgHSFA2e1-GFP .

5. A recombinant bacterium, characterized in that, It is obtained by transforming the recombinant expression vector of claim 4 into host cells.

6. The recombinant bacteria according to claim 5, characterized in that, The host cell is Agrobacterium.

7. The application of the gene encoding the transcription factor TgHSFA2e1 of Torreya grandis as described in claim 2 in regulating the synthesis of catechins in Torreya grandis.

Images