Lepidoptera insect Caspase-4 mutant and application of Lepidoptera insect Caspase-4 mutant in improvement of yield of baculovirus
By constructing and expressing the Caspase-4C286A gene of the beet armyworm, a mutant of Caspase-4 in lepidopteran insects, the problem of cell apoptosis caused by baculovirus infection was solved, virus yield was increased, and the effect of pest control was improved.
Patent Information
- Application Number
- CN202511810283.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-24
AI Technical Summary
Baculovirus infection can easily induce apoptosis in host cells, leading to a decrease in viral production and affecting viral transmission and insecticidal efficacy.
The Caspase-4C286A gene of the beet armyworm, a mutant of Caspase-4 in lepidopteran insects, was constructed and inserted into the genome of a baculovirus. It was then expressed in large quantities in host cells via the Bac-to-bac system to inhibit apoptosis and increase viral yield.
It effectively inhibited cell apoptosis during baculovirus infection, significantly increased the production of viral polyhedromes, and provided an effective way to control lepidopteran pests in a green manner.
Smart Images
Figure CN121555484A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bio-agricultural products technology, specifically relating to a Caspase-4 mutant of lepidopteran insects and its application in increasing baculovirus production. Background Technology
[0002] Baculoviruses are a class of naturally occurring microorganisms, mostly isolated from lepidopteran insects. Due to their environmental friendliness, safety for humans and animals, and low likelihood of developing resistance, they have been developed into safe insecticides widely used for the green control of lepidopteran pests such as the beet armyworm. However, baculovirus infection easily induces host cell apoptosis, leading to reduced viral production and consequently affecting viral transmission and insecticidal efficacy.
[0003] The genome of baculoviruses is a stable, double-stranded circular DNA molecule. Baculovirus expression vector systems (BEVS) developed based on this genome can be used to study the expression and function of viral or exogenous genes. For example, the Bac-to-bac system can be used to construct genetically engineered recombinant baculoviruses carrying exogenous genes. Studies have found that the apoptosis core factor caspases can induce apoptosis in host cells during baculovirus infection, thereby reducing viral yield. Therefore, how to inhibit apoptosis and increase baculovirus yield during viral infection has become a key research focus in the control of the beet armyworm. Summary of the Invention
[0004] The purpose of this invention is to provide a Caspase-4 mutant of lepidopteran insects and its application in increasing baculovirus production, namely the Caspase-4 mutant SeCaspase-4C286A gene of beet armyworm, and its application in increasing baculovirus production.
[0005] The present invention first provides a Caspase-4 mutant of a lepidopteran insect, the amino acid sequence of which is SEQ ID NO:1; MENETEYYQSYPGIFFLSRKGKGKKKKKGKSGKKSNNNGDKQNEKSESETLESVEDPSNLTDENGSGLDETEDDSNKSVIYRANDGESADLNENRISIDAMMSAPPEYEKSSEKVKFVDNEDIETLESNVDKLQIEEESVFENEDTKYTLINTRALPKEATTYELEKFTKHAMIIFNQKEIDGHLPRLGTEKDVEALTRTFSNYGFEVTPHNNLTKDELFKELKTFSERDFTDYGCVAVAILTHGSNNGLLRAKDQQYSEIEVINHFKDSSKPTLVTKPKIIIIQAARGTKITQGLPVFHAGKIRKDVDEEDLEPYILPVESDFLILHSSYVGRASHRNELYGSWFIQTLCKKIDSLSPSQDLESILTEVKREVAIDKQHEEYNKRTFEMNVNKQMPVLTSTLIRKLFLKKYGEKGRKDTYVDQSRRPSESRHDALDAINPVPATPLLVQFGPCSCFLDHFVYMRDCLRYFVEENPCDETAQNFLDIANTFEDGVEFNTSKDKMCKAISKHLMINARSSQYYKFLYFYHSQQNSQQTTPSQSFQY。
[0006] The mutant described above has a nucleotide sequence of SEQ ID NO:2 for its encoding gene.
[0007]
[0008] In another aspect, the present invention provides a viral shuttle plasmid bacmid, which is formed by inserting a nucleotide fragment of the above-mentioned beet armyworm SeCaspase-4 mutant SeCaspase-4C286A gene into the viral genome bacmid; As a specific example, the virus described is a baculovirus; The present invention also provides another use for the beet armyworm SeCaspase-4C286A mutant gene, which is its application in increasing baculovirus production; In another aspect, the present invention provides a method for increasing baculovirus production, wherein the method comprises increasing the content of the SeCaspase-4C286A gene, a mutant of the beet armyworm SeCaspase-4, in host cells; As a specific example, the large-scale expression of the above-mentioned mutant SeCaspase-4C286A gene of the beet armyworm SeCaspase-4 in host cells is achieved by transferring the above-mentioned shuttle plasmid bacmid into the host cells.
[0009] The host cell, as specifically described in this embodiment, is the beet armyworm.
[0010] This invention constructs a SeCaspase-4 mutant, SeCaspase-4C286A, from the beet armyworm, and constructs a genomic bacmid carrying the gene of the recombinant Autographacalifornica multiple nucleopolyhedrovirus (AcMNPV). Recombinant viral occlusion bodies (OBs) carrying the SeCaspase-4C286A gene were successfully obtained through cell transfection. SeCaspase-4C286A inhibits apoptosis during AcMNPV infection and increases the yield of viral OBs. This invention provides an effective way to increase the yield of baculoviruses and is of great significance for the efficient use of baculoviruses for the green control of lepidopteran pests. Attached Figure Description
[0011] Figure 1This diagram illustrates the nucleotide mutation sites and amino acid sequence analysis of the SeCaspase-4C286A mutant gene. The mutation strategy of this invention involves mutating adenine (A) at position 858 of SeCaspase-4 to cytosine (C), thymine (T) at positions 859 and 861 to guanine (G), guanine (G) at position 860 to cytosine (C), C at position 862 to A, A at position 864 to G, and T at position 867 to C (…). Figure 1 A (marked in red). To improve the mutation success rate, multiple nucleotide mutations were performed, resulting in the mutation of amino acid 287 of SeCaspase-4 from cysteine (Cys / C) to alanine (Ala / A). Figure 1 B, marked in red.
[0012] Figure 2 The diagram shows the construction and identification of the recombinant viral bacmid carrying the SeCaspase-4C286A gene. Figure 2 A is a schematic diagram of the construction of a recombinant viral bacmid carrying SeCaspase-4C286A. After fusing a GFP (green fluorescent protein) tag to the C-terminus of SeCaspase-4C286A, it is cloned into the AcMNPV genome bacmid and named SeCaspase-4C286A-GFPbacmid. Figure 2 B represents the PCR identification of the recombinant viral bacmid carrying SeCaspase-4C286A. PCR amplification of the bacmid carrying SeCaspase-4C286A was performed using universal primers M13 / pUCR and upstream primers of the SeCaspase-4C286A gene. A 4294 bp SeCaspase-4C286A gene fragment (including a 1635 bp SeCaspase-4C286A gene fragment, a 720 bp GFP gene fragment, two 218 bp PolyA fragments, a 165 bp polyhedral gene promoter fragment (polh), a 735 bp polyhedral Polh gene fragment, and two DNA fragments of 458 bp and 145 bp respectively from the bacmid vector) was obtained, indicating that the SeCaspase-4C286A-GFP bacmid was correctly constructed.
[0013] Figure 3Figure 1 shows the effect of high expression of SeCaspase-4C286A in cells on apoptosis induced by recombinant virus AcMNPV. Using GFPbacmid constructed before transfection and unmutated SeCaspase-4-GFPbacmid as controls, and transfecting beet armyworm cells with the correctly constructed SeCaspase-4C286A-GFPbacmid, the results showed that no apoptosis was observed in cells transfected with GFPbacmid from 48 to 96 hours post-transfection (h pt), and viral polyhedromes (OBs) were produced in the cells from 72 to 96 hours post-transfection (indicated by blue arrows). Numerous apoptosis events were observed in cells transfected with SeCaspase-4-GFPbacmid (indicated by red arrows), but no viral OBs were observed. In contrast, no apoptosis was observed in cells transfected with SeCaspase-4C286A-GFPbacmid, and the number of viral OBs produced in these cells from 72 to 96 hours post-transfection (indicated by blue arrows) was significantly higher than that produced in cells transfected with GFPbacmid.
[0014] Figure 4 The figure shows the effect of SeCaspase-4C286A on the yield of recombinant viral AcMNPV. After transfecting cells with SeCaspase-4C286A-GFP bacmid, cell pellets and supernatants were collected. The cells were centrifuged and disrupted to obtain recombinant viral polyhedromes (OBs). The yield was then calculated using a hemocytometer. The results showed that the yield of recombinant viral polyhedromes (OBs) carrying SeCaspase-4C286A was significantly higher than that carrying GFP (significant difference analysis showed ***). P <0.001). Detailed Implementation
[0015] This invention discovered that the cysteine residue at position 287 (Cys / C) of SeCaspase-4 from the beet armyworm is a key site for its enzyme activity, and mutating it to alanine (Ala / A) leads to the loss of SeCaspase-4's pro-apoptotic function. Therefore, this invention constructed a mutant SeCaspase-4C287A using overlapping PCR, then cloned the gene of this mutant SeCaspase-4C287A into the shuttle plasmid bacmid of the AcMNPV baculovirus genome and transfected beet armyworm Se-3 cells. Apoptosis analysis showed that high expression of SeCaspase-4C287A inhibited apoptosis induced by recombinant virus infection. Collection and yield analysis of recombinant viral polyhedromes (OBs) produced in transfected cells showed that SeCaspase-4C287A increased the yield of recombinant viral polyhedromes (OBs).
[0016] Therefore, by using the Bac-to-bac system to construct the Caspase mutant gene into the baculovirus genome and express the mutant gene in large quantities, the production of recombinant baculovirus can be increased by utilizing its inhibition of apoptosis during viral infection.
[0017] The present invention will now be described in conjunction with specific embodiments and accompanying drawings.
[0018] Example 1: Construction of the SeCaspase-4 mutant SeCaspase-4C286A Based on the gene sequence of SeCaspase-4 from the beet armyworm (SEQ ID NO:3), a gene mutation primer was designed at positions 858 to 867. Overlap PCR amplification was performed using the previously constructed SeCaspase-4pMD18-T plasmid as a template. The first round of PCR amplification used SeCaspase-4pMD18-T as a template, and two sets of primers were used. The PCR primer sequences are as follows: First set of primers: CaspXF: 5' - AAT TCTAGA ATGGAGAACGAAACCGAATATTATCAG- 3′ (Double underscore marker) Xba I restriction site) Casp4CmR:5′ - CGT G CC C C TCGCG GCCTGGATGATAATTATCTTGGG- 3′ (bases after mutation marked with a single underscore) Second set of primers: Casp4CmF:5′ - GC CGCGA GG GG C ACGAAGATCACCCAAGGTCTACC-3′ (bases after mutation marked with a single underscore) Casp4ER: 5' - AAT GAATTC ATATTGAAACGACTGTGACGGTGTAGT- 3′ (Double underscore mark) EcoR I restriction site).
[0019] After separation by agarose gel electrophoresis, the PCR products yielded an upstream gene fragment (DNA fragment 1) of approximately 870 bp and a downstream gene fragment (DNA fragment 2) of approximately 783 bp. These fragments were then recovered from the gel and stored at -20°C for later use. Subsequently, using a mixture of the two gene fragments (DNA fragment 1 and DNA fragment 2) from the first round of PCR products in equal proportions as templates, a second round of PCR amplification was performed using the primers CaspXF and Casp4ER. After separation by agarose gel electrophoresis, a gene fragment of approximately 1638 bp was obtained. This fragment was recovered from the gel and ligated into the vector pMD18-T. After clone selection and DNA sequencing, a complete ORF of SeCaspase-4C286A with a size of 1638 bp was obtained.
[0020] The nucleotide sequence of the ORF of SeCaspase-4C286A is SEQ ID NO:2, and the amino acid sequence of the protein it encodes is SEQ ID NO:1.
[0021] Example 2: Effects of SeCaspase-4C286A on AcMNPV-induced apoptosis and viral yield 1. Construction of bacmid carrying the SeCaspase-4C286A recombinant virus The SeCaspase-4C286A vector plasmid pMD18-T was double-digested with restriction endonucleases XbaI and EcoRI. Simultaneously, a green fluorescent protein (GFP) tag was fused to the C-terminus of this gene and constructed into the donor plasmid pFastBac of the Bac-to-Bac system (Invitrogen). This donor plasmid was then transformed into DH10Bac competent cells (containing the AcMNPV genome bacmid) to construct a recombinant viral bacmid carrying the SeCaspase-4C286A-GFP fusion gene (see schematic diagram of bacmid construction). Figure 2As shown in A), then bacmids were extracted according to the Bac-to-Bac system instructions and used as templates. The universal primers M13 / pUCR (5' – CGCCAGGGTTTTCCCAGTCAC – 3') and the gene-specific full-length primers for SeCaspase-4 (Casp4XF: 5' – AAT) provided by the system were used. TCTAGA PCR amplification was performed using ATGGAGAACGAAACCGAATATTATCAG – 3'), and the correctness of the constructed recombinant viral bacmid was determined based on the size of the target DNA obtained from the PCR. The electrophoretic analysis results of the PCR products are as follows: Figure 2 As shown in B, the SeCaspase-4C286A-GFP bacmid was obtained by PCR, yielding a gene fragment of approximately 4294 bp. Combined with the previous sequencing results of pMD18-T of SeCaspase-4C286A-GFP, it was confirmed that the viral genome bacmid carrying SeCaspase-4C286A-GFP was correctly constructed and named SeCaspase-4C286A-GFP bacmid.
[0022] 2. Analysis of the effect of SeCaspase-4C286A on apoptosis induced by recombinant viral infection Beet armyworm Se-3 cells were stored at a density of 1 × 10⁻⁶ cells per well. 6 Cells were seeded into 6-well cell culture plates. After cell adhesion, Se-3 cells were transfected with the correctly constructed SeCaspase-4C286A-GFP bacmid using Cellfectin II transfection reagent. GFP bacmid and wild-type SeCaspase-4-GFP bacmid were used as controls. 4 μg of each recombinant viral bacmid DNA was transfected. Fluorescence expression and cell morphology changes were observed under a fluorescence microscope at 48, 72, and 96 hours post-transfection (hp.t.). Results are as follows: Figure 3As shown, green fluorescence was expressed in cells transfected with all three recombinant viral bacmids from 48 to 96 hours post-transfection. No apoptosis was observed in cells transfected with GFP bacmid, but significant apoptosis was observed in cells transfected with wild-type SeCaspase-4-GFP bacmid from 48 to 96 hours (indicated by red arrows). No apoptosis was also observed in cells transfected with SeCaspase-4C286A-GFP bacmid. This indicates that the cysteine mutation at position 287 of SeCaspase-4 inhibits its pro-apoptotic function, and overexpression of the mutant SeCaspase-4C286A can inhibit apoptosis induced by baculovirus infection.
[0023] 3. Analysis of the impact of SeCaspase-4C286A on recombinant virus yield Ninety-six hours after Se-3 cells were transfected with SeCaspase-4C286A-GFPbacmid, the cell pellet and supernatant were collected, centrifuged, and the cells were sonicated to completely release the viral polyhedromes (OBs). The yield of OBs was then counted using a hemocytometer. Results are as follows: Figure 4 As shown, the yield of recombinant viral polyhedromes OB carrying SeCaspase-4C286A was significantly higher than that of recombinant viral polyhedromes OB carrying GFP or wild-type SeCaspase-4.
[0024] In summary, the mutation of cysteine at position 287 of SeCaspase-4 to alanine (Ala / A) can inhibit its pro-apoptotic function. Overexpression of the mutant SeCaspase-4C286A can inhibit cell apoptosis caused by viral infection during AcMNPV infection, thereby promoting the production of AcMNPV viral polyhedromes OB. This provides an effective way to improve the yield and pest control effect of baculovirus in the production process.
Claims
1. A Caspase-4 mutant of a lepidopteran insect, characterized in that, The mutant described herein has a protein with the amino acid sequence SEQ ID NO:
1.
2. A gene characterized in that, The gene encodes the mutant described in claim 1.
3. The gene as described in claim 2, characterized in that, The nucleotide sequence of the gene is SEQ ID NO:
2.
4. A viral shuttle plasmid, bacmid, characterized in that, The shuttle plasmid bacmid is prepared by inserting the nucleotide fragment of the gene described in claim 2 into the viral genome bacmid.
5. The shuttle plasmid bacmid as described in claim 4, characterized in that, The virus in question is a baculovirus.
6. The application of the mutant according to claim 1 in increasing baculovirus yield.
7. A method for increasing baculovirus yield, characterized in that, The method described herein is to increase the content of the mutant of claim 1 in a host infected with baculovirus.
8. The method as described in claim 7, characterized in that, The method involves transferring the shuttle plasmid bacmid described in claim 4 into host cells to increase the expression level of the mutant.
9. The method as described in claim 7 or 8, characterized in that, The host cell is the beet armyworm.