Application of fluorescent dye, method for detecting multiplex amplification Matrix system by using 10-color fluorescence and kit for simultaneously performing multiplex amplification on 74 STR (short tandem repeat) gene loci

By employing a 10-color fluorescence detection multiplex amplification matrix system and specific fluorescent dyes and primers, the problems of spectral cross-interference and limited locus number in existing fluorescent DNA detection technologies have been solved, enabling efficient amplification and detection of 74 STR loci, thus improving detection efficiency and sensitivity.

CN121555644APending Publication Date: 2026-02-24JIANGSU SUBO BIOMEDICAL TECH NANJING CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510617433.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-06-19
Filing Date
2025-05-14
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

Existing five-color, six-color, and nine-color fluorescent DNA detection technologies are limited in the number of loci that can be amplified simultaneously, making it difficult to meet the needs of library construction and case investigation. Furthermore, traditional fluorescent detection systems suffer from spectral cross-interference and decreased detection sensitivity.

Method used

A 10-color fluorescence detection multiplex amplification matrix system was developed, employing 10 fluorescent dyes including FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. By optimizing primer design and spectral differentiation, the system can simultaneously amplify 74 STR loci, preferentially amplifying shorter fragments and reducing spectral cross-interference.

Benefits of technology

Simultaneous amplification of 74 loci was achieved, which improved detection throughput and efficiency, increased the detection rate of trace and degraded samples, reduced the risk of amplification failure, reduced spectral crosstalk rate and fluorescence intensity inhomogeneity, and promoted technological innovation in the field of forensic medicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005401484450000021
    Figure BDA0005401484450000021
  • Figure BDA0005401484450000031
    Figure BDA0005401484450000031
  • Figure BDA0005401484450000041
    Figure BDA0005401484450000041
Patent Text Reader

Abstract

The invention discloses application of a fluorescent dye, a method for detecting a composite amplification Matrix system by using 10-color fluorescence, a kit for simultaneously carrying out composite amplification on 74 STR (short tandem repeat) gene loci, and application of the fluorescent dye for detecting the composite amplification Matrix system by using the 10-color fluorescence. The fluorescent dye comprises 10 kinds of dye at the same time: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685 and ER690; 10 kinds of dyes are used for combined marking, FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674 and ER685 are used for marking amplification primers, ER690 is used for marking an interior label, 10 kinds of fluorescence emission spectrums can be distinguished and do not permeate one another, and the wavelength of the 10 kinds of fluorescent dyes ranges from 480 to 710. According to the invention, the limitation of the prior art is broken through, the number of fluorescent channels and loci is expanded, 74 core loci can be amplified at the same time, more small fragments can be accommodated, and the efficiency and capability of fluorescent DNA detection are greatly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the use of a class of fluorescent dyes, a method for detecting a multiplex amplification matrix system using 10-color fluorescence, and a kit for simultaneous multiplex amplification of 74 STR loci, belonging to the field of fluorescent STR typing technology. Background Technology

[0002] Fluorescence detection technology, as a core tool for molecular diagnostics and gene analysis, has been widely applied in pathogen detection, genetic disease screening, tumor genotyping, and forensic DNA identification due to its high sensitivity and specificity. Among these, multiplex amplification technology based on multiplex polymerase chain reaction (PCR) can simultaneously amplify multiple target genes in a single reaction, significantly improving detection throughput and efficiency. However, with the increase in the number of detection targets, traditional fluorescence detection systems face two major technical bottlenecks: the limited number of fluorescence channels and the complexity of spectral cross-interference. Currently, most mainstream commercial detection systems employ 5-6 fluorescence channels, distinguishing targets through combinations of different fluorescent dyes and differences in product fragment lengths. However, the number of targets that can be detected simultaneously is limited by the spectral overlap of fluorescent dyes. For example, the emission spectra of FAM and HEX dyes partially overlap, requiring precise optical filters and algorithms to correct the signals, leading to decreased detection sensitivity and increased data analysis complexity.

[0003] In recent years, to overcome the bottleneck of multicolor detection, researchers have attempted to optimize the system through the following two approaches: (1) developing and selecting novel narrow emission spectrum fluorescent dyes (such as CF dyes and ATTO series) and combining them with high-resolution capillary electrophoresis technology to improve channel utilization; (2) expanding the wavelength range of collectable fluorescent dyes in genetic testing instruments or optimizing the fluorescence collection algorithm. However, the former requires extremely high instrument spectroscopic accuracy and has poor compatibility between dyes, which can easily lead to uneven amplification efficiency; the latter relies on complex data modeling or hardware design, making it difficult to achieve standardized application on conventional PCR platforms.

[0004] Traditional five- or six-color fluorescence systems have a limited number of spectral channels, restricting the number of detectable STR loci in a single experiment to 20-44, and the fragments are relatively large, making it difficult to meet the current needs of library construction and genotyping in case investigation. Currently, CN111286320A discloses a fluorescent dye, specific amplification primer pairs, and genotyping method that can be used for nine-color fluorescent STR genotyping. The inventors have also published an article on this topic, "Construction of a Nine-Color Matrix System" (Criminal Technology, Bai Xue et al., Vol. 47, No. 4, pp. 371-375, October 27, 2021). This article mentions that the key to spectral primer design is that the maximum fragment size should not exceed 200 bp. If the fragment is too large, the matrix system will not elute completely within the instrument's programmed time, or the peak shape of large fragments will become broad, resulting in inaccurate fragment analysis (see paragraph 6, left column, page 375). Furthermore, only 42 loci can be amplified at a time. Therefore, the development of the 10-color matrix system and reagent kit in this study is not only a technological upgrade, but also a pioneering achievement in 10-color technology both domestically and internationally. It breaks the foreign monopoly on STR detection technology and promotes the development of the entire domestic industrial chain, which can simultaneously amplify more than 74 loci. Summary of the Invention

[0005] This invention aims to overcome the limitations of existing five-color, six-color, and nine-color fluorescent DNA detection technologies by providing a type of fluorescent dye, a method for detecting a 10-color fluorescent multiplex amplification matrix system, and a kit for simultaneous multiplex amplification of 74 STR loci. It expands the number of fluorescent channels and loci, greatly improving the efficiency and capability of fluorescent DNA detection.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] This document describes the application of a class of fluorescent dyes in a 10-color fluorescent detection multiplex amplification matrix system. The fluorescent dyes comprise 10 dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. These 10 dyes are used for combined labeling. FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, and ER685 are used to label amplification primers, while ER690 is used to label the internal standard. The 10 fluorescent emission spectra are distinguishable and do not interpenetrate. The wavelengths of the 10 fluorescent dyes are in the range of 480-710 nm. The specific chemical structures of each dye are as follows:

[0008]

[0009]

[0010] An in the formula- It refers to the fluorescent group contained in the chemical formula.

[0011] This application's 10-color fluorescence matrix system, by increasing the selection of fluorescent dyes, makes the emission spectra more distinct and non-interfering, allowing a single tube to amplify up to 74 or more loci, significantly improving detection throughput. Furthermore, the 10-color fluorescence system, through optimized primer design, prioritizes the amplification of shorter fragments (<300bp), improving the detection rate of degraded or trace samples. For example, domestic reagent kits, due to their limited number of channels, have a low detection rate for trace degraded samples, especially those with longer fragments (e.g., >300bp), particularly for crime scene evidence. The 10-color system further accommodates shorter fragments and more loci, increasing the detection rate and reducing the risk of amplification failure.

[0012] A method for detecting a multiplex amplification matrix system using 10-color fluorescence detection employs a combination of 10 dyes for labeling, establishing a 10-color fluorescence analysis system. The 10 fluorescence emission spectra are distinguishable and do not interpenetrate. The 10 dyes are FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. The specific steps are as follows:

[0013] 1) Ten fluorescent dyes were selected for combined labeling: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, and ER685 were used to label amplification primers, while ER690 was used to label internal standards. Based on the emission wavelength of the gene typing instrument's laser and the range of the CCD, the emission wavelength range of the ten fluorescent dyes was determined to be between 480-710 nm. The fluorescence emission spectra of the ten fluorescent dyes were distinguishable and did not interpenetrate, and the emission intensity of the ten dyes was uniform.

[0014] 2) Matrix primer design: Using random plasmid 800 as a template, with fixed upstream primer sequences, 10 downstream primer sequences with fragment sizes of 80bp, 100bp, 120bp, 140bp, 160bp, 180bp, 200bp, 220bp, 260bp and 280bp were designed. These primers were synthesized by the primer synthesis department of Jiangsu Subo Biomedical Technology Nanjing Co., Ltd. The primer fragment sizes needed to be spaced 20bp apart. During primer synthesis, 10 different dyes were used to fluorescently label the 5' end of the primers.

[0015] 3) Matrix PCR amplification and assembly: PCR amplification of 10 fragments, including one fragment labeled with each of 10 fluorescent dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685 and ER690, with each fragment having a molecular weight difference of at least 20 bp. After capillary electrophoresis, the amplification system was optimized and the PCR products were purified to make their peak heights approximately the same.

[0016] 4) Adjust the peak height balance of the 10 segments, and the 10-color Matrix standard product is successfully assembled.

[0017] The excitation and emission wavelengths of the above 10 fluorescent dyes are as follows:

[0018]

[0019]

[0020] The primer sequences designed in step 2) above are shown in the table below:

[0021]

[0022] The sequence of random plasmid 800 in step 2) above is as follows:

[0023]

[0024] ATTCGTAATGAAGGTCTTGTGCACGTATGAGTACGTAGAGGTATCAGAGGCTAAGAA

[0025] CATACGGAGACGTCATAGCTACCTGGACCAGATCTCATGCACGATCCCTCAGTGTTC

[0026] GCAAGGATGGTTTCCAATCTTAACCATTAAGTGTGGCTTACTGTCGGTCGTTTTCCTG

[0027] AATCGTATCAGCGGATACCAATCAGTTTTATCTGCGTTAGACAACGAGCGATCCCGTT

[0028] CAGCATCACCTCCGTTGAAAAGCAATAATCAGCGGAATTCTTTAACGGTACTCTGTGACAACCTCAGAAAAGGACCCTTGCTCAGTGTTAGGGACGTTACACTCAAGGCTTG.

[0029] In step 3) above, the total PCR volume for PCR amplification is 50uL, including 20uL of PCR Mix, 0.5uL of Taq polymerase, 1uL of labeled primers, 2.5uL of unlabeled primers, 1uL of DNA template, and water added to bring the volume to 50uL. The PCR program is as follows: 95℃ for 3 min; 94℃ for 30 s, 62℃ for 30 s, 72℃ for 45 s, for a total of 35 cycles; 72℃ for 15 min, and PCR products are stored at 4℃.

[0030] In step 3) above, the specific steps for PCR product purification are as follows: Calculate the volume of the PCR product and add an equal volume of chloroform. Centrifuge and transfer the supernatant to a new centrifuge tube. Add 2.5-3 times the volume of pre-chilled anhydrous ethanol and 5 μL of liver glycogen (20 mg / mL) to the centrifuge tube. Freeze for 1 hour or overnight. After removal, centrifuge at 12000 rpm for 15 min at 4°C, discard the liquid, and retain the precipitate. Add 500 μL of pre-chilled 70% ethanol (enough to cover the precipitate), gently pipette several times or shake to suspend the precipitate, and wash the precipitate. Centrifuge at 12000 rpm for 15 min, discard the liquid, and retain the precipitate (repeat this washing step twice). Finally, air dry or dry at 56°C to completely evaporate any remaining ethanol. Dissolve the obtained DNA precipitate by adding 5-25 μL of TE (pH 8.0) and store at -20°C.

[0031] Step 4) above is as follows: Mix the fragments labeled with 10 fluorescent dyes obtained by amplification, perform capillary electrophoresis using the Honor 1816 genetic analyzer and collect data, perform spectral correction according to the instrument's spectral mode, and adjust the addition ratio of the 10 fragments according to the fluorescence signal intensity of each color in the electrophoresis results to make the peak height uniform and consistent. The 10-color matrix standard is successfully constructed.

[0032] A kit for simultaneous multiplex amplification of 74 STR loci using a 10-color fluorescence detection multiplex amplification matrix system. The primers for multiplex amplification of 74 STR loci are labeled with nine fluorescent dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674 and ER685, and the fluorescent dye ER690 is used as an internal standard label.

[0033] The 74 STR loci include 29 autosomal STR loci, 41 Y-chromosome STR loci, 1 sex locus (Amel), and 3 Y-chromosome Indel loci. The 29 autosomal STR loci are: D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, D3S3045, D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, D22S1045, D19S433, D18S51, D6S1043, D15S659, D8S1179, D5S818, D21S11, FGA, D10S1435, D1 0S1248, TH01, D1S1656, TPOX, and D19S253; the 41 Y-chromosome STR loci are: DYS437, DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, DYS527(DYS527a+DYS527b), DYS391, DYS576, DY S447, DYS388, DYS643, DYS557, DYS460, DYS458, DYS19, DYF387S1 (DYF387Sla+DYF387Sl b), DYS593, DYS385 (DYS385a+DYS385b), DYS444, DYS393, DYS549, DYS439, DYS392, DYS44 8. DYS518, DYS645, DYS596, DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449 and DYF404S1 (DYF404Sla+DYF404Slb); the three Y chromosome indels are: rs759551978, rs771783753 and rs199815934.

[0034] The 74 STR loci were divided into nine groups, and at least one primer for each locus was labeled with a fluorescent dye at its 5' end:

[0035] Fluorescent dye FAM was used to label the amplification primers for loci D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, and D3S3045, respectively.

[0036] The fluorescent dye TET was used to label the amplification primers for loci DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, and DYS527a / b, respectively.

[0037] The fluorescent dye HEX was used to label the amplification primers for loci D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, and DYS437, respectively.

[0038] The fluorescent dye ER650 was used to label the amplification primers for loci Amel, D22S1045, D19S433, D18S51, D6S1043, DYS391, D15S659, and DYS576, respectively.

[0039] The fluorescent dye ER652 was used to label the amplification primers for loci D8S1179, D5S818, D21S11, FGA, D10S1435, and DYS447, respectively.

[0040] The fluorescent dye ER663 was used to label the amplification primers for loci D10S1248, TH01, D1S1656, TPOX, DYS388, DYS643, D19S253, and DYS557, respectively.

[0041] The fluorescent dye ER664 was used to label the amplification primers for loci DYS460, DYS458, DYS19, DYF387S1a / b, DYS593, DYS385a / b, DYS444, rs759551978, rs771783753, and rs199815934, respectively.

[0042] The fluorescent dye ER674 was used to label the amplification primers for loci DYS393, DYS549, DYS439, DYS392, DYS448, DYS518, DYS645, and DYS596, respectively.

[0043] The fluorescent dye ER685 was used to label the amplification primers for loci DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449, and DYF404S1a / b, respectively.

[0044] The fluorescent dye ER690 was used for internal standard labeling, and the labeling types of each upstream primer are shown in Table 1.

[0045] This application uses a 9-group fluorescent dye method to label and prepare a set of primers for multiplex amplification of 74 STR loci, which simultaneously amplifies 74 STR sites.

[0046] The sequences of the amplification primers for the above 74 STR loci are shown in Table 1, PM NO.01-PM NO.140, including 70 upstream primers labeled with different fluorescent dyes and 70 downstream primers without fluorescent labels;

[0047] The sequences, numbers, and working concentrations of the primers for amplification of 29 pairs of autosomal STR loci are as follows: D3S1358, PM NO.1-2, 0.044±0.002uM; vWA, PM NO.3-4, 0.112±0.002uM; D12S391, PM NO.5-7, 0.120±0.002uM; CSF1PO, PM NO.8-9, 0.093±0.002uM; Penta E, PM NO.10-11, 0.144±0.002uM; D6S477, PM NO.12-13, 0.096±0.002uM; D3S3045, PM NO.14-15, 0.072±0.002uM; D2S441, PM NO.1-2, 0.044±0.002uM; vWA, PM NO.3-4, 0.112±0.002uM; D12S391, PM NO.5-7, 0.120±0.002uM; D2S441, PM NO.1-2, 0.044±0.002uM; D3S3045, PM NO.14-15, 0.072 ... NO.31-32, 0.057±0.002uM; D16S539, PM NO.33-34, 0.067±0.002uM; D7S820, PM NO.35-36, 0.090±0.002uM; D13S317, PM NO.37-38, 0.093±0.002uM; D2S1338, PM NO.39-40, 0.060±0.002uM; Penta D, PM NO.41-42, 0.107±0.002uM; D8S1132, PMNO.43-44, 0.140±0.002uM; D22S1045, PM NO.49-50, 0.047±0.002uM; D19S433, PM NO.51-52, 0.087±0.002uM; D18S51, PM NO.53-54, 0.067±0.002uM; D6S1043, PM NO.55-56, 0.073±0.002uM; D15S659, PM NO.59-60, 0.087±0.002uM; D8S1179, PM NO.63-64, 0.067±0.002uM; D5S818, PM NO.65-66, 0.061±0.002uM; D21S11, PM NO.67-68, 0.067±0.002uM; FGA, PM NO.69-70, 0.072±0.002uM; D10S1435, PM NO.71-72, 0.200±0.002uM; D10S1248, PM NO.75-76, 0.144±0.002uM; TH01, PM NO.77-78, 0.072±0.002uM; D1S1656, PM NO.79-80, 0.102±0.002uM; TPOX, PM NO.81-82, 0.109±0.002uM; D19S253, PM NO.87-88, 0.073±0.002uM;

[0048] The sequences, numbers, and working concentrations of the primers for amplification of 41 Y-chromosome STR loci are as follows: DYS481, PM NO. 16-17, 0.087 ± 0.002 uM; DYS389, PM NO. 18-20, 0.073 ± 0.002 uM; DYS635, PM NO. 16-17, 0.087 ...389, PM NO. 16-17, 0.073 ± 0.002 uM; DYS635, PM NO. 16-17, 0.087 ± 0.002 uM; DYS389, PM NO. 16-20, 0.073

[0049] NO.21-22, 0.093±0.002uM; DYS533, PM NO.23-24, 0.117±0.002uM; DYS627, PMNO.25-26, 0.113±0.002uM; DYS522, PM NO.27-28, 0.080±0.002uM; DYS527a / b, PMNO.29-30, 0.087±0.002uM; DYS437, PM NO.45-46, 0.333±0.002uM; DYS391, PM

[0050] NO.57-58, 0.100±0.002uM; DYS576, PM NO.61-62, 0.267±0.002uM; DYS447, PM

[0051] NO.73-74, 0.400±0.002uM; DYS388, PM NO.83-84, 0.193±0.002uM; DYS643, PMNO.85-86, 0.167±0.002uM; DYS557, PM NO.89-90, 0.433±0.002uM; DYS460, PMNO.91-92, 0.104±0.002uM; DYS458, PM NO.93-94, 0.152±0.002uM; DYS19, PM NO.95-96, 0.200±0.002uM; DYF387S1a / b, PM NO.97-98, 0.120±0.002uM; DYS593, PM NO.99-100, 0.120±0.002uM; DYS385a / b, PM NO.101-102, 0.104±0.002uM; DYS444, PM NO.103-104, 0.467±0.002uM; DYS393, PM NO.111-112, 0.117±0.002uM; DYS549, PM NO.113-114, 0.103±0.002uM; DYS439, PM NO.115-116, 0.100±0.002uM; DYS392, PM NO.117-118, 0.133±0.002uM; DYS448, PM NO.119-120, 0.093±0.002uM; DYS518, PM NO.121-122, 0.147±0.002uM; DYS645, PM NO.123-124, 0.200±0.002uM; DYS596, PM NO.125-126, 0.467±0.002uM; DYS456, PM NO.127-128, 0.133±0.002uM; DYS570, PM NO.129-130, 0.173±0.002uM; DYS390, PM NO.131-132, 0.080±0.002uM; DYS438, PM NO.133-134, 0.107±0.002uM; Y_GATA_H4, PM NO.135-136, 0.213±0.002uM; DYS449, PM NO.137-138, 0.467±0.002uM; DYF404S1a / b, PM NO.139-140, 0.333±0.002uM;

[0052] The sequences, numbers, and working concentrations of the amplification primers for Amel at one sex locus are as follows: Amel, PM NO.47-48, 0.040±0.002uM;

[0053] The sequences, numbers, and working concentrations of the amplification primers for the three Y chromosome indels are as follows: rs759551978, PM NO.105-106, 0.240±0.002uM; rs771783753, PM NO.107-108, 0.240±0.002uM; rs199815934, PM NO.109-110, 0.400±0.002uM.

[0054] Table 1 Primer sequences and final concentrations for each locus

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062] The kit includes a composite primer set of 140 specific primers that simultaneously amplify 74 STR sites, a reaction mixture, and a hot-start Taq polymerase.

[0063] The above kit includes a 25 μL amplification reaction system: 10 μL of 2.5×PCR Mix, 5 μL of AY74 primer mixture, 1 μL of Taq DNA polymerase, 2.5 μL of template DNA, and 6.5 μL of deionized water; wherein, the AY74 primer mixture is a mixture of amplification primers for 74 loci; the 2.5×PCR Mix components are: 90 mM Tris-HCl (pH 8.4), 10 mM MgCl2, 125 mM KCl, 10 mg / ml BSA, and 6.0 mM dNTPs;

[0064] The aforementioned multiplex amplification kit also includes an allele ladder containing 74 STR loci, DNA standards, fluorescent molecular weight internal standard O-650 (ER690 labeled), and T10-Matrix.

[0065] The aforementioned multiplex amplification reagent is adaptable to amplification of different samples and has a wide annealing temperature range. The amplification reaction program is as follows: 95℃ for 3 min, 95℃ for 5 s, 62℃ for 90 s, 28-30 cycles; final extension at 60℃ for 20 min; hold at 4℃. The amplified products were analyzed for fluorescence signals using a genetic analyzer; the fluorescence signal data were collected, and the DNA genotyping results of the 74 loci were analyzed using gene analysis software.

[0066] The aforementioned STR loci include 20 core CODIS loci, among which Penta E, Penta D, and D6S1043 are highly polymorphic loci in the Chinese population. In addition to autosomal STRs, these STR loci also include 41 Y-chromosome STR loci, comprising 32 low-mutation-rate STR loci (mutation rate less than 1%) and 9 fast-mutation loci (mutation rate greater than 1%). All loci are located before 650 bp, making them suitable for kinship identification, database construction, and crime scene investigation.

[0067] The multiplex amplification and detection method of the detection kit using the 10-color fluorescent autosomal STR multiplex amplification system includes the following steps:

[0068] ① Sample processing: Extract genomic DNA from the sample as an amplification template or directly use an extraction-free sample as an amplification template;

[0069] ② Use the amplification primers shown in Table 1 (PM NO.1-140) to perform PCR amplification on the genomic DNA of the sample obtained in step ①;

[0070] ③ Use an Honor 1816 genetic analyzer to detect the fluorescence signal of the amplification product obtained in step ②;

[0071] ④ Collect fluorescence signal data and use gene analysis software to analyze the DNA typing results of the 74 loci.

[0072] In step ① above, the amplification template is either an extracted sample or a direct amplification sample. Extracted samples include human semen stains, blood, bodily fluids, hair, tissue, or bloodstains, as well as old or degraded samples. The main DNA genomic extraction methods are magnetic bead extraction or the Chelex 100 method. Direct amplification samples include human blood or oral cells collected using one or more carriers selected from filter paper, blood cards, cotton swabs, or FTA cards. The preferred amount of DNA template in the sample is 0.5 ng to 4 ng. The above-mentioned multiplex amplification kit can be applied to individual identification in the Chinese population, paternity testing, forensic identification, construction of autosomal DNA databases, and population genetics research.

[0073] Any techniques not mentioned in this invention are based on existing technologies.

[0074] Currently, there is no publicly available 10-color fluorescence detection system. Compared with existing technologies, the 10-color fluorescence multiplex amplification technology and reagent kit provided by this invention have the following advantages:

[0075] (1) This Matrix system is the first 10-color system in China;

[0076] (2) Based on resonant energy transfer technology, the emission spectral interval of 10 fluorescent dyes is ≥15nm, the spectral crosstalk rate is <0.01% (traditional 6-color system >0.5%), and the fluorescence intensity CV value is ≤2.8% (international competitors >5%).

[0077] (3) The ultra-multiplex STR detection system covers loci and 74 core loci (29 autosomal STRs + 41 Y-STRs + Amel + 3 Y-Indels), which improves detection efficiency;

[0078] (4) Simultaneous amplification of autosomes and Y chromosome (reducing the library preparation process by 2 steps), reducing the time and reagent costs of DNA library preparation;

[0079] (5) It can accommodate more small fragments, supports the enrichment of small fragments of 80-350bp, and improves the detection rate of degradation samples to more than 92%, reducing the possibility of large fragment peak loss;

[0080] (6) It has promoted technological innovation in the field of forensic medicine and driven the development of DNA analysis technology towards higher precision and wider application.

[0081] In summary, the introduction of 10-color fluorescence multiplex amplification technology and its kit application is an important supplement and upgrade to existing technologies. It not only addresses the limitations of existing technologies but also provides a powerful tool for more complex forensic DNA analysis needs. Attached Figure Description

[0082] Figure 1 The excitation and emission wavelengths of the 10 fluorescent dyes of this invention are shown.

[0083] Figure 2 The sequence is a random plasmid template 800;

[0084] Figure 3 This is the first step in creating a new form in Example 1;

[0085] Figure 4 Step 2 of creating a new form for Example 1;

[0086] Figure 5 This refers to the right-click menu for running the model in the second step of creating a new form in Example 1;

[0087] Figure 6This refers to the second step of creating a new form in Example 1, which involves editing and running the model.

[0088] Figure 7 This refers to the right-click menu for the second step of creating a new form in Example 1, which is the spectral correction standard.

[0089] Figure 8 In Example 1, edit the spectral acquisition parameters for the second step of creating a new form, which is the spectral calibration standard.

[0090] Figure 9 The 10-color Matrix standard sample successfully assembled in Example 1;

[0091] Figure 10 This is a layout diagram of the 10-color AY74 kit in Example 1;

[0092] Figure 11 The electrophoresis pattern of the 10-color AY74 kit in Example 3 is shown in the Allelic Ladder electrophoresis pattern.

[0093] Figure 12 The image shows the electrophoretic pattern of 1 ng DNA positive standard 9948 amplified by the 10-color AY74 kit in Example 3.

[0094] Figure 13 The electrophoretic pattern of 0.125 ng DNA positive standard 9948 amplified by the 10-color AY74 kit in Example 3;

[0095] Figure 14 The image shows the electrophoretic pattern of the blood card amplified using the 10-color AY74 kit in Example 3.

[0096] Figure 15 The image shows the electrophoretic pattern of the saliva card amplified by the 10-color AY74 kit in Example 3.

[0097] Figure 16 This is the electrophoretic pattern of hair (with follicles) amplified by the 10-color AY74 kit in Example 3.

[0098] Figure 17 The electrophoretic pattern of a degraded sample (an old blood card extracted in 2017) amplified by the 10-color AY74 kit in Example 3 is shown.

[0099] Figure 18 The image shows the electrophoretic pattern of a degraded sample (an old blood card extract from 2017) amplified using the Applied Biosystems kit in Example 3. Detailed Implementation

[0100] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments.

[0101] Example 1

[0102] 1.1 Sequencing Instrument Information:

[0103] This invention is based on the Suyuan Honor series genetic analyzer. This platform, through virtual dyeset combined with the adjustment of primer and dye concentrations, can achieve precise identification of emission wavelengths in the 520-720nm range. The applicable dye collection fluorescence spectral range of the ABI 3500 series and GA118-24B genetic analyzers cannot reach this range (Table 2). This invention achieves a breakthrough in the 10-color matrix system on the Suyuan Honor platform.

[0104] Table 2 Sequencing instrument parameter information

[0105] Honor1816 series ABI 3500 GA118-24B Place of origin China USA China Number of channels 16 / 24 / 96 8 / 24 24 Fluorescence detection count 5 / 6 / 8 / 9 / 10 5 / 6 5 / 6 / 9 laser Solid-state laser, 505nm Argon ion laser, 488nm solid-state laser Spectral wavelength range 520-720nm 520-650nm 522~650nm

[0106] 1.2 Selection of dyes for the 10-color fluorescent matrix system:

[0107] A method for constructing a 10-color fluorescence detection multiplex amplification matrix system is presented, using 10 dyes—FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690—for combined labeling. FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, and ER685 are used to label amplification primers, while ER690 is used to label the internal standard. The 10 fluorescent dyes used in the 10-color fluorescence detection multiplex amplification matrix system have been optimized and screened, meeting the following requirements: 1) The emission wavelength range of the 10 fluorescence colors is determined to be between 480-710 nm based on the emission wavelength of the genotyping instrument's laser and the range of the CCD. 2) The emission spectra of the 10 fluorescence colors are distinguishable and do not interpenetrate. 3) The emission intensities of the 10 fluorescence colors are as uniform as possible. (See Table 3.) Figure 1 )

[0108] Table 3 Excitation and emission wavelength ranges of 10 fluorescent dyes

[0109]

[0110] 1.3 PCR amplification using a 10-color fluorescent matrix system:

[0111] Using random plasmid 800 as a template, the template sequence is shown below. Figure 2Ten fragments of different sizes were amplified to prepare Matrix standards. Using specialized primer design software, ten downstream primer sequences with fragment sizes of 80bp, 100bp, 120bp, 140bp, 160bp, 180bp, 200bp, 220bp, 260bp, and 280bp were designed with a fixed upstream primer. The primer sequences are shown in Table 4. These primers were synthesized by the company's in-house primer synthesis department.

[0112] Table 4 Primer sequences

[0113]

[0114] Ten fragments were amplified by PCR, including one fragment labeled with each of the ten fluorescent dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690, with a molecular weight difference of 20 bp between each fragment. The total PCR volume was 50 μL, including 20 μL of PCR Mix, 0.5 μL of Taq polymerase, 1 μL of labeled primers, 2.5 μL of unlabeled primers, 1 μL of DNA template, and water to a final volume of 50 μL. The PCR program was as follows: 95℃ for 3 min; 94℃ for 30 s, 62℃ for 30 s, 72℃ for 45 s, for a total of 35 cycles; 72℃ for 15 min; and PCR products were stored at 4℃.

[0115] 1.4. Assembly of the 10-color fluorescent matrix system:

[0116] Ten amplified fragments with different fluorescence were each taken in 1 μL and combined to form a 10 μL matrix fragment mixture, which was then mixed with 160 μL of deionized formamide. Capillary electrophoresis was performed using an Honor 1816 genetic analyzer to collect data. Spectral calibration was performed according to the instrument's spectral mode. Click "New Form," name it "C10," select "SpectralCal" as the application type, and click Next. Figure 3 As shown.

[0117] The sample name is "C10", the dye set is "C10", the running model is "SpectralCal36_pop7" which is currently available on the instrument, and the spectral calibration standard is "GeneScan-SetC10". Figure 4 Right-click "SpectralCal36_pop7" and select "Edit Run Model" (). Figure 5 Enter "12" for sample loading time, "1.2" for sample loading voltage, and "1200" for running time. Leave other settings as default and click OK. Figure 6 Right-click "GeneScan-SetC10" and select "Spectral Correction Standard" (). Figure 7 Enter "0.75" for the minimum mass number, leave the other settings as default, and click OK. Figure 8 Click OK to complete the form editing. Then link the edited form to drive A or drive B where the sample is located, and click Run.

[0118] Based on the fluorescence signal intensity of each color in the electrophoresis results, the dosage ratio of the 10 fragments was adjusted to ensure consistent peak height. The 10-color matrix standard was successfully constructed. (See attached image) Figure 9 .

[0119] Under essentially unchanged detection equipment and conditions, the spectral overlap between different fluorescent dyes remains relatively stable in terms of intensity ratio, and the degree of cross-interference among various fluorescent dyes can be quantitatively described using a matrix numerical table. This numerical table, which quantitatively represents the relative proportions of the intensities of various color signals within a fluorescent fragment peak, is called the Matrix numerical table for STR fluorescent labeling detection and analysis technology, and the corresponding computer file constructed from this table is called a Matrix file. The Matrix numerical table obtained in this study is shown in Table 5.

[0120] Table 5 Matrix values

[0121] FAM TET HEX ER650 ER652 ER663 ER664 ER674 ER685 ER690 FAM 1.000 0.814 0.466 0.242 0.127 0.073 0.021 0.021 0.017 0.017 TET 0.527 1.000 0.612 0.320 0.169 0.094 0.076 0.023 0.023 0.034 HEX 0.107 0.378 1.000 0.470 0.287 0.158 0.092 0.063 0.051 0.034 ER650 0.023 0.071 0.522 1.000 0.440 0.234 0.119 0.068 0.030 0.017 ER652 0.104 0.083 0.122 0.587 1.000 0.550 0.305 0.192 0.112 0.099 ER663 0.141 0.110 0.076 0.096 0.406 1.000 0.709 0.356 0.234 0.186 ER664 0.149 0.126 0.083 0.046 0.074 0.334 1.000 0.589 0.264 0.200 ER674 0.195 0.166 0.106 0.074 0.068 0.083 0.507 1.000 0.489 0.277 ER685 0.024 0.137 0.357 0.156 0.093 0.047 0.069 0.502 1.000 0.779 ER690 0.054 0.270 0.624 0.290 0.177 0.075 0.060 0.195 0.835 1.000

[0122] The aforementioned matrix system is the first 10-color system in China; the 10 fluorescence emission spectra can be distinguished and do not interpenetrate; the 10 fluorescence emission intensities are strong and the colors are uniform; it can be compatible with 74 or even more loci, improving detection efficiency; it can accommodate more small fragments, greatly improving the detection rate of difficult samples such as trace samples and degraded samples, and reducing the possibility of large fragment peak loss.

[0123] Example 2

[0124] To better understand the present invention, the following embodiment 2 further clarifies the content of the present invention, but the content of the present invention is not limited to the following embodiment.

[0125] 2.1 Locus selection and arrangement for the AY74 kit with a 10-color fluorescent matrix system:

[0126] Based on the successfully constructed 10-color matrix spectrum, and referring to the standard GB / T 41009-2021 "Selected Loci and Data Structures for Forensic Science DNA Databases," recommended core and preferred loci were screened. Following primer design principles, professional primer design software was used for design. The entire primer set should be designed with uniform parameters to ensure consistent annealing temperatures. Screening was conducted to avoid or reduce interference between primers, achieving amplification stability and balance. Primer amplification specificity was detected using the Primer-BLAST function in NCBI, and species specificity of these designed loci primers was considered using genomic data from other species in the database.

[0127] The final 74 loci identified (locus arrangement diagram as shown) Figure 10 As shown below: D3S1358, vWA, D12S391, CSF1PO, Penta D 8S1132, DYS437, Amel, D22S1045, D19S433, D18S51, D6S1043, DYS391, D15S 659, DYS576, D8S1179, D5S818, D21S11, FGA, D10S1435, DYS447, D10S1248, T H01, D1S1656, TPOX, DYS388, DYS643, D19S253, DYS557, DYS460, DYS458, DYS19, DYF387S1a / b, DYS593, DYS385a / b, DYS444, rs759551978, rs771783753 , rs199815934, DYS393, DYS549, DYS439, DYS392, DYS448, DYS518, DYS645, DYS596, DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449 and DYF404S1a / b.

[0128] The aforementioned STR loci include 20 core CODIS loci, among which Penta E, Penta D, and D6S1043 are highly polymorphic loci in the Chinese population. In addition to autosomal STRs, these STR loci also include 41 Y-chromosome STR loci, comprising 32 low-mutation-rate STR loci (mutation rate less than 1%) and 9 fast-mutation loci (mutation rate greater than 1%). All loci are located before 650 bp, making them suitable for kinship identification, database construction, and crime scene investigation.

[0129] A kit for detecting multiplex amplification matrix system using 10-color fluorescence uses nine fluorescent dyes, FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674 and ER685, to label primers for multiplex amplification of 74 STR loci, and uses fluorescent dye ER690 as an internal standard label.

[0130] The 74 STR loci include 29 autosomal STR loci, 41 Y-chromosome STR loci, 1 sex locus (Amel), and 3 Y-chromosome Indel loci. The 29 autosomal STR loci are: D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, D3S3045, D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, D22S1045, D19S433, D18S51, D6S1043, D15S659, D8S1179, D5S818, and D21S11. FGA, D10S1435, D10S1248, TH01, D1S1656, TPOX, and D19S253; the 41 Y-chromosome STR loci are: DYS437, DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, DYS527a / b. DYS391, DYS576, DYS447, DYS388, DYS643, DYS557, DYS460, DYS458, DYS19, DYF387S1a / b, DYS593, DYS385a / b, DYS444, DYS393, DYS549, DYS439, DYS392, DYS 448, DYS518, DYS645, DYS596, DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449 and DYF404S1a / b; the three Y chromosome indels are: rs759551978, rs771783753 and rs199815934.

[0131] The 74 STR loci were divided into nine groups, and at least one primer for each locus was labeled with a fluorescent dye at its 5' end:

[0132] Fluorescent dye FAM was used to label the amplification primers for loci D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, and D3S3045, respectively.

[0133] The fluorescent dye TET was used to label the amplification primers for loci DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, and DYS527a / b, respectively.

[0134] The fluorescent dye HEX was used to label the amplification primers for loci D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, and DYS437, respectively.

[0135] The fluorescent dye ER650 was used to label the amplification primers for loci Amel, D22S1045, D19S433, D18S51, D6S1043, DYS391, D15S659, and DYS576, respectively.

[0136] The fluorescent dye ER652 was used to label the amplification primers for loci D8S1179, D5S818, D21S11, FGA, D10S1435, and DYS447, respectively.

[0137] The fluorescent dye ER663 was used to target loci D10S1248, TH01, D1S1656, TPOX, DYS388, DYS643, D19S253, and DYS557, respectively.

[0138] The fluorescent dye ER664 was used to label the amplification primers for loci DYS460, DYS458, DYS19, DYF387S1a / b, DYS593, DYS385a / b, DYS444, rs759551978, rs771783753, and rs199815934, respectively.

[0139] The fluorescent dye ER674 was used to label the amplification primers for loci DYS393, DYS549, DYS439, DYS392, DYS448, DYS518, DYS645, and DYS596, respectively.

[0140] The fluorescent dye ER685 was used to label the amplification primers for loci DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449, and DYF404S1a / b, respectively.

[0141] The 140 specific primers for 74 STR sites include 70 upstream primers labeled with different fluorescent dyes and 70 downstream primers without fluorescent labels. The primer sequences of the composite primer set of the 140 specific primers are the nucleotide sequences of PM NO.1 to PM NO.140 in Table 1. See Table 1 for details.

[0142] 2.2 Construction of the 10-color fluorescent matrix system AY74 kit amplification system:

[0143] PCR amplification was performed using the multiplex primer set containing 74 STR gene loci obtained from the final concentration in Table 1. The extracted sample or direct amplification sample was used as a template, and the reaction mixture was prepared according to Table 6.

[0144] Table 6. Amounts of each component added in the PCR system preparation.

[0145]

[0146] The AY74 primer mixture is a mixture of amplification primers for 74 loci; the 2.5×PCR Mix consists of: 90mM Tris-HCl at pH 8.4, 10mM MgCl2, 125mM KCl, 10mg / ml BSA, and 6.0mM dNTPs.

[0147] The AY74 multiplex amplification kit also includes an allele ladder containing 74 STR loci, DNA standards, fluorescent molecular weight internal standard O-650 (ER690 labeled), and T10-Matrix.

[0148] The amplification reaction program was as follows: 95℃ for 3 min, 95℃ for 5 s, 62℃ for 90 s, 28-30 cycles; final extension at 60℃ for 20 min; hold at 4℃. The amplified products were analyzed for fluorescence signal detection using a genetic analyzer; the fluorescence signal data were collected, and the DNA genotyping results of the 74 loci were analyzed using gene analysis software.

[0149] 2.3. Capillary electrophoresis of PCR products from the AY74 kit:

[0150] The AY74 PCR amplification product obtained above was mixed with 1 μL of the allele standard genotyping ladder, 0.15 μL of O-650 molecular weight internal standard, and 9 μL of deionized formamide. The mixture was then subjected to capillary electrophoresis using a Suyuan Honor 1816 genetic analyzer. Electrophoresis parameters: injection time 12 s, injection voltage 1.2 kV; other parameters were set to machine defaults. Electrophoresis data were collected using acquisition software and analyzed using Suyuan GeneMapper software. The allele genotyping standards provided in this invention are product groups derived from the amplification of corresponding allele plasmids using primers at each STR locus. DNA positive standard 9948 was purchased from Suzhou Xinhai Biotechnology Co., Ltd., and hot-start Taq DNA polymerase was purchased from Takara Bio Inc. Figure 11 Electrophoresis pattern for Allelic Ladder.

[0151] Example 3

[0152] AY74 kit positive standard amplification test:

[0153] Using 1 ng and 0.125 ng of DNA positive standard 9948 as templates, the reagents were prepared according to the amplification system following the steps of the above-described specific implementation method 2. After centrifugation, the reagents were loaded onto the instrument for PCR amplification. Capillary electrophoresis was performed using the Honor 1816 genetic analyzer to obtain STR typing data. Data analysis was performed using the Honor GeneMapper software.

[0154] Figure 12 The electrophoretic pattern of 1 ng DNA positive standard 9948. Figure 13 The image shows the electrophoretic pattern of 0.125 ng of DNA positive standard 9948. The AY74 kit developed using the 10-color system of this invention amplifies the positive standard 9948, yielding accurate and clear DNA typing. Both the molecular weight internal standard and the allele typing standards can accurately calibrate the typing. Accurate typing is still possible even at a DNA concentration of 0.03 ng, allowing for complete detection.

[0155] AY74 kit for various direct amplification tests on samples:

[0156] Using blood cards, saliva cards, and hair (with follicles) as templates, the reagents were prepared according to the amplification system following the steps of Specific Implementation Method 2 described above. After centrifugation and shaking, PCR amplification was performed. Capillary electrophoresis was performed using the Honor 1816 genetic analyzer to obtain STR typing data. Data analysis was performed using the Honor GeneMapper software.

[0157] Figure 14-16The electrophoretic patterns amplified using blood cards, saliva cards, and hair (with follicles) as templates, along with the AY74 kit developed using the 10-color system of this invention, can amplify various direct amplification samples to obtain accurate and clear DNA typing. Furthermore, both the molecular weight internal standard and the allele typing standard can accurately calibrate the typing.

[0158] AY74 kit degradation sample amplification test:

[0159] Using a degraded sample (extracted from an old blood card in 2017) as a template, the reagents were prepared according to the amplification system and centrifuged after shaking before PCR amplification was performed. STR typing data were obtained using a Suyuan Honor 1816 genetic analyzer and analyzed using Suyuan GeneMapper software.

[0160] Figure 17 The image shows the electrophoretic pattern of amplified and degraded samples (blood card extracts from 2017) using a 10-color AY74 kit. Figure 18 The electrophoretic patterns of the same samples amplified using the Applied Biosystems kit are shown. The kit of this invention significantly improves the peak height and uniformity of degraded samples compared to traditional six-color STR kits, and also significantly increases the detection rate of large fragments, allowing for the acquisition of more genetic information from degraded samples.

Claims

1. The use of a class of fluorescent dyes, characterized in that: This system is a 10-color fluorescence detection multiplex amplification matrix system. The fluorescent dyes include 10 dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. These 10 dyes are used for combined labeling. FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, and ER685 are used to label amplification primers, while ER690 is used to label the internal standard. The 10 fluorescence emission spectra are distinguishable and do not interpenetrate. The wavelengths of the 10 fluorescent dyes are in the range of 480-710 nm. The specific chemical structures of each dye are as follows:

2. A method for detecting a multiplex amplification matrix system using 10-color fluorescence detection, characterized in that: A 10-color fluorescence analysis system was established by combining 10 dyes for labeling. The 10 fluorescence emission spectra can be distinguished and do not interpenetrate. The 10 dyes are FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685 and ER690.

3. The method for detecting a multiplex amplification matrix system using 10-color fluorescence detection as described in claim 2, characterized in that: The specific steps are as follows: 1) Ten fluorescent dyes were selected for combined labeling: the ten dyes were FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685, and ER690. Among them, FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, and ER685 were used to label amplification primers, and ER690 was used to label internal standards. The emission wavelength range of the ten fluorescent dyes was between 480-710 nm. The fluorescence emission spectra of the ten fluorescent dyes were distinguishable and did not interpenetrate, and the fluorescence emission intensity of the ten dyes was uniform. 2) Matrix primer design: Using random plasmid 800 as a template, with fixed upstream primer sequences, 10 downstream primer sequences with fragment sizes of 80bp, 100bp, 120bp, 140bp, 160bp, 180bp, 200bp, 220bp, 260bp and 280bp were designed. During primer synthesis, 10 different dyes were used to fluorescently label the 5' end of the primers. 3) Matrix PCR amplification and assembly: PCR amplification of 10 fragments, including one fragment labeled with each of 10 fluorescent dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674, ER685 and ER690, and the molecular weight of each fragment must differ by at least 20 bp. 4) Adjust the peak height balance of the 10 segments, and the 10-color Matrix standard product is successfully assembled.

4. The method as described in claim 3, characterized in that: The excitation and emission wavelengths of the 10 fluorescent dyes in step 1) are as follows:

5. The method as described in claim 3 or 4, characterized in that: The primer sequences designed in step 2) are shown in the table below:

6. The method as described in claim 3 or 4, characterized in that: In step 3), the total PCR volume for PCR amplification is 50 μL, including 20 μL of PCR Mix, 0.5 μL of Taq polymerase, 1 μL of labeled primers, 2.5 μL of unlabeled primers, 1 μL of DNA template, and water added to bring the volume to 50 μL. The PCR program is as follows: 95℃ for 3 min; 94℃ for 30 s, 62℃ for 30 s, 72℃ for 45 s, for a total of 35 cycles; 72℃ for 15 min; and PCR products are stored at 4℃.

7. The method as described in claim 3 or 4, characterized in that: Step 4) involves mixing the fragments labeled with the 10 fluorescent dyes obtained from the amplification, performing capillary electrophoresis using the Honor 1816 genetic analyzer, collecting data, performing spectral correction according to the instrument's spectral mode, and adjusting the dosage ratio of the 10 fragments based on the fluorescence signal intensity of each color in the electrophoresis results to ensure consistent peak height. The 10-color matrix standard is then successfully constructed.

8. A kit for simultaneous multiplex amplification of 74 STR loci using a 10-color fluorescence detection multiplex amplification matrix system, characterized in that: Primers for multiplex amplification of 74 STR loci were labeled using nine fluorescent dyes: FAM, TET, HEX, ER650, ER652, ER663, ER664, ER674 and ER685. Fluorescent dye ER690 was used as an internal standard. The 74 STR loci include 29 autosomal STR loci, 41 Y-chromosome STR loci, 1 sex locus (Amel), and 3 Y-chromosome Indel loci. The 29 autosomal STR loci are: D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, D3S3045, D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, D22S1045, D19S433, D18S51, D6S1043, D15S659, D8S1179, D5S818, D21S11, FGA, D1 0S1435, D10S1248, TH01, D1S1656, TPOX, and D19S253; the 41 Y-chromosome STR loci are: DYS437, DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, DYS527a, DYS527b, and DYS391. , DYS576, DYS447, DYS388, DYS643, DYS557, DYS460, DYS458, DYS19, DYF387Sla, DYF387Slb, DYS593, DYS385a, DYS385b, DYS444, DYS393, DYS549, DYS439, DYS392, DYS4 48, DYS518, DYS645, DYS596, DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449, DYF404Sla and DYF404Slb; the three Y chromosome indels are: rs759551978, rs771783753 and rs199815934; The 74 STR loci were divided into nine groups, and at least one primer for each locus was labeled with a fluorescent dye at its 5' end: Fluorescent dye FAM was used to label the amplification primers for loci D3S1358, vWA, D12S391, CSF1PO, Penta E, D6S477, and D3S3045, respectively. The fluorescent dye TET was used to label the amplification primers for loci DYS481, DYS389I, DYS635, DYS389II, DYS533, DYS627, DYS522, and DYS527a / b, respectively. The fluorescent dye HEX was used to label the amplification primers for loci D2S441, D16S539, D7S820, D13S317, D2S1338, PentaD, D8S1132, and DYS437, respectively. The fluorescent dye ER650 was used to label the amplification primers for loci Amel, D22S1045, D19S433, D18S51, D6S1043, DYS391, D15S659, and DYS576, respectively. The fluorescent dye ER652 was used to label the amplification primers for loci D8S1179, D5S818, D21S11, FGA, D10S1435, and DYS447, respectively. The fluorescent dye ER663 was used to label the amplification primers for loci D10S1248, TH01, D1S1656, TPOX, DYS388, DYS643, D19S253, and DYS557, respectively. The fluorescent dye ER664 was used to label the amplification primers for loci DYS460, DYS458, DYS19, DYF387S1a / b, DYS593, DYS385a / b, DYS444, rs759551978, rs771783753, and rs199815934, respectively. The fluorescent dye ER674 was used to label the amplification primers for loci DYS393, DYS549, DYS439, DYS392, DYS448, DYS518, DYS645, and DYS596, respectively. The fluorescent dye ER685 was used to label the amplification primers for loci DYS456, DYS570, DYS390, DYS438, Y_GATA_H4, DYS449, and DYF404S1a / b, respectively. The fluorescent dye ER690 was used for internal standard labeling, and the labeling types of each upstream primer are shown in Table 1.

9. The reagent kit as described in claim 8, characterized in that: The sequences of amplification primers for the 74 STR loci are shown in Table 1, PM NO.01-PM NO.140, including 70 upstream primers labeled with different fluorescent dyes and 70 downstream primers without fluorescent labels. The sequences, numbers, and working concentrations of the primers for amplification of 29 pairs of autosomal STR loci are as follows: D3S1358, PM NO.1-2, 0.044±0.002uM; vWA, PM NO.3-4, 0.112±0.002uM; D12S391, PM NO.5-7, 0.120±0.002uM; CSF1PO, PM NO.8-9, 0.093±0.002uM; Penta E, PM NO.10-11, 0.144±0.002uM; D6S477, PM NO.12-13, 0.096±0.002uM; D3S3045, PM NO.14-15, 0.072±0.002uM; D2S441, PM NO.1-2, 0.044±0.002uM; vWA, PM NO.3-4, 0.112±0.002uM; D12S391, PM NO.5-7, 0.120±0.002uM; D2S441, PM NO.1-2, 0.044±0.002uM; D3S3045, PM NO.14-15, 0.072 ... NO.31-32, 0.057±0.002uM; D16S539, PM NO.33-34, 0.067±0.002uM; D7S820, PMNO.35-36, 0.090±0.002uM; D13S317, PM NO.37-38, 0.093±0.002uM; D2S1338, PM NO.39-40, 0.060±0.002uM; Penta D, PM NO.41-42, 0.107±0.002uM; D8S1132, PM NO.43-44, 0.140±0.002uM; D22S1045, PM NO.49-50, 0.047±0.002uM; D19S433, PM NO.51-52, 0.087±0.002uM; D18S51, PM NO.53-54, 0.067±0.002uM; D6S1043, PM NO.55-56, 0.073±0.002uM; D15S659, PM NO.59-60, 0.087±0.002uM; D8S1179, PM NO.63-64, 0.067±0.002uM; D5S818, PM NO.65-66, 0.061±0.002uM; D21S11, PM NO.67-68, 0.067±0.002uM; FGA, PM NO.69-70, 0.072±0.002uM; D10S1435, PM NO.71-72, 0.200±0.002uM; D10S1248, PM NO.75-76, 0.144±0.002uM; TH01, PM NO.77-78, 0.072±0.002uM; D1S1656, PM NO.79-80, 0.102±0.002uM; TPOX, PM NO.81-82, 0.109±0.002uM; D19S253, PM NO.87-88, 0.073±0.002uM; The sequences, numbers, and working concentrations of the primers for amplification of 41 Y-chromosome STR loci are as follows: DYS481, PM NO. 16-17, 0.087±0.002uM; DYS389, PM NO. 18-20, 0.073±0.002uM; DYS635, PM NO. 21-22, 0.093±0.002uM; DYS533, PM NO. 23-24, 0.117±0.002uM; DYS627, PM NO. 25-26, 0.113±0.002uM; DYS522, PM NO. 27-28, 0.080±0.002uM; DYS527a / b, PM NO. 29-30, 0.087±0.002uM; DYS437, PM NO. 29-30, 0.087±0.002uM; DYS437, PM NO. 29-2 ... NO.45-46, 0.333±0.002uM; DYS391, PMNO.57-58, 0.100±0.002uM; DYS576, PM NO.61-62, 0.267±0.002uM; DYS447, PMNO.73-74, 0.400±0.002uM; DYS388, PM NO.83-84, 0.193±0.002uM; DYS643, PMNO.85-86, 0.167±0.002uM; DYS557, PM NO.89-90, 0.433±0.002uM; DYS460, PMNO.91-92, 0.104±0.002uM; DYS458, PM NO.93-94, 0.152±0.002uM; DYS19, PMNO.95-96, 0.200±0.002uM; DYF387S1a / b, PM NO.97-98, 0.120±0.002uM; DYS593, PMNO.99-100, 0.120±0.002uM; DYS385a / b, PM NO.101-102, 0.104±0.002uM; DYS444, PMNO.103-104, 0.467±0.002uM; DYS393, PM NO.111-112, 0.117±0.002uM; DYS549, PMNO.113-114, 0.103±0.002uM; DYS439, PM NO.115-116, 0.100±0.002uM; DYS392, PMNO.117-118, 0.133±0.002uM; DYS448, PM NO.119-120, 0.093±0.002uM; DYS518, PMNO.121-122, 0.147±0.002uM; DYS645, PM NO.123-124, 0.200±0.002uM; DYS596, PMNO.125-126, 0.467±0.002uM; DYS456, PM NO.127-128, 0.133±0.002uM; DYS570, PMNO.129-130, 0.173±0.002uM; DYS390, PM NO.131-132, 0.080±0.002uM; DYS438, PMNO.133-134, 0.107±0.002uM; Y_GATA_H4, PM NO.135-136, 0.213±0.002uM; DYS449, PMNO.137-138, 0.467±0.002uM; DYF404S1a / b, PM NO.139-140, 0.333±0.002uM;. The sequences, numbers, and working concentrations of the amplification primers for Amel at one sex locus are as follows: Amel, PM NO.47-48, 0.040±0.002uM; The sequences, numbers, and working concentrations of the amplification primers for the three Y chromosome indels are as follows: rs759551978, PM NO.105-106, 0.240±0.002uM; rs771783753, PM NO.107-108, 0.240±0.002uM; rs199815934, PM NO.109-110, 0.400±0.002uM.

10. The kit as described in claim 8 or 9, characterized in that: The amplification reaction system consists of 25 μL of the following components: 10 μL of 2.5×PCRMix, 5 μL of AY74 primer mixture, 1 μL of Taq DNA polymerase, 2.5 μL of template DNA, and 6.5 μL of deionized water. The AY74 primer mixture contains a mixture of primers for 74 gene loci. The 2.5×PCR Mix consists of: 90 mM Tris-HCl (pH 8.4), 10 mM MgCl2, 125 mM KCl, 10 mg / ml BSA, and 6.0 mM dNTPs. The amplification reaction program is as follows: 95℃ for 3 min, 95℃ for 5 s, 62℃ for 90 s, 28-30 cycles; final extension at 60℃ for 20 min; hold at 4℃.